ID: 924564515

View in Genome Browser
Species Human (GRCh38)
Location 1:245185664-245185686
Sequence GTGAATAAACTGGTGGTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 185}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924564515 Original CRISPR GTGAATAAACTGGTGGTAAA TGG (reversed) Intronic
900836984 1:5012580-5012602 GTGAATAAAATGATAGAAAATGG - Intergenic
903359835 1:22769942-22769964 GTGGATAAATTGGTGGTGTAAGG + Intronic
910234511 1:85021816-85021838 TTGACTTCACTGGTGGTAAACGG + Intronic
910754023 1:90666703-90666725 GAGAATAAAGTGGTTGAAAAAGG - Intergenic
911499997 1:98673754-98673776 GTGAATAAATTTGTGGTATAGGG - Intronic
911931999 1:103916188-103916210 TTCAATAAACTGTTGTTAAATGG - Intergenic
912725470 1:112055594-112055616 GGGAAGAAATTGGTGGTGAATGG + Intergenic
913001300 1:114583066-114583088 GTTTATAAAATGGGGGTAAAAGG - Exonic
913676131 1:121142407-121142429 GTGAAAAAGCTTGTGGTGAAAGG - Intergenic
918071817 1:181138854-181138876 GTGAAGGACTTGGTGGTAAAGGG + Intergenic
918498897 1:185171679-185171701 ATGAAAAACCTTGTGGTAAAGGG - Intronic
919498238 1:198304313-198304335 GTGATTGAATTGGGGGTAAAGGG - Intronic
920463499 1:206161245-206161267 GTGAAAAAGCTTGTGGTGAAAGG - Intergenic
923060481 1:230467682-230467704 TTGAATAAACTGGTTGCATATGG - Intergenic
924564515 1:245185664-245185686 GTGAATAAACTGGTGGTAAATGG - Intronic
1064288187 10:14011012-14011034 GTGAAGAAACTGGTGCTCAGAGG + Intronic
1065416866 10:25497690-25497712 GTGAATAAAATGGTGAAGAAGGG + Intronic
1066443762 10:35462982-35463004 AAGTATAAACTGCTGGTAAATGG + Intronic
1067364254 10:45610422-45610444 GTGTAGAAACAGGTTGTAAAGGG + Intergenic
1068572747 10:58649103-58649125 GTGATAAAAGTGGTGGGAAATGG + Intronic
1068836763 10:61563843-61563865 ATGATCAATCTGGTGGTAAACGG + Intergenic
1069282550 10:66673205-66673227 CTGACTAAAGTGGTGCTAAATGG - Intronic
1071134993 10:82443514-82443536 ATGAAAAAAATGGTTGTAAAAGG - Intronic
1071362600 10:84864467-84864489 TTGTATAAACTGGTGGTACAAGG + Intergenic
1073998222 10:109340293-109340315 TTGCATAAACTGTTGTTAAATGG - Intergenic
1079103545 11:17556593-17556615 GTGAATGAAGAGTTGGTAAATGG + Intronic
1081506437 11:43721895-43721917 GTAAATAGACTAGTGGCAAAGGG + Intronic
1082131360 11:48493410-48493432 GTGAATAGAATGGTGGTAATCGG + Intergenic
1082564856 11:54664284-54664306 GTGAATAGAATGGTGGTTACCGG + Intergenic
1082565568 11:54674215-54674237 CTGAAAAAGCTGGGGGTAAAAGG + Intergenic
1084649419 11:70479986-70480008 GTGAATGCACTGGTGGCACAGGG - Intronic
1085177174 11:74499755-74499777 CTGAAAAAAATGGTAGTAAAGGG - Intronic
1089544731 11:119214771-119214793 GTTAATAAACTGAAGCTAAAAGG - Intronic
1090251510 11:125255082-125255104 ATCTATAAAATGGTGGTAAATGG - Intronic
1092583562 12:9874403-9874425 GTGAATAAAATAGAGGTAAATGG - Intergenic
1093031262 12:14291205-14291227 GTGAATAAACTCGTGGGTATAGG - Intergenic
1093043201 12:14409724-14409746 GTGATTATATTGGTGGTGAAAGG - Intronic
1096027500 12:48379723-48379745 GTCAATCATCTGGTGGTAATTGG + Intergenic
1097893812 12:64804674-64804696 ATGAAAAAACTAGTGGGAAAGGG + Intronic
1097959708 12:65520556-65520578 GAGAATAAACTGGTGGGAGTTGG - Intergenic
1098146435 12:67502470-67502492 GTGTATAAAATGGAGGAAAATGG - Intergenic
1101683928 12:106997971-106997993 GTGAAAAAACTGTTGAAAAAAGG + Exonic
1102220191 12:111188964-111188986 GTGAATATTCTGGGGGTAAAGGG - Intronic
1107963168 13:45576550-45576572 ATGAATGAACTGGTAGAAAAGGG + Intronic
1108704615 13:52973958-52973980 ATGAATAAAATTGAGGTAAACGG - Intergenic
1110290199 13:73796961-73796983 TAGAACTAACTGGTGGTAAAAGG + Intronic
1114145556 14:19972917-19972939 GGGAATGTACTGGGGGTAAAGGG + Intergenic
1115057646 14:29150626-29150648 CTAAATAAACTGGTGGGACATGG - Intergenic
1116483430 14:45418531-45418553 GGAGATAAACTGGTAGTAAATGG + Intergenic
1117246294 14:53889867-53889889 GTGAGGAAAGTGGTGGGAAAGGG + Intergenic
1117833064 14:59772909-59772931 GTGAATGAACTCCAGGTAAATGG + Intronic
1118315175 14:64721731-64721753 GTGAGGAAACTGCTGGGAAAGGG + Intronic
1119594180 14:75918421-75918443 GTCAAGAAGCTGGTGGTAGAGGG - Intronic
1119750225 14:77072080-77072102 GTGCATAAAGTGGTGATTAAAGG - Intergenic
1120329509 14:83072764-83072786 GTGAATAAAATGTTAGTAAATGG - Intergenic
1120621161 14:86766363-86766385 CTAACTAAACTGATGGTAAATGG + Intergenic
1121294213 14:92804490-92804512 GTGAAGAAAGTGATGGGAAATGG - Intronic
1122600890 14:102921260-102921282 GTGAATAGATAGATGGTAAATGG - Intergenic
1125066403 15:35490995-35491017 GGGAATAGACTTGTGATAAAAGG - Intronic
1125101531 15:35918700-35918722 GTGAATAGAATGGTGGTTATTGG + Intergenic
1130776844 15:86993247-86993269 GGGAATAAACTGGGGTTACAAGG - Intronic
1132678535 16:1130558-1130580 ATGGATAAACTGGGGGTCAAAGG - Intergenic
1133702665 16:8323615-8323637 GTGATTATACAGGTAGTAAATGG - Intergenic
1134137273 16:11685708-11685730 GTTAGTAAACTTTTGGTAAATGG - Intronic
1137749119 16:50845551-50845573 TTGAAAAAACTGGTGGGAAGTGG + Intergenic
1138211925 16:55170431-55170453 TAGAATAAAATGGTGGAAAAGGG + Intergenic
1141726170 16:85790167-85790189 GGGAATAAACTGGTTAAAAATGG + Intronic
1149039048 17:52165607-52165629 GTGAAGACACTGGTGATAACAGG + Intergenic
1151178683 17:72310155-72310177 GAGCATAACCTGGTGGGAAATGG - Intergenic
1154047280 18:10917575-10917597 GTGGTAAAACTGGTGGTCAAAGG + Intronic
1154174028 18:12071523-12071545 GTGGTAAAACTGGTGGTCAAAGG - Intergenic
1155042570 18:22077043-22077065 GAGAATAGACTGGTGGTTACTGG - Intergenic
1156387952 18:36623809-36623831 GTGGATACACTCCTGGTAAACGG + Intronic
1156468750 18:37364245-37364267 GTAAAGAAGCTGGTGGTAAGGGG - Intronic
1156727859 18:40150892-40150914 GTAAATAAAATGGTGGTATAGGG - Intergenic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
928828361 2:35447618-35447640 ATGAAGAAACTGGTGGTAGGTGG - Intergenic
930519318 2:52444103-52444125 GGGAATGAACTGGAGGTAAATGG - Intergenic
933465986 2:82652580-82652602 ATGAAGAGACTGGTTGTAAAAGG - Intergenic
934476879 2:94599549-94599571 GTGGATACACGGGTGGTTAATGG - Intronic
937567970 2:123319232-123319254 GTGAATAAACAGATTGGAAATGG + Intergenic
940336968 2:152539397-152539419 GTGAAAAAGCTTGTGGCAAATGG - Intronic
941610462 2:167654978-167655000 ATGAATAAAATGGAGGTAAGGGG + Intergenic
943407667 2:187510009-187510031 GTGATTACACTGGTGGACAATGG - Intronic
944348383 2:198697082-198697104 GTGAATAAAGTAGTGTTTAAGGG + Intergenic
947944717 2:234091740-234091762 GTGAATAAACTGGAGGAGGAGGG + Intergenic
1170050345 20:12136355-12136377 GTGAATAGAATGGTGGTTACTGG - Intergenic
1173215322 20:41076458-41076480 GTGAAACATATGGTGGTAAAAGG - Intronic
1174257115 20:49264963-49264985 GAGAATAAACTTGTGCTTAAAGG + Intronic
1174389964 20:50213003-50213025 GTAAATAAACAGCTAGTAAATGG + Intergenic
1177759708 21:25389599-25389621 GAGAAAAAACTGATGGCAAAAGG - Intergenic
1177885514 21:26741484-26741506 CTGAGTAAACAGGTGGTAAGAGG - Intergenic
1178892351 21:36530703-36530725 GAGAATAAACAGGTAGCAAAAGG + Intronic
1181681255 22:24497330-24497352 GTGAATCAAATAGTGGGAAAGGG - Intronic
1182594192 22:31405521-31405543 ATGAATAAACTGAGGGAAAAAGG - Intronic
1182597985 22:31436902-31436924 TTGAATCAATTGTTGGTAAAGGG + Intronic
1182995791 22:34810830-34810852 TTTAATAAATGGGTGGTAAATGG + Intergenic
1185093341 22:48789498-48789520 GAAAAGAAACTGGTGGAAAAGGG + Intronic
1185358035 22:50386773-50386795 GTGACTAAACTCTGGGTAAATGG - Intronic
954120251 3:48494136-48494158 CAGAATAAAATGGTGGTAACCGG - Intronic
954262509 3:49449720-49449742 ATGCATAAACTTGTAGTAAATGG + Intergenic
954358916 3:50107402-50107424 GTGAATCAGTTGGTGGTATAGGG + Intronic
954782375 3:53071244-53071266 GTGAAGAAGCTGTTGGCAAAGGG + Intronic
958579694 3:96001956-96001978 CTGAATAACATTGTGGTAAATGG + Intergenic
958666555 3:97146801-97146823 GAGAATGAACTGGAGGTAAAAGG - Intronic
958807958 3:98834475-98834497 GAGAATAGACTGGTGGTTACTGG - Intronic
958889735 3:99770122-99770144 GTTAATTAACTGGGGGTAAATGG + Intronic
960369195 3:116812616-116812638 ATGAATAAATTGGTTGTAAGAGG + Intronic
960871865 3:122257992-122258014 TTCAATAAACTGTTAGTAAATGG - Intronic
962676423 3:137761706-137761728 TTGAATAAACCGGTGGTCACCGG + Intergenic
964784053 3:160374055-160374077 GTGAATCCACAGGTAGTAAATGG + Intronic
965894914 3:173563859-173563881 GTGTAGAAACTGGTTGTAGAGGG - Intronic
966045431 3:175542885-175542907 ATGAATAAACAGGAGGAAAATGG + Intronic
966468505 3:180260428-180260450 CTGAAAAAACTGGGGATAAAAGG + Intergenic
967838315 3:193982649-193982671 TTGAATAAGCTAGTGGAAAAAGG - Intergenic
968290803 3:197538257-197538279 GTGAATGAGCAGGTGGTAACAGG + Intronic
971496050 4:27266523-27266545 GTTATTAAAGTGGTGGTAAGTGG + Intergenic
971732093 4:30397479-30397501 GTGAATAAATTGGGACTAAAAGG + Intergenic
971930876 4:33081198-33081220 ATTAAGAAACCGGTGGTAAATGG - Intergenic
972639611 4:40913733-40913755 GTGAAAAAAGTGGTACTAAATGG - Intronic
974203812 4:58673463-58673485 GTGAATAAACTGCCGAAAAAGGG + Intergenic
977065451 4:92307292-92307314 GTGATGAAACTGGAGGGAAAGGG + Intronic
979787172 4:124730671-124730693 GTGGATAAAATGATGGCAAATGG - Intergenic
981562123 4:146059416-146059438 GAGAATAAACTGGTGGGCTAAGG - Intergenic
982190261 4:152847070-152847092 ATGACTAAACTGCTGGCAAAGGG - Intronic
986628392 5:9745064-9745086 GAGAATGAATTGGTGGAAAAAGG + Intergenic
987716229 5:21575545-21575567 TTCAATAAACTGGTGTTAAAAGG - Intergenic
988568688 5:32342735-32342757 AGAAAGAAACTGGTGGTAAATGG - Intergenic
989141679 5:38207732-38207754 TTTAATAAACTGATGGTATAAGG + Intergenic
990590982 5:57264577-57264599 ATGAGTTAACTGCTGGTAAATGG - Intronic
990978914 5:61584268-61584290 GTGAAGAACATGGTGGGAAAAGG + Intergenic
992063010 5:73075631-73075653 GAGAATAAACTGGGGGCAGAGGG + Intronic
993643696 5:90436632-90436654 GTGATTAAACTGATGATACATGG - Intergenic
994090978 5:95809343-95809365 ATTCCTAAACTGGTGGTAAATGG - Intronic
994564893 5:101431141-101431163 GTGAACAAACTTTTTGTAAAAGG + Intergenic
996618614 5:125472236-125472258 GTGAATATAGAGGTGGTTAATGG - Intergenic
997893650 5:137696744-137696766 CTGAAGAAACTGGTGCTCAAAGG - Intronic
998119601 5:139564783-139564805 GGGAATAAACTAGGGGAAAATGG - Intronic
998216386 5:140241165-140241187 CTGATTAAACTGGAGGAAAAAGG + Intronic
999708269 5:154293663-154293685 GAGAATAAACATGTGGCAAATGG - Intronic
1000768410 5:165319707-165319729 ATGAATAAACTGTTGGAAACTGG - Intergenic
1001358488 5:171056900-171056922 CTGAATAAACTGTAGGAAAAAGG - Intronic
1003812491 6:9800436-9800458 GGGAATTATCTGGGGGTAAAAGG - Intronic
1005430010 6:25746466-25746488 CTTAATAAACTGGGGGTAATGGG + Intergenic
1008778241 6:55067459-55067481 GAGAATAGAATGGTGGTTAACGG - Intergenic
1009621924 6:66088438-66088460 GAGAGTACAATGGTGGTAAACGG + Intergenic
1009807712 6:68623861-68623883 TTGAATAAACTGGGTGTGAAGGG - Intergenic
1009809491 6:68642132-68642154 GTGAATAAAATGGGAGTCAAAGG - Intronic
1011123246 6:83978047-83978069 GTTTATAAACTGGTGGCCAATGG - Intergenic
1016071614 6:139746194-139746216 ATGAAAAAACTGGAGGTCAAGGG - Intergenic
1016604716 6:145907186-145907208 GTGAATAAGCAGGTGGGTAATGG - Intronic
1020020665 7:4865771-4865793 GTGAAAAACCTTGTGGTGAAGGG - Intronic
1021185031 7:17554419-17554441 GTGAAAACACTGGTGTTGAAGGG - Intergenic
1021840947 7:24721512-24721534 GTGCATGAACTGTTGGTAACAGG + Intronic
1023436452 7:40145227-40145249 GTAAATATACTTTTGGTAAAAGG - Intronic
1023835890 7:44066898-44066920 GTGAATCAACTCTTGGTCAAAGG - Intronic
1027691518 7:81352818-81352840 TTGAATAAACTTAAGGTAAAGGG - Intergenic
1030555224 7:111015667-111015689 CTGAGGAAACTGGCGGTAAATGG + Intronic
1031218063 7:118923216-118923238 GTGAGTATACTTGGGGTAAATGG - Intergenic
1033947717 7:146742332-146742354 GTGAACATACTGGTGGTCAGTGG - Intronic
1034879611 7:154753214-154753236 GGGAATAAACGGGTGGTGCATGG + Intronic
1036412233 8:8512857-8512879 GTGATGAAACTGGTGGTATCGGG - Intergenic
1038813694 8:30879054-30879076 GAGAATACACTGATGGCAAATGG - Intronic
1038901091 8:31844629-31844651 GTGAGTAAACTGATGCTCAAAGG - Intronic
1041037116 8:53803917-53803939 GAGAGGAAACTGATGGTAAATGG - Intronic
1042135500 8:65629373-65629395 GAGAACAGAATGGTGGTAAAAGG + Intronic
1043551667 8:81380022-81380044 ATGAATAAAATGGTACTAAATGG - Intergenic
1043715440 8:83479234-83479256 GAAAATAAAGTGGTGGGAAAAGG + Intergenic
1045677989 8:104629428-104629450 GTGAGTAAAGTGGTGGAAAGGGG - Intronic
1047041340 8:120999633-120999655 GTGAATAGATATGTGGTAAAAGG - Intergenic
1048310627 8:133319895-133319917 GTGAGGAAAGTGGTGGTAACAGG - Intergenic
1050361945 9:4838469-4838491 GTGAAAAAGCTGGCAGTAAAGGG + Intronic
1050518531 9:6471833-6471855 GAGAAGAAACTGGTGGGAATAGG + Intronic
1052032380 9:23643454-23643476 ATGGTTAAACTGGTGGTAGAAGG + Intergenic
1053681186 9:40486531-40486553 GTGGATAGACGGGTGGTTAATGG + Intergenic
1053684839 9:40511510-40511532 GTGAAGAAAGTGGGGGAAAAGGG - Intergenic
1053931175 9:43114855-43114877 GTGGATACACGGGTGGTTAATGG + Intergenic
1054278888 9:63113446-63113468 GTGAAGAAAGTGGGGGAAAAGGG + Intergenic
1054282528 9:63138403-63138425 GTGGATAGACGGGTGGTTAATGG - Intergenic
1054294273 9:63322046-63322068 GTGGATACACGGGTGGTTAACGG + Intergenic
1054297931 9:63346973-63346995 GTGAAGAAAGTGGGGGAAAAGGG - Intergenic
1054392295 9:64626535-64626557 GTGGATACACGGGTGGTTAATGG + Intergenic
1054395948 9:64651491-64651513 GTGAAGAAAGTGGGGGAAAAGGG - Intergenic
1054426943 9:65131746-65131768 GTGGATACACGGGTGGTTAATGG + Intergenic
1054430592 9:65156686-65156708 GTGAAGAAAGTGGGGGAAAAGGG - Intergenic
1054499788 9:65864835-65864857 GTGAAGAAAGTGGGGGAAAAGGG + Intergenic
1054503432 9:65889794-65889816 GTGGATACACGGGTGGTTAATGG - Intronic
1055550540 9:77428521-77428543 CTGAATGAATTGGTGGTGAATGG - Intronic
1187172792 X:16868889-16868911 GTGTATAGTGTGGTGGTAAAAGG - Intronic
1187890120 X:23926477-23926499 GTTAATACACTGCTGGTAAGTGG - Intronic
1188908430 X:35816455-35816477 TTGAGTAAACTGCAGGTAAAAGG - Intergenic
1189594755 X:42552241-42552263 GTGAGCATAATGGTGGTAAAAGG + Intergenic
1190842016 X:54154078-54154100 GAGAATAAAATGGAGGTAAGGGG + Intronic
1194125280 X:90008842-90008864 GTGAATAAACAGGTTTTAAATGG - Intergenic
1194380084 X:93180892-93180914 GTGAATAAACTACTGACAAAAGG + Intergenic
1194572453 X:95569728-95569750 GGGAAAAAAATGGTGGTAAATGG - Intergenic
1194823812 X:98537180-98537202 CTGAAAAAACTGGGTGTAAAAGG + Intergenic
1197230297 X:123996786-123996808 GTCCTTCAACTGGTGGTAAATGG - Intronic
1200961107 Y:8996949-8996971 GTAAATCAACAGGTGGTAAAGGG + Intergenic
1201853397 Y:18514441-18514463 GAGATTAAACTGGTGGAAGATGG + Intergenic
1201879924 Y:18805943-18805965 GAGATTAAACTGGTGGAAGATGG - Intronic