ID: 924552037

View in Genome Browser
Species Human (GRCh38)
Location 1:245087956-245087978
Sequence CATTGGAACTAGAGAAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 352}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924552033_924552037 19 Left 924552033 1:245087914-245087936 CCAGCATGTCACCATTTATGGAG 0: 1
1: 0
2: 0
3: 4
4: 128
Right 924552037 1:245087956-245087978 CATTGGAACTAGAGAAAAGAAGG 0: 1
1: 0
2: 1
3: 34
4: 352
924552035_924552037 8 Left 924552035 1:245087925-245087947 CCATTTATGGAGTAGCTAAAGGA 0: 1
1: 0
2: 1
3: 10
4: 133
Right 924552037 1:245087956-245087978 CATTGGAACTAGAGAAAAGAAGG 0: 1
1: 0
2: 1
3: 34
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924552037 Original CRISPR CATTGGAACTAGAGAAAAGA AGG Intronic
901564167 1:10098571-10098593 CACTGGAGCAAGAGAAGAGAGGG - Intronic
902787986 1:18745441-18745463 CATTGGGACTCCAGCAAAGAGGG + Intronic
903320093 1:22538004-22538026 CATGGGAAGTAGAGAAACCAGGG + Intergenic
903746276 1:25588909-25588931 CATAGGACCTAAAGACAAGATGG - Intergenic
905649790 1:39648504-39648526 CATTGGGCCCAGAGTAAAGATGG + Intergenic
907588431 1:55642725-55642747 CACTGGAACTAGATAATTGAGGG - Intergenic
908079106 1:60556151-60556173 GATTGGACATAGAGGAAAGAAGG - Intergenic
908546375 1:65166214-65166236 CATTAGGACTCCAGAAAAGAAGG - Intronic
908648736 1:66308942-66308964 CCTTGTAATTAGAAAAAAGAAGG + Intronic
909095395 1:71280897-71280919 TACTTGAAGTAGAGAAAAGATGG + Intergenic
910085270 1:83394512-83394534 TATTGGAAGCAAAGAAAAGAAGG + Intergenic
911799549 1:102118386-102118408 GATTGGAACAAGTGAAAGGAGGG + Intergenic
912193424 1:107368171-107368193 CATTGGAACCAGAGGTAATAAGG - Intronic
912997978 1:114550731-114550753 AATGTGAACTTGAGAAAAGAAGG + Intergenic
914903524 1:151725792-151725814 CAATGGAAATAGACAAAACATGG - Intronic
915390025 1:155534363-155534385 CAATGGAAATAGAGAAAAACGGG + Intronic
915950015 1:160183467-160183489 CAGGGGAATCAGAGAAAAGAGGG - Intronic
916308271 1:163364403-163364425 CATTGGAACTAGTGTAAAATAGG - Intergenic
916506343 1:165431287-165431309 CATCTGAAGGAGAGAAAAGAGGG + Intronic
917019998 1:170575996-170576018 CATTAGAACCAGACAAAAAATGG - Intergenic
917161928 1:172067336-172067358 CAATGGAAATGGAGAAAAGTGGG - Intronic
917308188 1:173649127-173649149 CATTGGAAATAAACAATAGAAGG - Intronic
918867091 1:189915798-189915820 CATTTTAACTAGAGAAATTAAGG - Intergenic
918932550 1:190873468-190873490 CATTTGAACTAGGGAAATGGAGG + Intergenic
919125509 1:193388310-193388332 CAGTACAACTAGAGAAAAGCAGG - Intergenic
921055432 1:211539134-211539156 CATTGCAACCAGAGAATGGAGGG + Intergenic
921448670 1:215276764-215276786 CATTGCAACAACAGAATAGAAGG + Intergenic
923916655 1:238513767-238513789 CATTGGTAATAGTGACAAGAAGG - Intergenic
924552037 1:245087956-245087978 CATTGGAACTAGAGAAAAGAAGG + Intronic
924717525 1:246591399-246591421 CATTGTAAATAGGGAAGAGAAGG - Intronic
1062821189 10:535660-535682 CATTGCATCTTGAGAAAAGATGG - Intronic
1064461498 10:15539123-15539145 CATTTCAACTACAGAATAGAGGG + Intronic
1065933188 10:30497405-30497427 CATTTCAAATAGAGAAAAGGGGG + Intergenic
1066318613 10:34276449-34276471 CATTTTAATTAGAGAAAAGGTGG - Intronic
1067915775 10:50396484-50396506 TTTTGGAACTAGAGAGAGGAAGG + Intronic
1069367709 10:67711440-67711462 GATAGGAACTGGAGAAAAGGTGG + Intergenic
1070606572 10:77902468-77902490 CATTGTAAGTACAGAAAAAATGG + Intronic
1071345869 10:84692025-84692047 CATTGTAACAAGAGAAAAGGAGG + Intergenic
1071874700 10:89832467-89832489 GATTGGAACAGGAGAAAAGAGGG - Intergenic
1071935672 10:90527346-90527368 AATTGCAACTAGAGAGAAGGAGG - Intergenic
1073018827 10:100423996-100424018 AAAAGTAACTAGAGAAAAGATGG + Intergenic
1073167107 10:101465045-101465067 CATATGCAATAGAGAAAAGAGGG - Intronic
1074200763 10:111233167-111233189 CAGAGGAACCAGAGAGAAGATGG - Intergenic
1074569659 10:114612904-114612926 AATTGGAATTAGAGAGTAGAAGG - Intronic
1074918975 10:117988076-117988098 GTATGGAAATAGAGAAAAGAAGG - Intergenic
1075023237 10:118966465-118966487 CCTTAGAATTAGAGAAAGGAAGG + Intergenic
1077773907 11:5250211-5250233 CACTGGAGCTAGAGACAAGAAGG - Intronic
1077774409 11:5255139-5255161 CACTGGAGCTACAGACAAGAAGG - Exonic
1077799479 11:5523733-5523755 CATAGGATCTAGAACAAAGATGG - Intronic
1078405867 11:11069484-11069506 CACTCGGCCTAGAGAAAAGAAGG - Intergenic
1078712187 11:13804516-13804538 CATTGGAACTATAGATTAGTCGG - Intergenic
1078796870 11:14600922-14600944 AATTGGAACTACACAAAAGTGGG - Intronic
1079521841 11:21337485-21337507 CACTGCAACAACAGAAAAGAAGG + Intronic
1080409224 11:32007756-32007778 GAGTGGAACTAGAGAAAGGAAGG + Intronic
1080902952 11:36512897-36512919 CATTGAAACTATAGAAGATATGG - Intronic
1082752821 11:57039003-57039025 CAGGGAAACTAGGGAAAAGATGG - Intergenic
1082801231 11:57416363-57416385 GATGCGAAATAGAGAAAAGAGGG + Intronic
1082966319 11:58969483-58969505 CATTTGAACAAGGGAAAAGATGG + Intronic
1084731456 11:71076198-71076220 CCTTGGACCTGGAGAAAAGTCGG + Intronic
1086541954 11:87923487-87923509 AATTAGTACTAGAGAATAGAAGG + Intergenic
1087042892 11:93819118-93819140 CATAGGAAATAGAGAAGATATGG + Exonic
1087656330 11:100927759-100927781 CATTGGAATTCCTGAAAAGATGG - Intronic
1088109340 11:106244491-106244513 CATTGGGACTGGACAGAAGAAGG + Intergenic
1089756130 11:120688756-120688778 CATTGGAAGTAGAGCAATGGGGG + Intronic
1089971652 11:122698461-122698483 CTTTGGAACTATAGAAAATTAGG + Intronic
1090466518 11:126939492-126939514 CATTGGAACTTGTGAAAATAAGG - Intronic
1090714058 11:129414466-129414488 CATTAATACTAAAGAAAAGAAGG - Intronic
1090913643 11:131143442-131143464 GATTGGAATTAGTGAGAAGAGGG + Intergenic
1091014200 11:132035219-132035241 CTATGGAAGTAGAGAAAAGAGGG - Intronic
1091056356 11:132422960-132422982 CATTGCAAATTGAGAAGAGATGG + Intronic
1091956884 12:4652350-4652372 AAATGGAACTAGAGAAAACAAGG - Intronic
1092021945 12:5210142-5210164 CAGTAAAAATAGAGAAAAGATGG - Intergenic
1092552565 12:9519941-9519963 CATTAGAATTAGAGAAACTAAGG + Intergenic
1092982694 12:13812792-13812814 CATTGGAAATGGAGAAATTATGG + Intronic
1092992909 12:13920403-13920425 GAATGGAAGTAGGGAAAAGATGG + Intronic
1094061666 12:26320836-26320858 TGTTTGAAATAGAGAAAAGAAGG + Intergenic
1094519552 12:31170675-31170697 CATTAGAATTAGAGAAACTAAGG - Intergenic
1094705934 12:32914521-32914543 CATGGCAACAAGAGAAAATAAGG - Intergenic
1094716426 12:33018995-33019017 GATGGGAACTAGAAAGAAGATGG - Intergenic
1097860664 12:64515429-64515451 CATTGGAACAAGAGAAAGGAGGG - Intergenic
1098553846 12:71795732-71795754 CACTGGAACTAGAGAACTGGAGG + Exonic
1098878583 12:75892658-75892680 GAGGGGAACTATAGAAAAGAGGG + Intergenic
1099288834 12:80749613-80749635 TATTGAAACTACAGAACAGATGG + Intergenic
1100158149 12:91826060-91826082 CAGTGGAACTAGAGAACAAAAGG - Intergenic
1100478584 12:94956363-94956385 CCTTGGACCTATGGAAAAGAAGG + Intronic
1100683204 12:96953114-96953136 CTTTGGGACAAGAGACAAGAAGG - Intronic
1100691772 12:97046071-97046093 CATTGGGAGCAGAGAAAGGAGGG - Intergenic
1101557455 12:105823608-105823630 CTTTGGAACTAGAGAAACTTGGG + Intergenic
1102717026 12:114982848-114982870 CATTCCAGCTGGAGAAAAGAGGG + Intergenic
1103651267 12:122434375-122434397 ATTTGGAACTAGAGGAAAGGTGG + Intergenic
1103889959 12:124231393-124231415 CATTTGCACAAGTGAAAAGAGGG - Intronic
1106206140 13:27597013-27597035 GATTGAGACTAGAGAAAACAGGG - Intronic
1106727802 13:32504166-32504188 CAAAGGAACTGCAGAAAAGAAGG + Intronic
1107744644 13:43491466-43491488 CATTTGAACTAAAGTAAATAAGG + Intronic
1109496193 13:63176037-63176059 CTTTGGAATTAAAGAAAACAGGG + Intergenic
1109838705 13:67893532-67893554 CATTGGCACTGGAGGAATGAAGG + Intergenic
1110030911 13:70612061-70612083 TATGTGAACTAGAGAAAAGTAGG - Intergenic
1110061059 13:71038726-71038748 TATTGCAACTCTAGAAAAGAGGG - Intergenic
1110850708 13:80241504-80241526 CATGGGAAGGAGAGAAGAGAAGG - Intergenic
1111473703 13:88719156-88719178 CATTGGATTGAGAGAAAAGCTGG + Intergenic
1111489761 13:88956514-88956536 CATTGGAAATGGAAAGAAGATGG + Intergenic
1111617462 13:90679085-90679107 CTTTGGAACCAGAGGAGAGAGGG - Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112131297 13:96526541-96526563 CAATGGTACTAGGGAAAAAAAGG - Intronic
1112143953 13:96676968-96676990 CATAGTAAGTAGAGAAAAGTTGG + Intronic
1112530032 13:100192200-100192222 CAATTGAACTAAAGCAAAGATGG - Intronic
1112807820 13:103182311-103182333 CATTTGAACTAGAGAAGAATAGG - Intergenic
1112957227 13:105074561-105074583 CATTGAAAATACACAAAAGAGGG + Intergenic
1113905984 13:113819428-113819450 CACTTGACCTAGAGAAAAGTCGG - Intergenic
1114295020 14:21321338-21321360 CATTGGAACTAGAAAAGACCAGG + Exonic
1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG + Intergenic
1115048789 14:29030223-29030245 AATTAGAACAAGAGATAAGATGG + Intergenic
1116109756 14:40562664-40562686 TCTTGGAAATAGAGAATAGAAGG - Intergenic
1116283719 14:42945354-42945376 AATTGGAAATGGAGATAAGATGG + Intergenic
1116735462 14:48685246-48685268 GATAGGAATTAGAGAGAAGACGG + Intergenic
1116779837 14:49224902-49224924 CTGTGGAAGAAGAGAAAAGATGG + Intergenic
1117428637 14:55628541-55628563 AATTGAAACTATAGAAAATATGG + Intronic
1118026227 14:61771789-61771811 CTTTGAAACTTGAGGAAAGAAGG + Intronic
1118932025 14:70251898-70251920 CATTGGAATAAGAGGGAAGATGG - Intergenic
1118953153 14:70453300-70453322 CATTGGAATAAGAGGGAAGATGG + Intronic
1119053021 14:71389227-71389249 AATTGTAACTGGAGAGAAGAGGG + Intronic
1119286536 14:73459114-73459136 CATTGAGACCAAAGAAAAGAAGG - Intronic
1120021837 14:79539651-79539673 CATAAGGACTAGAGAAAAGATGG + Intronic
1120746515 14:88157287-88157309 CATTGGAACCAAAGAAAACCAGG + Intergenic
1121034488 14:90689099-90689121 AAATGGAACTAGATATAAGAAGG - Intronic
1121308265 14:92920981-92921003 CACTGGAACTAGTGAACAGAAGG - Intergenic
1121479466 14:94252211-94252233 CATTAAAACTAAAGAAAAGACGG + Intronic
1122466204 14:101935211-101935233 CATCAAAACGAGAGAAAAGACGG + Intergenic
1125152563 15:36549561-36549583 CATTGCAACTAGGGATAAGGTGG - Intergenic
1125174303 15:36803191-36803213 CAATAGAACTGGAGAAAATATGG + Intronic
1125286271 15:38095889-38095911 GATTGGAGCTAGAGGGAAGAGGG - Intergenic
1127157612 15:56145651-56145673 TGTGGAAACTAGAGAAAAGAAGG - Intronic
1127685797 15:61342389-61342411 CATTTTAACCAGAGCAAAGAAGG - Intergenic
1128034072 15:64507768-64507790 CATTTGAAATAGAGAGCAGAGGG + Intronic
1128233359 15:66050680-66050702 TATTGGGATTAGAGAATAGATGG + Intronic
1128264386 15:66254096-66254118 AATAGAAAATAGAGAAAAGAGGG - Intergenic
1128752495 15:70159355-70159377 CATTGGAACCACAGGAAAAATGG - Intergenic
1129020479 15:72513579-72513601 ACTTGGAACTACAGGAAAGAAGG - Intronic
1131558086 15:93416412-93416434 AAATGGAACTAGGGAAAAGTCGG - Intergenic
1132388851 15:101423640-101423662 CATTCGAAGCAGAGAAAAAAGGG + Intronic
1133486128 16:6220413-6220435 GATTGAAACAAGAGAAAAGGAGG + Intronic
1137847720 16:51708470-51708492 TAGTGGAGCTGGAGAAAAGATGG + Intergenic
1140294308 16:73693603-73693625 CACGGGAACGAGAGAAAAGAAGG + Intergenic
1140978435 16:80083392-80083414 CATTGGAACAAGAGAAAACCTGG - Intergenic
1141096340 16:81165709-81165731 CCTTGGAGCTAGAGAAGTGATGG - Intergenic
1141917183 16:87107226-87107248 CATTGGAAACAGAGCAGAGAGGG - Intronic
1143347593 17:6261291-6261313 CATGGGACCTGGAGAAAAGAAGG - Intergenic
1143942271 17:10554622-10554644 CATTGGAAGAAAAGAACAGATGG + Intergenic
1145021999 17:19439478-19439500 TATGGGAACCACAGAAAAGAAGG + Intergenic
1145721478 17:27077197-27077219 CATTGGAACCAAAGAAAAAAGGG + Intergenic
1145838088 17:27969993-27970015 CAGTGAAGCTGGAGAAAAGAGGG - Intergenic
1146104304 17:30017838-30017860 AATTGTAATTACAGAAAAGAAGG - Intronic
1149596543 17:57867798-57867820 CAGTTCAACTAGAGAAATGAAGG + Intronic
1151036779 17:70809741-70809763 AATTGAAACTAAAGAAAATATGG - Intergenic
1151281118 17:73074635-73074657 CTTTGGAAATAGAGAACAGCTGG + Intronic
1155094240 18:22540768-22540790 CCTTGGAAGTGGAGAAGAGAAGG - Intergenic
1155984716 18:32218057-32218079 CATAGGAAACAGAGAGAAGAAGG - Intronic
1156018893 18:32577384-32577406 AATTGAAAATACAGAAAAGAGGG - Intergenic
1158479680 18:57810636-57810658 CATTTGAGCCTGAGAAAAGAGGG - Intergenic
1158681196 18:59568562-59568584 CATGAGAACTAGGGAGAAGATGG + Intronic
1159408545 18:68038350-68038372 CATTGGAAATATACAGAAGATGG + Intergenic
1160112464 18:76046586-76046608 CATTGGATGTCGGGAAAAGATGG - Intergenic
1162287807 19:9752859-9752881 CAGTGAAAGTAGTGAAAAGAAGG - Intronic
1163861464 19:19745235-19745257 CCTAGGAAAGAGAGAAAAGAGGG - Intergenic
1166462935 19:43005269-43005291 CATTGAAATCAGAGAAAAGGGGG - Intronic
1166469063 19:43061730-43061752 CATTGAAATCAGAGAAAAGGGGG - Intronic
1166480204 19:43165247-43165269 CATTGAAATCAGAGAAAAGGGGG - Intronic
1168483755 19:56743168-56743190 CACTGGAACTCGAGAGAAGGAGG + Intergenic
925711738 2:6747767-6747789 TCTAGAAACTAGAGAAAAGAAGG - Intergenic
926771258 2:16378042-16378064 GATTGGAGCTAGAGAGAAGCTGG - Intergenic
927002012 2:18806139-18806161 AATTGGAATTACAGAAAAAAAGG + Intergenic
927633634 2:24795466-24795488 CGTTGCTACTACAGAAAAGAGGG - Intronic
927745711 2:25618451-25618473 CATTGGAAGTAGTGAAAACATGG - Intronic
928239357 2:29572998-29573020 CTTTGGAACTAGAGACGGGATGG - Intronic
928990090 2:37224078-37224100 CATTGGACCTTTAGAGAAGAGGG - Intronic
930709521 2:54537297-54537319 CATTTGAACTACAGGAAACAAGG - Intronic
931055016 2:58459993-58460015 CATTGCAGGTAGAGAAAAGATGG + Intergenic
931975500 2:67639714-67639736 TATTGGAAGTAGAGTAAAAAGGG - Intergenic
932982616 2:76688136-76688158 CACTGGAACCTGAGAAATGAGGG - Intergenic
933126685 2:78617552-78617574 CATAAGAACTACAGAAAAAATGG - Intergenic
937547830 2:123045995-123046017 CATTGGTACTAGACAAGGGAGGG - Intergenic
937711130 2:124981376-124981398 TATTAGAATTAGAGAAAAAAAGG - Intergenic
937742399 2:125371282-125371304 CCTTGTAACTATACAAAAGATGG + Intergenic
938324420 2:130388829-130388851 CATTTGACCTAGAGCTAAGATGG - Intergenic
938931879 2:136093838-136093860 CATTCCAATTAGAGAAAGGAGGG + Intergenic
938962777 2:136358035-136358057 TTTTGGAACTAGAGAGATGATGG - Intergenic
939019260 2:136939620-136939642 CATTGGTCAGAGAGAAAAGAAGG - Intronic
939866145 2:147474924-147474946 CATTGTAATTAGAGAGAAGAGGG - Intergenic
941207194 2:162588896-162588918 CATTGGAGGGAGAGGAAAGAGGG - Intronic
941613304 2:167688696-167688718 TCTTAGAACTAGAGAAAAAAGGG + Intergenic
943142024 2:183994187-183994209 ATTTGGAACTTGAGAAAATAAGG + Intergenic
943406077 2:187488026-187488048 CATTAGAATTAGAGTAAATACGG + Intronic
944327367 2:198422328-198422350 CATTCTAACTAGAGAAAACAAGG - Intronic
945054354 2:205855282-205855304 CATTGGAAATAGAGGAATGTAGG - Intergenic
945796741 2:214373755-214373777 CATTGGAAGCAGATAAAAAAAGG - Intronic
946343368 2:219087069-219087091 GAGTGGGAGTAGAGAAAAGAAGG - Intronic
946934260 2:224703165-224703187 GATTGGAAGGAGAGAAAAAATGG - Intergenic
947339169 2:229119369-229119391 CATTGTTACTGGAGAAATGAAGG - Intronic
948189978 2:236051074-236051096 CAGTGTGACTAAAGAAAAGATGG - Intronic
948197844 2:236108353-236108375 CAGAGGAAGGAGAGAAAAGAGGG - Intronic
948230257 2:236344086-236344108 CATTGAAAGGAGAGAAAAGAAGG + Intronic
948341300 2:237254396-237254418 CACTGTAACCAGAGAAAAGTTGG + Intergenic
948555509 2:238807274-238807296 GGTTGTAAATAGAGAAAAGATGG + Intergenic
1169559184 20:6781069-6781091 CAATAGAACTAGAGATAAAAAGG - Intergenic
1169560475 20:6794515-6794537 AGTTGAAACTAGAAAAAAGAAGG + Intergenic
1169769468 20:9185447-9185469 CAAGGGAATTAGTGAAAAGAAGG - Intronic
1170435105 20:16318387-16318409 CATTGAAAGAAGAGAAAATAAGG + Intronic
1171070634 20:22065043-22065065 CAGTGGAAATAGTGGAAAGATGG - Intergenic
1171473658 20:25390938-25390960 CCTTGGAACTAGAGAGGAGGTGG - Exonic
1172471092 20:35196757-35196779 ACTTGGAACTACAGAAATGAAGG + Intergenic
1172979278 20:38928660-38928682 CACTGGAACTAGAGGCCAGAGGG + Intronic
1174171934 20:48623136-48623158 GATTGGAAATCGGGAAAAGATGG + Intergenic
1174903958 20:54530542-54530564 CATGGGAAGTAGAGAAGAGGAGG - Intronic
1175377730 20:58540961-58540983 GTTTGGAACTAGAAAAAAGCTGG + Intergenic
1177146506 21:17412551-17412573 GAATGGAACCAGAGAAAACAGGG + Intergenic
1178010561 21:28280970-28280992 TAATGAAACTATAGAAAAGATGG - Intergenic
1184569159 22:45310961-45310983 CACTGGAAATAGAGATGAGACGG + Intronic
949606257 3:5657552-5657574 CATTGCAGCTGGAGAATAGAGGG + Intergenic
951364616 3:21766006-21766028 CATGTAAACAAGAGAAAAGAAGG + Intronic
951551957 3:23883091-23883113 AATTGATACTAAAGAAAAGATGG - Intronic
951927500 3:27924725-27924747 AATTGGAGATAGAGAAAAGGAGG - Intergenic
953120716 3:40038919-40038941 CCCTGGAACAAGAGAAGAGAGGG + Intronic
954686706 3:52374700-52374722 CATTGGAACAAGATAATACATGG + Intronic
954978376 3:54719987-54720009 TATTGGAAATGGAAAAAAGAAGG - Intronic
956087203 3:65624700-65624722 CATTGGAAATTGAGAAAACAGGG + Intronic
956517674 3:70067505-70067527 ACTTGGAACTAAAGAAAGGAGGG + Intergenic
956563448 3:70610367-70610389 CATTTAAATTTGAGAAAAGAGGG - Intergenic
957875489 3:86140432-86140454 CATTGGAACAACAGACATGATGG + Intergenic
959298515 3:104569545-104569567 CTTTGGAAACAGAGCAAAGAGGG - Intergenic
959307637 3:104689688-104689710 AATTGGAAGAAAAGAAAAGAAGG - Intergenic
959437997 3:106341069-106341091 CAATGGAACAATAAAAAAGATGG - Intergenic
959480538 3:106866982-106867004 CATTGGCACAAGGGCAAAGAGGG - Intergenic
959631971 3:108517181-108517203 GATAGAAACTAGTGAAAAGAGGG - Intronic
959688041 3:109168806-109168828 CATGGGAACTAGAAAATATATGG + Intergenic
960465310 3:117990432-117990454 CTTCTGAAATAGAGAAAAGAGGG + Intergenic
961991042 3:131191386-131191408 CTTTGAAAATAGAGAAAGGAGGG - Intronic
962282339 3:134061353-134061375 CATTGGCAGAAGAGAGAAGAAGG - Intergenic
962842930 3:139251979-139252001 CAGGGGAAGAAGAGAAAAGAGGG + Intronic
964808679 3:160639339-160639361 CATTGGTACTAGATAGAAGCAGG - Intergenic
964913923 3:161816334-161816356 CCTGGTAGCTAGAGAAAAGAAGG + Intergenic
965433512 3:168618808-168618830 CAATAGAACTGGAGAAAAGCTGG - Intergenic
965978355 3:174654642-174654664 CATTTGCACTAAAGAAAACATGG - Intronic
966332034 3:178825335-178825357 CATTGGCCCCAGAGTAAAGAAGG + Intronic
967056235 3:185831045-185831067 GATTGGAACAAGAGGATAGATGG + Intergenic
967197416 3:187040656-187040678 AAGAAGAACTAGAGAAAAGAAGG - Intronic
968286081 3:197509732-197509754 CCTGGGAACTAGAGGAAGGAGGG - Intergenic
969087737 4:4669144-4669166 CATTGGAACCTCAGAAAGGAGGG - Intergenic
969644012 4:8415948-8415970 CAGGGGAACGAGCGAAAAGAGGG + Exonic
970167410 4:13253872-13253894 CACTGAAACTAGAGATGAGAAGG + Intergenic
973872100 4:55176874-55176896 CGTTGGACATACAGAAAAGAGGG + Intergenic
974080704 4:57209461-57209483 CATGGGTAGAAGAGAAAAGACGG - Intergenic
974208991 4:58744562-58744584 CATTAGCTATAGAGAAAAGAGGG - Intergenic
975234854 4:71981565-71981587 CAATTGAAATAGAGAAAAAAAGG - Intergenic
975457278 4:74607212-74607234 CAATGGAAGTATAGAGAAGAGGG - Intergenic
975973063 4:80065527-80065549 CATGAGAGCAAGAGAAAAGAAGG + Intronic
976435748 4:85015912-85015934 CAATGGATTTAGTGAAAAGATGG - Intergenic
976640462 4:87332296-87332318 TAGAGGAACTAGAGAAATGAGGG - Intergenic
977927427 4:102717053-102717075 CATTGGAGATAGGGAAAAGAAGG + Intronic
978181879 4:105807989-105808011 CATAGGATCAAGAGAGAAGAAGG - Intronic
978624237 4:110666397-110666419 CATTTGATCAATAGAAAAGAAGG + Intergenic
978946184 4:114500540-114500562 TTTGGGAAATAGAGAAAAGAAGG - Intergenic
979387857 4:120091100-120091122 CCTTCAAACTAGAGAAAAGAAGG - Intergenic
980198270 4:129620235-129620257 CAATGGAACGTGAGCAAAGATGG + Intergenic
980570054 4:134602891-134602913 CAGTGGAACAAGAGAACAGATGG + Intergenic
981249662 4:142584724-142584746 CATAGGGAAAAGAGAAAAGAAGG - Intronic
983875453 4:172869771-172869793 CATGGGAACTAGAGAGAATGAGG - Intronic
984847371 4:184119510-184119532 CATTGGAACTAGACAAATTCGGG + Intronic
986307022 5:6523473-6523495 AATTTGAAATGGAGAAAAGAGGG - Intergenic
987199880 5:15566131-15566153 TATTGAAAATAGATAAAAGATGG + Intronic
987432718 5:17856286-17856308 TTTTGCAGCTAGAGAAAAGAGGG + Intergenic
987649056 5:20716818-20716840 CATTGGAATTAATGAAAATAAGG - Intergenic
988459467 5:31420101-31420123 TATTGGAACTAGAGAGAATATGG - Intronic
988482883 5:31644298-31644320 CTTTAGAAATAGAGAAAAGATGG + Intronic
988746509 5:34144721-34144743 CATTGGAATTAATGAAAATAAGG + Intergenic
989247963 5:39275174-39275196 TATTGAAACTCAAGAAAAGAAGG + Intergenic
990494282 5:56331751-56331773 GATGGGAAGTAGAGCAAAGATGG - Intergenic
992892150 5:81213398-81213420 CATTGGTGCCAGAGAATAGAAGG + Intronic
994450866 5:99941130-99941152 TGTTGGAAATAGAGAAAACAGGG - Intergenic
995001862 5:107142431-107142453 AATTTGATCAAGAGAAAAGAAGG - Intergenic
995062478 5:107826133-107826155 TTTTAGAACTAGAGAAAGGAAGG + Intergenic
995141051 5:108735674-108735696 AATGGGATCTAGAGAAGAGAAGG - Intergenic
997141919 5:131390764-131390786 ATTTGGAAATAGAGAAAATAGGG + Intronic
997741786 5:136261425-136261447 CATTGTAACGGGAGAAAAGGTGG - Intronic
999053878 5:148552964-148552986 GATTTCACCTAGAGAAAAGAAGG + Intronic
1000388585 5:160699792-160699814 CATGAGAAATAGAGATAAGATGG + Intronic
1000508532 5:162152453-162152475 GAATGGAAATTGAGAAAAGAAGG - Intronic
1000655917 5:163877599-163877621 AAATAAAACTAGAGAAAAGATGG - Intergenic
1001444851 5:171775224-171775246 CATTTGAATTTGAGGAAAGAAGG - Intergenic
1002301822 5:178261747-178261769 CCCTGGAACAAGAGAAGAGAAGG + Exonic
1004120950 6:12821794-12821816 CATTGGATTTAGAAAGAAGAAGG + Intronic
1004266057 6:14149495-14149517 GATTGACACTAGAGAACAGAAGG + Intergenic
1005487887 6:26318545-26318567 CCTTGGCAAGAGAGAAAAGATGG + Intergenic
1005544657 6:26852960-26852982 CATTGGAATTAATGAAAATAAGG + Intergenic
1007452066 6:41947744-41947766 AAGTGGAAATCGAGAAAAGAAGG - Intronic
1008158453 6:48047161-48047183 CATTAGAACAAGAGAAGGGAAGG - Intronic
1009015447 6:57894590-57894612 CATTGGAATTAATGAAAATAAGG + Intergenic
1009452885 6:63822195-63822217 CATTTGAACTCGAGAAGAGGAGG - Intronic
1011861084 6:91757514-91757536 CACTGGAAAGTGAGAAAAGATGG + Intergenic
1011937680 6:92801414-92801436 CATTGGTGCTTGAGAAATGAGGG - Intergenic
1011963667 6:93124371-93124393 CACTGGACCTAGTGAAAACATGG - Intergenic
1012241253 6:96875505-96875527 CAGTAGAAATGGAGAAAAGATGG - Intergenic
1013808655 6:114020160-114020182 CATTAGAAAGATAGAAAAGATGG - Intergenic
1015296216 6:131596424-131596446 CATTAGAACCAGAGAGAAAACGG + Intronic
1015674670 6:135731690-135731712 CACTGGAAATAAATAAAAGATGG - Intergenic
1016418896 6:143863451-143863473 CATTTAAACTGGAGAAAAGAAGG + Exonic
1016426808 6:143943851-143943873 CAGTGGAACTATGAAAAAGATGG - Intronic
1016736466 6:147485285-147485307 AATTGGAAAAAGACAAAAGAAGG - Intergenic
1016937623 6:149459333-149459355 CATTGGAACTATGAGAAAGAGGG - Intronic
1017458761 6:154628743-154628765 CATTGGATCTCTAGATAAGAAGG + Intergenic
1018141881 6:160846117-160846139 CACTGAACTTAGAGAAAAGATGG - Intergenic
1018142576 6:160853931-160853953 CAGTGAACCCAGAGAAAAGATGG - Intergenic
1020429711 7:8106521-8106543 CATTGGAAATAGAGCACAAAAGG + Intergenic
1020603418 7:10305308-10305330 CAGTGAAATTAGAGAAAAAAAGG + Intergenic
1021241322 7:18205573-18205595 CATTAGAACTAGAAAATATAGGG - Intronic
1022148655 7:27575325-27575347 CATTGGGACTTGAGTAAATAAGG + Intronic
1022569139 7:31434157-31434179 CATGGGATCTGGAGAAAGGAAGG + Intergenic
1023175254 7:37429800-37429822 GAATGGAACTAGAGGGAAGAGGG + Intronic
1023525242 7:41095658-41095680 CAATGGAAGTAGAGAAAATTTGG + Intergenic
1024149336 7:46553998-46554020 CAGAGGAAGTTGAGAAAAGAGGG + Intergenic
1024857981 7:53803893-53803915 CATTGATACAAGATAAAAGAAGG - Intergenic
1025086742 7:56029530-56029552 CTTTGGAACTAGGGATGAGAAGG - Intronic
1025602408 7:63012972-63012994 CTTTGCAAATAGAGAAAATAAGG + Intergenic
1027302145 7:76850978-76851000 TATTGGAAGCAAAGAAAAGAAGG + Intergenic
1027554854 7:79650832-79650854 CATAGTAACTACAGAAAATATGG + Intergenic
1027828567 7:83148868-83148890 CATTCGAAGTAGAGAACAAATGG - Intronic
1028246378 7:88483577-88483599 CATTGGACAAAGGGAAAAGAGGG + Intergenic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1030377138 7:108766350-108766372 CATTAAAACCAGAGAAAAGCAGG + Intergenic
1031196053 7:118615328-118615350 CAGTGGAAGTAAAGAGAAGAGGG + Intergenic
1031294674 7:119986247-119986269 CATTGCAACTAGAGAAACAAGGG + Intergenic
1031344323 7:120646327-120646349 TATTGGGAAAAGAGAAAAGAAGG - Intronic
1031850967 7:126863046-126863068 ATTTGGAACTAAATAAAAGAAGG - Intronic
1032362405 7:131268268-131268290 CAGAGGATCTAGACAAAAGAAGG - Intronic
1032517240 7:132515948-132515970 GCTTGGAACTGGAGAAAAGAGGG - Intronic
1032553038 7:132803741-132803763 TATTGGAACTAGAGGAGAAAGGG + Intronic
1032733738 7:134670807-134670829 CTTTGGAATTAGAAAAAAAAGGG - Intronic
1033053076 7:138024164-138024186 CATTGGAACAAGACAATACATGG + Intronic
1033770940 7:144550763-144550785 TTTTGGAACAAGAGAAAACATGG - Intronic
1036612138 8:10359648-10359670 CAGTGGAAGGAGTGAAAAGAAGG - Intronic
1037418526 8:18677177-18677199 CAGAGGAACTAGAGGAAGGAGGG + Intronic
1037705958 8:21315310-21315332 CTTAGGAACTAGTGAAGAGATGG + Intergenic
1037888580 8:22608670-22608692 CATGTGAACTGGAGAGAAGACGG - Intronic
1040464036 8:47678235-47678257 CATTGGTTCCAGAGAAATGAGGG + Intronic
1040980749 8:53244108-53244130 TCTTGGAACTAGAGAAATGTGGG - Intronic
1041076180 8:54172169-54172191 CATTGGAAGTGGAGAAAATTGGG + Intergenic
1041422505 8:57683855-57683877 CATTGGACCCAAAGAAAAAAGGG + Intergenic
1041831272 8:62157056-62157078 GATTGCAAGTAGAGAAAAGAGGG - Intergenic
1041943549 8:63416363-63416385 AATAAAAACTAGAGAAAAGATGG - Intergenic
1042794243 8:72643188-72643210 TTTTGGAAATAGAGAAAGGAAGG + Intronic
1043645587 8:82514166-82514188 AATTGGAACCAGAGAACACAGGG - Intergenic
1044176094 8:89124629-89124651 CATTAAAAGTAGAGAAGAGAAGG + Intergenic
1045270470 8:100657146-100657168 CATGGGAAGTAAAGAAAAGAAGG + Intronic
1046154610 8:110271237-110271259 CATGGGAACTCCAGAGAAGATGG + Intergenic
1046394372 8:113621979-113622001 CATTGGTAATATAGAAAAAAAGG - Intergenic
1046780164 8:118206146-118206168 CATTGGAAATGGAGACAAGCTGG - Intronic
1046892026 8:119432625-119432647 CATTGGAGAGAGAGAAGAGAGGG - Intergenic
1047022694 8:120792950-120792972 CACTGGAAGAAAAGAAAAGAAGG + Intronic
1047905654 8:129470389-129470411 CTTATGAACTACAGAAAAGAAGG - Intergenic
1049249193 8:141579076-141579098 CAGTGGACATAGAGAAAACACGG + Intergenic
1050911599 9:11078518-11078540 TATAGAAACCAGAGAAAAGAAGG - Intergenic
1050970371 9:11863580-11863602 CATTGAAAGAAAAGAAAAGATGG + Intergenic
1052358902 9:27533142-27533164 CATTGCAAATATAGAAAAAAAGG + Intergenic
1053190360 9:36060953-36060975 CAATGGAACTAGAAAGAACAAGG - Intronic
1055981569 9:82008013-82008035 CATTGAAACAGCAGAAAAGAAGG + Intergenic
1056033884 9:82583746-82583768 CCTTGGAACCAGATCAAAGAGGG - Intergenic
1056541133 9:87572366-87572388 CATTGAAATTTGAGAAAAGCTGG - Intronic
1058134302 9:101290221-101290243 CTTTGGGGCTAGAAAAAAGACGG - Intronic
1058279665 9:103098441-103098463 CTTGGGACCTAGAGAAAACAGGG + Intergenic
1058597754 9:106633191-106633213 CATTGTAAGTGGAGAAAAGAAGG - Intergenic
1059062002 9:111042793-111042815 CAATGAAAAAAGAGAAAAGAAGG + Intergenic
1059842210 9:118230275-118230297 CAATGGAAGGAGAGGAAAGAAGG - Intergenic
1061160157 9:128889172-128889194 CCTGGGAACCTGAGAAAAGAGGG - Intronic
1061565490 9:131436605-131436627 CACTGGAACTAGACAAAGGCAGG - Exonic
1185782666 X:2862705-2862727 AATTGGAGCTGGAGAAATGACGG - Intronic
1187487036 X:19714148-19714170 CAATGGACATAGAGAATAGAAGG + Intronic
1188344053 X:29042340-29042362 AATGGGAACTAGAGAAGAGTGGG - Intronic
1188428255 X:30074667-30074689 CATGGGAAAGAGAGAAAAAAGGG - Intergenic
1188481592 X:30641726-30641748 TAATGGAAGAAGAGAAAAGATGG + Intergenic
1188996597 X:36893987-36894009 TCTTGGACATAGAGAAAAGAAGG + Intergenic
1190522141 X:51291194-51291216 CAGTAGAAAGAGAGAAAAGAAGG - Intergenic
1192972500 X:76249012-76249034 CATTTGAACTATAGAACAAATGG - Intergenic
1194419484 X:93655889-93655911 CCATGGAAATAGAGAATAGAAGG + Intergenic
1196137846 X:112229450-112229472 CTCTGGTACTAGAGAAAAGTAGG - Intergenic
1196998011 X:121405538-121405560 CATTCAAACAAGAGGAAAGATGG + Intergenic
1197899361 X:131353610-131353632 CATTGGAGTTAGAGAAATCAGGG + Intronic
1197966073 X:132063264-132063286 CCTTGGAGATAGAGAATAGAAGG - Intergenic
1198053749 X:132974114-132974136 CATACAAAATAGAGAAAAGAGGG - Intergenic
1198565248 X:137897414-137897436 GATTGGACGTAGAGAACAGAGGG + Intergenic