ID: 924548781

View in Genome Browser
Species Human (GRCh38)
Location 1:245054673-245054695
Sequence TGTATTGGCTGGGAAAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924548781_924548784 -10 Left 924548781 1:245054673-245054695 CCTTCTCTTTCCCAGCCAATACA No data
Right 924548784 1:245054686-245054708 AGCCAATACATTCTACGTAGAGG 0: 1
1: 0
2: 0
3: 2
4: 45
924548781_924548787 21 Left 924548781 1:245054673-245054695 CCTTCTCTTTCCCAGCCAATACA No data
Right 924548787 1:245054717-245054739 TGCTCCTGTGGCTTCATGACCGG 0: 1
1: 0
2: 2
3: 17
4: 147
924548781_924548786 9 Left 924548781 1:245054673-245054695 CCTTCTCTTTCCCAGCCAATACA No data
Right 924548786 1:245054705-245054727 GAGGAGCTCTTCTGCTCCTGTGG 0: 1
1: 0
2: 1
3: 19
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924548781 Original CRISPR TGTATTGGCTGGGAAAGAGA AGG (reversed) Intronic
No off target data available for this crispr