ID: 924552993

View in Genome Browser
Species Human (GRCh38)
Location 1:245095640-245095662
Sequence GGTTCTTTGGGAGGCCAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231963
Summary {0: 1, 1: 84, 2: 3809, 3: 68025, 4: 160044}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924552993_924553001 0 Left 924552993 1:245095640-245095662 CCACCTTGGCCTCCCAAAGAACC 0: 1
1: 84
2: 3809
3: 68025
4: 160044
Right 924553001 1:245095663-245095685 GGGATTAGAGCCACCACACCTGG 0: 1
1: 19
2: 62
3: 210
4: 1315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924552993 Original CRISPR GGTTCTTTGGGAGGCCAAGG TGG (reversed) Intronic
Too many off-targets to display for this crispr