ID: 924560831

View in Genome Browser
Species Human (GRCh38)
Location 1:245155588-245155610
Sequence CCCCGGGGGCGCCTCTGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 212}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924560831_924560848 19 Left 924560831 1:245155588-245155610 CCGCTGCAGAGGCGCCCCCGGGG 0: 1
1: 0
2: 2
3: 29
4: 212
Right 924560848 1:245155630-245155652 GCGGAGGCGGGTCGGCCGCGGGG 0: 1
1: 0
2: 3
3: 39
4: 605
924560831_924560846 17 Left 924560831 1:245155588-245155610 CCGCTGCAGAGGCGCCCCCGGGG 0: 1
1: 0
2: 2
3: 29
4: 212
Right 924560846 1:245155628-245155650 GCGCGGAGGCGGGTCGGCCGCGG 0: 1
1: 0
2: 3
3: 24
4: 274
924560831_924560847 18 Left 924560831 1:245155588-245155610 CCGCTGCAGAGGCGCCCCCGGGG 0: 1
1: 0
2: 2
3: 29
4: 212
Right 924560847 1:245155629-245155651 CGCGGAGGCGGGTCGGCCGCGGG 0: 1
1: 0
2: 2
3: 14
4: 172
924560831_924560844 7 Left 924560831 1:245155588-245155610 CCGCTGCAGAGGCGCCCCCGGGG 0: 1
1: 0
2: 2
3: 29
4: 212
Right 924560844 1:245155618-245155640 GGTTGTGAGTGCGCGGAGGCGGG 0: 1
1: 0
2: 1
3: 19
4: 147
924560831_924560841 0 Left 924560831 1:245155588-245155610 CCGCTGCAGAGGCGCCCCCGGGG 0: 1
1: 0
2: 2
3: 29
4: 212
Right 924560841 1:245155611-245155633 CTGGCGGGGTTGTGAGTGCGCGG 0: 1
1: 0
2: 2
3: 12
4: 127
924560831_924560842 3 Left 924560831 1:245155588-245155610 CCGCTGCAGAGGCGCCCCCGGGG 0: 1
1: 0
2: 2
3: 29
4: 212
Right 924560842 1:245155614-245155636 GCGGGGTTGTGAGTGCGCGGAGG 0: 1
1: 0
2: 1
3: 17
4: 165
924560831_924560845 11 Left 924560831 1:245155588-245155610 CCGCTGCAGAGGCGCCCCCGGGG 0: 1
1: 0
2: 2
3: 29
4: 212
Right 924560845 1:245155622-245155644 GTGAGTGCGCGGAGGCGGGTCGG 0: 1
1: 0
2: 2
3: 19
4: 198
924560831_924560843 6 Left 924560831 1:245155588-245155610 CCGCTGCAGAGGCGCCCCCGGGG 0: 1
1: 0
2: 2
3: 29
4: 212
Right 924560843 1:245155617-245155639 GGGTTGTGAGTGCGCGGAGGCGG 0: 1
1: 0
2: 0
3: 17
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924560831 Original CRISPR CCCCGGGGGCGCCTCTGCAG CGG (reversed) Intronic
900082633 1:869952-869974 GCCTGGCGGCGCCTGTGCAGCGG + Intergenic
900252980 1:1681078-1681100 AACCGTGGGTGCCTCTGCAGGGG - Intronic
900309632 1:2027488-2027510 CTCAGGGGGCATCTCTGCAGGGG + Intronic
900338740 1:2177752-2177774 CCACGGGGGTGATTCTGCAGTGG - Intronic
900408080 1:2501173-2501195 GCCCAGAGGCGCCCCTGCAGGGG + Intronic
900567377 1:3340175-3340197 CCTCGGGGGATCCTCTGCTGTGG + Intronic
900718701 1:4161355-4161377 CCTCGGGGGAGCCTCTCCTGCGG + Intergenic
900992071 1:6102666-6102688 CCCCGGGTGCTCCCCTGCCGAGG - Exonic
901007900 1:6180466-6180488 ACCGGGGGGCGCCCCGGCAGGGG + Intergenic
901027600 1:6286884-6286906 CCCCAGGGGCACCGCTGGAGAGG + Intronic
901595172 1:10379397-10379419 CCTCTGGGGCGCCCCTGCTGCGG + Intronic
901659361 1:10788989-10789011 CCCCTTGGGCTCCCCTGCAGTGG - Intronic
901858697 1:12060389-12060411 ACCCAGGGGAGCCACTGCAGGGG + Intergenic
902361646 1:15945319-15945341 CCCCGGGGGGGCCTGTGAACTGG + Intronic
903667987 1:25019397-25019419 CCCCAGGGGCCACTCTGCAGGGG + Intergenic
906102244 1:43271041-43271063 TCCCGGAGACTCCTCTGCAGAGG - Intronic
906140519 1:43531305-43531327 CGCTGGGGGCGCGTCTGCCGCGG - Intronic
906306106 1:44720330-44720352 CCCCAGAGGAGGCTCTGCAGTGG - Intronic
906365377 1:45205873-45205895 CCCCGGGGGCGTCGCGGCTGGGG - Exonic
914869160 1:151458949-151458971 CCCCGCGGCCGCCCCTGCCGCGG + Intronic
915101931 1:153507112-153507134 CCACGTGGGCCACTCTGCAGAGG + Intergenic
915458155 1:156053909-156053931 GACCGGGGGGGCCACTGCAGCGG + Intergenic
916890197 1:169106400-169106422 CCCCGGGCCTGTCTCTGCAGAGG + Exonic
919820546 1:201469265-201469287 CCCCGGGGGCGGGGCCGCAGCGG + Intergenic
919991079 1:202709180-202709202 CCCAGGAGGGGCCACTGCAGTGG - Intronic
920065957 1:203269871-203269893 TCCCGGGGAAGTCTCTGCAGAGG + Intronic
920385628 1:205568891-205568913 CGGCGGGGGCGCCTCTGCGGCGG - Intronic
923048924 1:230376575-230376597 CCCTGGGGGCAGCTCTGCAGAGG - Intronic
924560831 1:245155588-245155610 CCCCGGGGGCGCCTCTGCAGCGG - Intronic
924706402 1:246506602-246506624 TACCGGCGGGGCCTCTGCAGGGG + Intronic
1062896970 10:1110754-1110776 CGCCGGGGGCTTCTCTGCAGTGG + Intronic
1062940676 10:1418404-1418426 CCCCCGTGGCGTCTCGGCAGGGG - Intronic
1063502040 10:6563937-6563959 GCCCGTGGGGGCCTTTGCAGAGG + Intronic
1064242082 10:13640044-13640066 AGCCGGTGGCGCCTCTTCAGAGG + Intronic
1067473035 10:46549747-46549769 CAGCGGGGATGCCTCTGCAGGGG + Exonic
1070765547 10:79054090-79054112 CCTTGGGGGCTCCTGTGCAGGGG + Intergenic
1070835723 10:79445754-79445776 CCCCGGAGCCGCCGCTGGAGGGG - Intergenic
1072940601 10:99760302-99760324 CCCCAGTGGGGACTCTGCAGGGG + Intergenic
1073426924 10:103460465-103460487 TCCCTGGGGAGCCTCTGCAAGGG - Intergenic
1074180735 10:111060343-111060365 CCCTGGGGGTGTTTCTGCAGGGG - Intergenic
1074843378 10:117375818-117375840 CCCCGCGGTTACCTCTGCAGCGG + Intergenic
1075999893 10:126905860-126905882 CCCGGGGGGCTCCACGGCAGAGG - Intronic
1076817157 10:132920660-132920682 CCCCGGGGTCGCCCATGCACAGG - Intronic
1076864397 10:133160009-133160031 TCCCGGGGTGGCCTCTGCAGCGG - Intergenic
1076872049 10:133199046-133199068 CCCCGGGGCCACCCCTGCCGGGG + Exonic
1076911055 10:133389782-133389804 CTCGGCGGGGGCCTCTGCAGCGG - Intronic
1077124360 11:925914-925936 CCCCGGCGGCTCCTCCGCGGCGG + Exonic
1077361835 11:2144324-2144346 CCCCGGTGGCGGCTCGGCCGCGG - Intronic
1078019003 11:7640022-7640044 CCCAGGGGGAGCCTCTGGGGAGG - Intronic
1080730110 11:34941862-34941884 CCCCGGGTGGGCCTCTGCTCTGG + Intronic
1082275371 11:50215564-50215586 CACCAGAGGAGCCTCTGCAGTGG - Intergenic
1082759854 11:57116971-57116993 ACCCGGGGGCGCATGTGCTGAGG - Intergenic
1083302154 11:61744966-61744988 CCCCTGGGGTGCCCCTGCCGAGG + Exonic
1084146266 11:67266845-67266867 CCCCGCGGGCGCCCCGGCCGCGG + Intronic
1084180610 11:67443715-67443737 CACCTGCGGCGCCTCTGCGGCGG - Intronic
1084181962 11:67451327-67451349 GCCCGGGGCCGCCTCTGGCGGGG + Exonic
1084790867 11:71474620-71474642 CCCCGGGGGCTTCTCCACAGGGG - Intronic
1084790892 11:71474692-71474714 CCCCGGGGGCTTCTCCACAGGGG - Intronic
1087578811 11:100025444-100025466 CCCCAGTGGGGACTCTGCAGGGG - Intronic
1092261369 12:6955009-6955031 CGGCGGGGGAGCCTCTGCTGAGG + Intronic
1094269982 12:28602772-28602794 CCCCGTGGGCTCTTTTGCAGTGG - Intergenic
1102023742 12:109701310-109701332 CCCCAGGGACGGCTCTGCCGTGG + Intergenic
1103416503 12:120745251-120745273 CCACAGGTGCCCCTCTGCAGCGG + Intergenic
1104060005 12:125259636-125259658 CCCCGGGGACTCGTCGGCAGTGG + Intronic
1104602434 12:130162599-130162621 CCCAGGTGGCGCGTCTGGAGCGG - Exonic
1107087749 13:36444262-36444284 CTCCAGAGGCCCCTCTGCAGAGG - Intergenic
1107859638 13:44648539-44648561 CCTTGGGGCTGCCTCTGCAGAGG + Intergenic
1114031433 14:18583894-18583916 GCCTGGCGGCGCGTCTGCAGCGG + Intergenic
1114559090 14:23578102-23578124 GCCCAGGGGAGGCTCTGCAGGGG + Intronic
1115344729 14:32330164-32330186 CCCTGGGAGAGCCTCTGAAGTGG + Intronic
1115664803 14:35534666-35534688 CCCCGGGGGCGCCGCCGCCGTGG + Exonic
1117699188 14:58396195-58396217 CGCCGCGGGCCCCTCGGCAGAGG - Intronic
1121271572 14:92641394-92641416 CCCAGGGGCCGCCTGTGCAGAGG + Intronic
1122537065 14:102472859-102472881 GCCCAGGGGAGCCTCGGCAGGGG - Intronic
1122629432 14:103100524-103100546 CCCCGAGGGCACCTCAGGAGTGG - Exonic
1126668434 15:51094741-51094763 GCCAGGGGGCGGCTCCGCAGAGG + Intronic
1127311024 15:57752560-57752582 CCCATGGGGCCCCTCTGCTGTGG - Intronic
1127763489 15:62164141-62164163 GCCCGGGGGCGCCTCCGAACAGG + Exonic
1128144914 15:65327768-65327790 AGGCTGGGGCGCCTCTGCAGGGG + Exonic
1128207923 15:65869515-65869537 ACCAGGGGGCGTCGCTGCAGGGG - Exonic
1129612333 15:77070820-77070842 CCCCACGGGCGCCTCCGCCGCGG + Intronic
1129739477 15:77983299-77983321 CCACTTGGGAGCCTCTGCAGAGG + Intergenic
1130023645 15:80251957-80251979 CCCCGCAGGCGCCGCGGCAGCGG + Intergenic
1131252570 15:90839955-90839977 CCCAGGGGACGTCCCTGCAGTGG - Intergenic
1131493544 15:92883002-92883024 CGCCCTGGGCGCCTCTGCCGCGG - Intergenic
1132717773 16:1300786-1300808 CCCGGTGTGCGACTCTGCAGAGG + Intergenic
1132743856 16:1428732-1428754 CCCCGGGGCCGGACCTGCAGAGG - Intergenic
1134290882 16:12902202-12902224 CTCCGGGGCCGCCTCCGGAGAGG + Exonic
1134440833 16:14298773-14298795 TCCAGGGGGCACCTCTGAAGGGG + Intergenic
1135622686 16:23969203-23969225 CCCAGTGGGCCCCACTGCAGGGG - Intronic
1136141855 16:28293267-28293289 CCGCGGGGACGCCGCGGCAGGGG - Exonic
1137290517 16:47049222-47049244 TCACTGGGGCTCCTCTGCAGCGG - Intergenic
1139848453 16:69936465-69936487 CGCCGGGGGCTCCGCTCCAGGGG + Intronic
1141443281 16:84042854-84042876 CCCCGGGGCCGGGCCTGCAGGGG - Intergenic
1141719986 16:85750799-85750821 CCCGGGCCGCGCCCCTGCAGCGG + Intronic
1141732111 16:85829787-85829809 CCCCGGGGGCCACCGTGCAGGGG + Intergenic
1141772766 16:86101188-86101210 CCCATGGGGCGTTTCTGCAGCGG - Intergenic
1142353313 16:89589625-89589647 CCCCGGGGAGGCGTCTGCAGGGG + Intronic
1142365230 16:89646570-89646592 GCCCGAGGGCGCCTCTGCCGTGG - Exonic
1142697859 17:1643527-1643549 CGCCGGAGGCGGCGCTGCAGCGG + Exonic
1142764696 17:2058568-2058590 CCCCGAGGGCGTCTTTGCTGTGG + Exonic
1143450224 17:7031850-7031872 CCCCAGTGGGGGCTCTGCAGTGG + Intergenic
1145066150 17:19762620-19762642 CCGCGGGGGCGCCTGAGCAACGG + Intergenic
1146676235 17:34775435-34775457 CCCCGGGGGCTCCACTGAGGAGG + Intergenic
1147819660 17:43234244-43234266 CCCCGGGGCCGCCTCTGCCTGGG + Intergenic
1147821776 17:43246131-43246153 CCCCGGGGCCGCCTCTGCCTGGG + Intergenic
1147822868 17:43252286-43252308 CCCCGGGGCCGCCTCTGCCTGGG + Intergenic
1147825386 17:43267090-43267112 CCCCGGGGCCGCCTCTGCCTGGG + Intergenic
1147826509 17:43273557-43273579 CCCCGGGGCCGCCTCTGCCTGGG + Intergenic
1147827398 17:43278435-43278457 CCCCGGGGCCGCCTCTGCCTGGG + Intergenic
1147828506 17:43284596-43284618 CCCCGGGGCCGCCTCTGCCTGGG + Intergenic
1147829615 17:43290748-43290770 CCCCGGGGCCGCCTCTGCCTGGG + Intergenic
1147830703 17:43296880-43296902 CCCCGGGCGCGCCTCTGCCTGGG + Intergenic
1147831392 17:43300498-43300520 CCCCGGGGCCGCCTCTGCCTGGG + Intergenic
1149865756 17:60150156-60150178 CGCGGGGGGATCCTCTGCAGGGG - Intronic
1151780200 17:76240424-76240446 CCGCGGCGGCGCCTCTGCCAAGG + Intergenic
1151911130 17:77083996-77084018 CCCCGTGGCCACCTCTGCATAGG + Intergenic
1152234611 17:79132233-79132255 CCCAGGAGGGGTCTCTGCAGCGG + Intronic
1152237898 17:79148000-79148022 CCCCCGGGGCCCCACGGCAGCGG - Intronic
1152464060 17:80456037-80456059 TCCCGGGACCCCCTCTGCAGGGG - Intergenic
1153514481 18:5891335-5891357 CCCGGGGGGCGCCGCGGCGGGGG + Exonic
1156453839 18:37281791-37281813 CCCTGGGGGGGCCACTGCATGGG - Intronic
1158976552 18:62715904-62715926 CCCCGGCGGCGCCTCGCCTGGGG - Exonic
1160053124 18:75455530-75455552 GCCCGGGGCCGCCTCTGCGCCGG + Intergenic
1160517007 18:79484160-79484182 GCCAGGGGCTGCCTCTGCAGTGG - Intronic
1160521532 18:79510909-79510931 CACCGGGGGCTCCTCCGCCGGGG + Intronic
1160708109 19:539317-539339 CCCCGGGGACGGCACCGCAGAGG - Intronic
1160708139 19:539400-539422 CCCCGGGGACGGCACTGCACGGG - Intronic
1160909494 19:1468172-1468194 CCGCGGAGGAGCTTCTGCAGCGG + Exonic
1161513290 19:4683354-4683376 CCGGGGAGGCGCCTCGGCAGGGG - Intronic
1161951818 19:7471725-7471747 CCCAGTGGGCGCCTCTGCCCAGG - Exonic
1162357305 19:10194364-10194386 CCCCGGGGGCGCTTCTGTGGTGG - Intronic
1162373919 19:10294158-10294180 CTCCGGGGGCGCCACTGAGGGGG + Exonic
1162520135 19:11174752-11174774 CTCCGGGGGCGCATCTGGGGTGG - Intronic
1162966441 19:14158430-14158452 CCCTGGGGGCGCCTCTCTAGTGG - Exonic
1163366107 19:16876931-16876953 CCCAGGTGGCTCCTCTGCTGGGG - Intronic
1164977033 19:32581172-32581194 CCCCGCGAGCGCCTGCGCAGTGG + Exonic
1167469959 19:49670170-49670192 CCCCGGGGGCGCTGCTGACGCGG + Intronic
1168241936 19:55092852-55092874 CCCGTCGGGCGCCTCTGCTGGGG + Exonic
1168637940 19:58010699-58010721 CCCCGGGGCCGCGACTGAAGTGG - Exonic
929188590 2:39120427-39120449 CCCCCGGGGCGCCTCTGGGCGGG + Exonic
929603285 2:43218208-43218230 TCCCGGTGACCCCTCTGCAGGGG - Intergenic
931762451 2:65430662-65430684 CCCCGCGCGCGTCTTTGCAGGGG - Intronic
932476169 2:72007552-72007574 CCTCGGGGGCACCTCTGTAGAGG + Intergenic
932777480 2:74536786-74536808 CCCTGGGGGGGGCCCTGCAGTGG - Exonic
933727122 2:85433343-85433365 GCCCATGGGCGCCTCTGAAGGGG + Intronic
933791850 2:85889163-85889185 CCCCGGGTGCGTCCCTGCAGGGG - Intergenic
934709207 2:96504024-96504046 CCCCGGGGTCCCCACTGCTGAGG + Intronic
934882358 2:97995444-97995466 CCCCGGCGGCGTCCCTGCGGCGG - Intronic
934978562 2:98822704-98822726 CACCGGGGGAGACTCCGCAGCGG + Exonic
937871534 2:126789546-126789568 CCCAGGTGGCGTCTCTGCACAGG + Intergenic
940954406 2:159712333-159712355 CCCCGGGGGCAGCTCTTCAACGG + Intergenic
948207297 2:236168847-236168869 CCCCGGGGGTGGCTCCGGAGGGG - Intergenic
948906800 2:240983523-240983545 CCGAGCGGGCGCGTCTGCAGGGG + Intronic
1173672800 20:44810054-44810076 CCCTGGGGGCGCCTTCCCAGGGG + Intronic
1175813954 20:61873966-61873988 CCCTCGGGGAGCCTCTCCAGTGG + Intronic
1175813958 20:61873977-61873999 CCCCGACGGCGCCACTGGAGAGG - Intronic
1175939344 20:62530791-62530813 CCCCGGGGGTTCTGCTGCAGAGG - Intergenic
1175944685 20:62553228-62553250 TCCCGGGGGTGCCACGGCAGTGG + Intronic
1176207285 20:63895665-63895687 CCCCGGGGTCTCCTCTCCTGCGG + Intronic
1179712075 21:43269109-43269131 CCCCGGGCACGCCTCTGGTGGGG + Intergenic
1180084447 21:45501672-45501694 CCCTGGGGGTCCTTCTGCAGAGG - Intronic
1180084461 21:45501715-45501737 CCCTGGGGGTCCTTCTGCAGAGG - Intronic
1180084475 21:45501758-45501780 CCCTGGGGGTCCTTCTGCAGAGG - Intronic
1180084501 21:45501844-45501866 CCCTGGGGGTCCTTCTGCAGAGG - Intronic
1180084514 21:45501887-45501909 CCCTGGGGGTCCTTCTGCAGAGG - Intronic
1180115858 21:45704493-45704515 CCCCTGGGGCGCCTCTGCCAGGG - Intronic
1180118218 21:45725986-45726008 GCCAGGGCGAGCCTCTGCAGTGG - Intronic
1180187244 21:46145835-46145857 CCCCGGGGGCGGCTCGGTGGCGG - Exonic
1180455546 22:15510951-15510973 GCCTGGCGGCGCGTCTGCAGCGG + Intergenic
1181155511 22:20917646-20917668 CCCCGGGGTGGCCTCCGCTGCGG + Exonic
1182096779 22:27630910-27630932 CCCAGGGGGAGCCACTCCAGAGG + Intergenic
1182444381 22:30381530-30381552 CTCCAGGTGCGCCTCTGCACAGG + Intronic
1183063038 22:35347118-35347140 ACCCGGGGGCCCCTCAGCTGAGG - Exonic
1184330686 22:43825309-43825331 CTCCGCGGGCTCCTCTGCATTGG + Exonic
1185015325 22:48339450-48339472 CCCTGGGGCCGCCTCTGCAGAGG + Intergenic
950466825 3:13160782-13160804 CCCAGGGGGTGTCTGTGCAGTGG - Intergenic
953236195 3:41109795-41109817 CACAGGGTGAGCCTCTGCAGTGG + Intergenic
953979197 3:47405256-47405278 CCCGTGGGGAGCCTCTGCTGGGG + Intronic
953999277 3:47543097-47543119 CCCCGGGGAGGCCTGTGCCGAGG - Intergenic
954373975 3:50184697-50184719 ACCAGGGGCCGCCGCTGCAGAGG - Exonic
957088580 3:75706493-75706515 CCCAGGGGCTGCCTCTGAAGTGG - Intergenic
961645580 3:128391109-128391131 CACCGGGGGCGGGGCTGCAGAGG - Intronic
965757540 3:172040638-172040660 CCCGAGGGGCGCCTCGGCCGGGG + Intronic
968479500 4:826984-827006 CCCCGGGATTTCCTCTGCAGCGG + Intergenic
968481886 4:836933-836955 CCCGGGAGGCCCCTCTGCCGGGG - Intergenic
968636889 4:1685256-1685278 CCCCAGGGGCCCCTCGCCAGGGG - Intergenic
968674556 4:1870823-1870845 CCACGGCGGGGCCTCTGCGGCGG + Intergenic
968753242 4:2401293-2401315 CCCCTGGGGTGGCTCTGCACAGG - Intronic
968952243 4:3701229-3701251 TCCCAGGGGAGCCTCTGAAGCGG + Intergenic
969422022 4:7103067-7103089 ATCCAGGGGCGTCTCTGCAGCGG + Intergenic
969716284 4:8869829-8869851 CCCAGGTGGCACCCCTGCAGAGG - Intronic
969721324 4:8894303-8894325 TCCCGGAGGCGCTTCTGCCGGGG + Intergenic
978206844 4:106090005-106090027 CCCTGGTGGGGACTCTGCAGGGG + Intronic
982573304 4:157076504-157076526 CTCCGCGGGCGCCACCGCAGCGG - Intronic
985923283 5:2996321-2996343 CACCGGGGCCGCCTCTCCAATGG + Intergenic
990981575 5:61606825-61606847 CCCAGGCTGCGCCTCTGCACCGG - Intergenic
997990804 5:138543133-138543155 CCCCGGCGGCGGCTCCGCGGCGG + Exonic
1000082266 5:157859109-157859131 CACCGGCGGCGCCGCTGCTGTGG - Exonic
1001274489 5:170340503-170340525 CCCCACGGGACCCTCTGCAGTGG - Intergenic
1001586758 5:172838036-172838058 CCTCGGGGGTGCCGCTGCACTGG + Intronic
1002045857 5:176541587-176541609 CCCCCAGGCCTCCTCTGCAGTGG + Intergenic
1002181814 5:177434640-177434662 CCCCGGAGGGGCCTCCCCAGTGG - Intronic
1018013424 6:159692607-159692629 CCCTGGGGTCGCCTCTGCCGGGG + Intronic
1018612938 6:165661797-165661819 CCCAGGGGGCTTCTCTGGAGGGG - Intronic
1019289622 7:243773-243795 CCTGGGCGCCGCCTCTGCAGTGG + Intronic
1019476547 7:1247316-1247338 GCCTGGCCGCGCCTCTGCAGCGG + Intergenic
1019787087 7:2983952-2983974 CCCCATGGGCCCCGCTGCAGAGG + Intronic
1020137371 7:5594562-5594584 CGCGGGGGGCTCCTCTGCAGGGG - Intronic
1022207521 7:28179559-28179581 CCCTGGGGGTGTCTCTCCAGCGG + Intronic
1028609772 7:92697627-92697649 TCCCGGGGGCTTCTCTGCAGTGG - Intronic
1029715135 7:102321557-102321579 CTCCGGGGGCTCCTCGGCGGCGG - Exonic
1032923971 7:136580644-136580666 CCCAGTGGCCTCCTCTGCAGAGG - Intergenic
1033033204 7:137846736-137846758 CGCAGGCGGCGCCGCTGCAGGGG + Exonic
1034128911 7:148698574-148698596 CCCCGGGGGCGCCCCTTCCGCGG - Intronic
1035187649 7:157138998-157139020 CCCGCTGGGCGCCCCTGCAGCGG + Exonic
1035323679 7:158051102-158051124 CCCATGGGGGGCATCTGCAGGGG + Intronic
1035352470 7:158256314-158256336 CCCCGCGGCTGCCTCTGCTGAGG + Intronic
1035723655 8:1811991-1812013 CCAGGGGGAGGCCTCTGCAGAGG + Intergenic
1036691820 8:10949138-10949160 CCCCGGGGCTGCCTCTGCAGGGG + Intronic
1038425531 8:27461824-27461846 CCCAGTGGCCGCCTGTGCAGGGG - Intronic
1038456032 8:27672437-27672459 CCAAGGGGGCTCCTCTGGAGTGG + Exonic
1039472440 8:37821780-37821802 CCCCGGGGGCTGGTATGCAGGGG + Intronic
1044569353 8:93700374-93700396 CCGCGCAGGCGGCTCTGCAGGGG + Intronic
1047231573 8:123002263-123002285 ACCCCGGGTCCCCTCTGCAGTGG + Intergenic
1048574540 8:135680381-135680403 CGCCGGAGGCGGCTCTTCAGCGG - Intergenic
1049725383 8:144143307-144143329 CCCCGGGGAGGCCTCTGGGGAGG + Intergenic
1056732455 9:89178042-89178064 CCCCGAGGGGGCCTGGGCAGCGG + Exonic
1058835306 9:108854820-108854842 CCCCGGGGACAGCCCTGCAGTGG - Exonic
1061242539 9:129382961-129382983 TCCCTGGGGGGCCTCTGGAGTGG + Intergenic
1061453633 9:130682025-130682047 CCCCGAGGGCCCCTCAGCAGAGG + Exonic
1061625594 9:131839043-131839065 CCCAGGGGGTGCTTCTGCCGTGG + Intergenic
1061852875 9:133426128-133426150 CCCTGGGGTCACCTTTGCAGAGG - Intronic
1061924958 9:133801452-133801474 CCAGGGTGACGCCTCTGCAGAGG + Intronic
1061987148 9:134136335-134136357 CCCGGGCGGGGCCGCTGCAGCGG - Intronic
1062343439 9:136103893-136103915 CCCCGGAGGCCCCTATGCACGGG - Intergenic
1062537834 9:137028572-137028594 CCGCGCTGGCGACTCTGCAGAGG + Intronic
1062656400 9:137606188-137606210 CGCCAGGAGCGGCTCTGCAGCGG - Intronic
1186313211 X:8342408-8342430 CCCCGGGGGAAACTCTGGAGAGG - Intergenic
1192473563 X:71420117-71420139 CCCCGGGGTCACGTCTACAGAGG - Intronic
1196582519 X:117393867-117393889 CCCCAGTGGGGACTCTGCAGGGG + Intergenic
1197560506 X:128014870-128014892 CCCCCGTGGAGCCTCTGCATAGG + Intergenic
1200787547 Y:7273748-7273770 CCCCGGGGGCGCCCCGGGCGCGG + Intergenic
1201904748 Y:19077125-19077147 CCCCGGCGGCGCTACCGCAGCGG + Intergenic