ID: 924567499

View in Genome Browser
Species Human (GRCh38)
Location 1:245210789-245210811
Sequence CAGGACTAGCTGGCTGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924567499_924567504 -10 Left 924567499 1:245210789-245210811 CCGTCCTCAGCCAGCTAGTCCTG 0: 1
1: 0
2: 2
3: 30
4: 236
Right 924567504 1:245210802-245210824 GCTAGTCCTGCAGGGCTGTTCGG 0: 1
1: 0
2: 1
3: 8
4: 140
924567499_924567506 0 Left 924567499 1:245210789-245210811 CCGTCCTCAGCCAGCTAGTCCTG 0: 1
1: 0
2: 2
3: 30
4: 236
Right 924567506 1:245210812-245210834 CAGGGCTGTTCGGAGCATCCAGG 0: 1
1: 0
2: 0
3: 13
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924567499 Original CRISPR CAGGACTAGCTGGCTGAGGA CGG (reversed) Intronic
901480492 1:9521595-9521617 CAGGTTCAGGTGGCTGAGGAAGG - Intergenic
902124941 1:14201514-14201536 CAGGACAGACTGGCTGAGGTGGG - Intergenic
902551691 1:17223319-17223341 CAGGAGCAGCTGGCAGATGAGGG - Intronic
902876184 1:19342280-19342302 CAGGGCTAGCTGGCTTGGAAGGG - Intronic
903332002 1:22601223-22601245 CAGAAGAAGCAGGCTGAGGAAGG - Intronic
903399576 1:23031233-23031255 GAGTACTAGCTTTCTGAGGATGG + Intronic
903847562 1:26287545-26287567 CAGGACAAGCAGGCTGCGGCAGG + Intronic
904384077 1:30130282-30130304 CAGCAGGAGCTGGCTGAGGAGGG + Intergenic
906351048 1:45059896-45059918 CAGGACTACCAGGTTGAGGTGGG + Intronic
906726662 1:48049168-48049190 GAGGAAAAGCTGTCTGAGGAGGG + Intergenic
907304404 1:53505783-53505805 CAGGGCAAGCTTGCTGGGGATGG - Intergenic
907727794 1:57036079-57036101 CTGGGCTTGGTGGCTGAGGAAGG - Intronic
908793072 1:67802423-67802445 CAGGAGTGGCTGGCTGGAGATGG - Intronic
916511136 1:165473310-165473332 CAGGACCAGCTGGCCGGGCATGG + Intergenic
918962498 1:191298304-191298326 CAGGATTGGCTGGCTGACTAGGG - Intergenic
920123818 1:203677839-203677861 CAGGACTTGATGAGTGAGGAAGG - Intronic
920188451 1:204177206-204177228 GAGGACGAGCTGGCTGAGCATGG + Intergenic
920599550 1:207309822-207309844 TTGGACCAGCTGGCTGGGGAGGG + Intergenic
922342892 1:224671557-224671579 CAGGGCTACCTGGTTGAAGAGGG - Intronic
923248130 1:232153877-232153899 GAGGCCTTGCTGGCTGTGGAGGG + Intergenic
923615607 1:235534570-235534592 CAGGACTGGGAGGCTGAGGCGGG + Intergenic
924117682 1:240763519-240763541 CTGGTCTCGCTGGCTCAGGAGGG - Intergenic
924552073 1:245088426-245088448 CAAGACTACATGCCTGAGGAAGG - Intronic
924567499 1:245210789-245210811 CAGGACTAGCTGGCTGAGGACGG - Intronic
1062841250 10:673638-673660 CAGGAATAGCTCCCTGGGGAAGG - Intronic
1064698573 10:17993167-17993189 CAGGCCCTGCTGGATGAGGATGG - Exonic
1068860783 10:61845830-61845852 CAGGATGATCTGGCTGAGGCAGG + Intergenic
1069865211 10:71498158-71498180 CAGGACTAGCTGTGTGACCATGG - Intronic
1070628997 10:78070998-78071020 CAGGCCCAGCTGGCTGAGCAGGG + Intergenic
1072223800 10:93349408-93349430 AAGGACTGGCTGTCTGGGGAAGG - Intronic
1074232724 10:111553847-111553869 CAGGAGAAGCTGACTGAGGGAGG - Intergenic
1074412395 10:113239682-113239704 CAGGACTCCCTGTCTCAGGATGG - Intergenic
1074928121 10:118094272-118094294 CAGCACTAGGTAGCTAAGGAAGG - Intergenic
1076850998 10:133092945-133092967 CAGCTCCAACTGGCTGAGGAAGG - Intronic
1076979788 11:198318-198340 CAGGTCCATTTGGCTGAGGATGG - Intronic
1077282577 11:1752356-1752378 CGGGACAAGAGGGCTGAGGAGGG + Intronic
1077463580 11:2722930-2722952 CAGGACCAACTGGCAGATGAAGG + Intronic
1078133381 11:8632394-8632416 CAGAATCAGATGGCTGAGGAAGG + Intronic
1078827839 11:14948175-14948197 CAGAAAAAGCTGCCTGAGGAGGG - Intronic
1079898838 11:26155608-26155630 TAGGACTGGATGGCTCAGGAAGG - Intergenic
1081565899 11:44261144-44261166 CAGGCCTAGCTGGGGGAGGATGG - Exonic
1081869329 11:46376211-46376233 CAGGGCGAGCTGGCTGCGGGAGG - Intronic
1082831839 11:57624118-57624140 CAGGACCACCAGGGTGAGGATGG + Intergenic
1083314044 11:61803176-61803198 CAGGTAAAGCTGGCTGAGGAAGG + Intronic
1083424342 11:62575416-62575438 CAGCGCCAGCTCGCTGAGGAGGG + Exonic
1083663262 11:64261870-64261892 CAGGAGCACCTGGCTGAGGCCGG + Intronic
1083923422 11:65792342-65792364 CAGTACTAACAGGCAGAGGAGGG + Intronic
1084445562 11:69201734-69201756 CAGAGCCAGCAGGCTGAGGAAGG - Intergenic
1088074276 11:105827044-105827066 TAGGACTTTCTGGATGAGGAAGG - Intronic
1088551470 11:111017705-111017727 CAGCACAATTTGGCTGAGGATGG - Intergenic
1089319023 11:117612641-117612663 CAGGGCTCACTGGCTGGGGAGGG - Intronic
1089623907 11:119739430-119739452 CAGGACCAGCTGTCTGAGGCTGG - Intergenic
1089893581 11:121905180-121905202 CTGGCCTGGTTGGCTGAGGAAGG - Intergenic
1090839106 11:130473883-130473905 CTGGAGTAGCGGGCAGAGGACGG + Exonic
1091077058 11:132629066-132629088 CAGGGCAAGCAGGCTTAGGATGG - Intronic
1091435607 12:470420-470442 CGGGACCAGCTGGCTGGTGAGGG - Intronic
1091456551 12:612400-612422 CAGGAATATCTGGCTCAGGCTGG + Intronic
1091779511 12:3205045-3205067 CAGGACTTGCTGCCCCAGGAAGG - Intronic
1092287579 12:7137698-7137720 CCTGGCTGGCTGGCTGAGGAGGG - Intronic
1092294713 12:7189198-7189220 CAGGCCTAGGAGGCTGAAGAAGG + Intronic
1093420548 12:18969318-18969340 CAGGACTTGCTGGCTCAGGCTGG - Intergenic
1095975710 12:47939599-47939621 CTGGACTAGGTGAGTGAGGAGGG - Intronic
1097072021 12:56362012-56362034 CAGGACAAGGGGTCTGAGGAGGG + Exonic
1099880234 12:88459059-88459081 GAGCCCTAGCAGGCTGAGGAGGG + Intergenic
1100314344 12:93430467-93430489 CAGGACTGGCTGGGTGGGGAGGG + Intronic
1101001828 12:100364533-100364555 TAGCACTGGGTGGCTGAGGACGG + Intronic
1102110450 12:110361541-110361563 CAGCACTGGCAGGCTGAGGTGGG + Intergenic
1102273561 12:111561386-111561408 CAGGAGGAGGTGGCTGAGGGAGG + Intronic
1102492125 12:113295829-113295851 CAGTACCAGCTGGGTGAGGCTGG + Intronic
1102729503 12:115095915-115095937 TATGACTATCTGGCTGAGGAAGG + Intergenic
1102999408 12:117374017-117374039 CAGGACAAGGGGGCTGAGAAGGG + Intronic
1103055806 12:117819207-117819229 CAGAACAAGCTAGCTGTGGAAGG + Intronic
1103154655 12:118674226-118674248 CAGGCCTTGCTGGCTGTGGTGGG + Intergenic
1104374321 12:128250523-128250545 CAGGACAAGAAGGCAGAGGAAGG + Intergenic
1104685220 12:130780508-130780530 CAGGAGTCGCTGGTGGAGGAGGG - Intergenic
1111211148 13:85082064-85082086 AAAGACTATTTGGCTGAGGAAGG - Intergenic
1114184649 14:20391249-20391271 CAGGAGGAGCTGACTGTGGAGGG + Intronic
1116951011 14:50878571-50878593 TAGGACTAGCCTGCAGAGGAGGG - Intronic
1119743327 14:77027856-77027878 GAGGACTGGCCGGCTGGGGAGGG + Exonic
1121148583 14:91608122-91608144 CAGGAATAGCTGTAAGAGGAGGG + Intronic
1121229114 14:92343346-92343368 CAGGAGTAGCTGGCAGACAAAGG + Intronic
1122848629 14:104514491-104514513 CGTGACTAGGAGGCTGAGGAGGG + Intronic
1122886065 14:104710961-104710983 CAGGATCAGCTGGCAGAAGATGG - Exonic
1124590733 15:31050798-31050820 CAGGCCTGGCTGTCTGAAGAAGG + Intronic
1124996941 15:34732656-34732678 CACGTCTAGCTGGCAGAGTAAGG + Intergenic
1126049452 15:44673182-44673204 CAGGAGGTGCTGGCTGAGGAGGG - Intronic
1126743401 15:51800606-51800628 CATTCCTAGATGGCTGAGGAGGG - Intronic
1128001547 15:64197355-64197377 GAGGTCTAGCAGGCAGAGGATGG - Intronic
1128260279 15:66228344-66228366 CAGGTCTGGCTGTCTGTGGAGGG - Intronic
1128396081 15:67227619-67227641 CAAGAAAAGCAGGCTGAGGAAGG + Intronic
1128756913 15:70189503-70189525 CAGGATTGGCTGGCATAGGATGG + Intergenic
1128757732 15:70194835-70194857 CAGGCCTATGTGGCAGAGGAAGG - Intergenic
1129492650 15:75944131-75944153 CAGGACTTGCTGGCTACAGAGGG - Intronic
1129952946 15:79608016-79608038 CAGGAACAGCAGGCTGAGGATGG - Intergenic
1130886224 15:88094721-88094743 CAGCCCTAGCTGACTGAGCAAGG + Intronic
1131091874 15:89629613-89629635 GAGGATTAGCTGGATGAAGAGGG - Intronic
1132461812 16:59185-59207 CAGGATTGGCTGGCTGGGGGTGG - Intronic
1132502212 16:289588-289610 CAGGACAAGATCGCAGAGGAAGG - Exonic
1132584189 16:699188-699210 CGGGCAGAGCTGGCTGAGGAAGG + Intronic
1132690595 16:1180363-1180385 CAGGGCAGGCTGGGTGAGGAGGG + Intronic
1132949797 16:2554772-2554794 CAGGACTATTTGGATGAGGGTGG - Intronic
1132964551 16:2645395-2645417 CAGGACTATTTGGATGAGGGTGG + Intergenic
1133525532 16:6601792-6601814 CAGCACTAGTTGGCTGAGCAAGG - Intronic
1135481748 16:22826407-22826429 CTAGACTAGGTGGCTGAGAATGG - Intronic
1137083687 16:36097281-36097303 GAGGACTACCTGGCTGAGTGAGG + Intergenic
1137571041 16:49566440-49566462 CAGCACTGGCTGGGAGAGGAGGG + Intronic
1137673140 16:50291092-50291114 CAGGTCGAGCTGGTTGAGAAAGG - Intronic
1137728161 16:50670732-50670754 CAGGAGGAGCTGGCTGTGGCAGG + Intronic
1139226346 16:65236038-65236060 CTGGGCTTGCTGGCTCAGGAGGG + Intergenic
1141377227 16:83542612-83542634 CTGGACTAGCTGCCAGAGCATGG - Intronic
1142256463 16:89015920-89015942 CAGGAGCAGGGGGCTGAGGAGGG + Intergenic
1143786393 17:9258926-9258948 CAGGACAAGCTGGCTGTGTACGG - Intronic
1144229346 17:13184770-13184792 CAGGTCGAGTAGGCTGAGGAGGG + Intergenic
1144848959 17:18234466-18234488 CAAGCCAAACTGGCTGAGGAGGG + Intronic
1146010577 17:29191262-29191284 TAGGACTTGGTGCCTGAGGATGG - Intergenic
1147282963 17:39377791-39377813 CAGGACTTGCAGGCTGGGCACGG - Intronic
1147556943 17:41485665-41485687 CTGGCATGGCTGGCTGAGGATGG + Intergenic
1147756028 17:42768558-42768580 CAGCACTAGGAGGCTGAGGCAGG + Intergenic
1149541387 17:57470624-57470646 CAGACCTAGCTGGCAGAGTAGGG + Intronic
1151419003 17:73985369-73985391 CAGGCCTGGCCTGCTGAGGATGG - Intergenic
1151750611 17:76035362-76035384 GAGCACGAGGTGGCTGAGGATGG - Intergenic
1152408287 17:80109739-80109761 CAGGACCAGCTGGCTGATGAGGG - Intergenic
1152946277 17:83199169-83199191 CAGGAGCAGCTGGGAGAGGAGGG - Intergenic
1155300391 18:24423959-24423981 CAGAACTTGCTGCCTGAGTATGG + Intergenic
1156396178 18:36702092-36702114 CAGGAATAGTTGCATGAGGATGG - Intronic
1157528958 18:48406149-48406171 AAGGACCAGCTGGCTGAGGCTGG - Intronic
1160269871 18:77373618-77373640 CAGGACAAGGTGGCAGAGGTGGG + Intergenic
1161847403 19:6719613-6719635 CAGGCCCAGCTGGCTGAGAGTGG - Intronic
1162476004 19:10899621-10899643 CAGGACTGGCTGGGTGTGGCCGG + Intronic
1165396692 19:35568266-35568288 CAGCACTAGGAGGCTGAGGCGGG + Intergenic
1165817044 19:38648589-38648611 CAGGACTGGGGGTCTGAGGAGGG + Intronic
1165826710 19:38709772-38709794 AAGGGCAAGGTGGCTGAGGAGGG + Intronic
1165858065 19:38891932-38891954 CAGGCCTGGCTGCCTGAGGAGGG + Intronic
1166720298 19:44992550-44992572 CAGGCCCACCTGGCTGTGGACGG + Intronic
1168241426 19:55091056-55091078 CAGGCCCACCTGGCTGAGGCTGG + Exonic
925435956 2:3837776-3837798 CACGGCTGGCCGGCTGAGGAAGG - Intronic
926969547 2:18453086-18453108 CAGGTCAAGGTGGCTGAGAATGG + Intergenic
927674368 2:25093746-25093768 CAGGACAGGTTGGATGAGGATGG - Intronic
927828363 2:26326195-26326217 CAGGTCTACCTGTCTGGGGACGG + Intronic
929055928 2:37875840-37875862 GAGGACAGGCTGGCAGAGGAGGG - Intergenic
933769517 2:85734216-85734238 CAGGACAGGCTGCCTGAGGTTGG + Intergenic
934573944 2:95388997-95389019 GAGGACCAGCAGGCTGAGGAGGG + Intergenic
936270101 2:111042713-111042735 CAGCAGTAGCTGGCCAAGGAAGG + Intronic
937138643 2:119577971-119577993 CAGCCCTAGCTGGCTGTGCATGG - Intronic
937475157 2:122208630-122208652 CAGGACTCACAGGCTGAAGAGGG - Intergenic
937867784 2:126767037-126767059 GAGGAGTAGCGGGCTGGGGAAGG - Intergenic
937986083 2:127638720-127638742 CAGGACTTGCTGGCTCAGTGTGG + Exonic
938306435 2:130259574-130259596 CAGAAGTAGCTCCCTGAGGATGG - Intergenic
939017594 2:136920280-136920302 CAGGACGACCTGCCTGTGGAAGG - Intronic
943384516 2:187184888-187184910 CAGGATCAGCTGGCAGAGAAAGG - Intergenic
944748387 2:202681953-202681975 CAGGCCTTGCTGGCAGAGGGAGG + Intronic
946176031 2:217922460-217922482 CAGGCCAAGCTGCCAGAGGACGG + Intronic
947615596 2:231554991-231555013 CAGGACTTACTGTCTGTGGATGG - Intergenic
948498386 2:238370626-238370648 CAGGACCAAATGGCTCAGGAGGG + Intronic
948593509 2:239065609-239065631 CAGGACTGCCGGGCTGGGGAGGG + Intronic
948637566 2:239349207-239349229 CAGGGCCAGCTAGCAGAGGACGG + Intronic
948863105 2:240762399-240762421 CAGGAGTGGCTGGATGATGATGG - Intronic
949045716 2:241871890-241871912 CAAGACCAGCCTGCTGAGGAAGG - Exonic
1169276827 20:4238901-4238923 TGGGACTAGCTGACTAAGGAAGG + Intronic
1169317093 20:4601813-4601835 CAGGACCAGCTGCCTGATCATGG - Intergenic
1171181807 20:23096448-23096470 CAGGACAAGCTGGCTCAGAAAGG + Intergenic
1171200240 20:23234838-23234860 GAGGGCTGGCTGGTTGAGGATGG + Intergenic
1172271679 20:33658791-33658813 CAGGTCCAGGTGGCAGAGGAAGG - Exonic
1172837380 20:37881803-37881825 CAGGCCCTGCTGCCTGAGGACGG + Intergenic
1173016984 20:39234695-39234717 CAGGACTGGCTGCCTGAGGCTGG + Intergenic
1173254906 20:41387352-41387374 CAGGCCTAGCTGGATGAGCCTGG + Intergenic
1173663570 20:44750555-44750577 CAGGACCACCAGGTTGAGGAAGG - Exonic
1173727044 20:45305433-45305455 CAGGAGGAGCTGGCTGCAGAGGG + Intronic
1174052089 20:47773997-47774019 AGGGGCAAGCTGGCTGAGGACGG - Intronic
1175226630 20:57448292-57448314 CAGGTTTAGCTGGCTGATGCTGG - Intergenic
1175403830 20:58714858-58714880 GAGGACAGGCTGGCTGGGGAAGG - Intronic
1176303870 21:5113521-5113543 CAGCACGCCCTGGCTGAGGAGGG - Intergenic
1179853160 21:44148429-44148451 CAGCACGCCCTGGCTGAGGAGGG + Intergenic
1179926319 21:44536217-44536239 CAGGAGCAGCAGCCTGAGGATGG - Intronic
1180057616 21:45367048-45367070 CAGGCCCAGCTGGCGGGGGAGGG + Intergenic
1182106243 22:27691823-27691845 CAGCACTTGTTGGCTGTGGAAGG - Intergenic
1183002514 22:34873393-34873415 CAGTTCTACATGGCTGAGGAGGG + Intergenic
1184169239 22:42749296-42749318 CAGGCCTACATGGCTGGGGAGGG - Intergenic
949485320 3:4532474-4532496 CAGGATTAGGAGGCTGAGGGGGG - Intronic
952259183 3:31723180-31723202 CAGGCTTAGCTGGCTGTGGATGG + Intronic
952965020 3:38615834-38615856 CAGGACTTTCTGGCTGAGCCTGG + Intronic
953054058 3:39373406-39373428 ATGGACTAGCTGGCTGATGCAGG - Intergenic
953875423 3:46663948-46663970 CAGGACTAATTGGCTGGGGAGGG - Intergenic
955140013 3:56259778-56259800 CAGGCCTAGCTTGCTGAGAATGG - Intronic
955945986 3:64194141-64194163 CATGACCAGCTGGCTGTGGAGGG - Intronic
956106425 3:65823531-65823553 CAGGAGAAGCAGGCTGTGGAAGG - Intronic
956784351 3:72630100-72630122 AAGGACTGCCTGGCTGAGGCTGG + Intergenic
956915871 3:73870202-73870224 CAGGCAAAGGTGGCTGAGGATGG + Intergenic
961104263 3:124227884-124227906 CAGGACTTGCCGGCTGATGATGG + Intronic
961689216 3:128656337-128656359 CAGGACTGGCTGTCTGGTGAGGG + Intronic
967082843 3:186066014-186066036 CAGGAACTCCTGGCTGAGGAGGG + Exonic
967977663 3:195044520-195044542 GGGGAGTAGCTGGGTGAGGAGGG - Intergenic
969746810 4:9079087-9079109 CTGGACCATCTGGCTGGGGAGGG + Intergenic
974156293 4:58077544-58077566 CAGGACCAGGAGGCTCAGGAAGG + Intergenic
976042051 4:80898427-80898449 CAGGTTCAGCTGGCAGAGGAAGG - Intronic
980080991 4:128343928-128343950 CAGGATGAGTAGGCTGAGGAGGG + Intergenic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
984947729 4:184983083-184983105 GGGGACCAGCTGGCTGGGGATGG - Intergenic
987678169 5:21103023-21103045 TAGAACTAACAGGCTGAGGAAGG + Intergenic
988294074 5:29331951-29331973 CAGGAAAAGCTGGAGGAGGATGG + Intergenic
989258392 5:39391474-39391496 CAGCACTAGCAGGCTGAGTGGGG + Intronic
989535404 5:42557928-42557950 CAGCACAAACTGGCTGGGGAAGG - Intronic
997368124 5:133338814-133338836 CAGGACTGATTGGCTGGGGATGG - Intronic
997749284 5:136329010-136329032 CAGCACTGCCTGGCTGAGGAAGG - Intronic
998166313 5:139846432-139846454 CCGGCCTAGGTGGTTGAGGAGGG - Intergenic
998650631 5:144117605-144117627 GAGGACTAGCAGGCTCTGGAAGG + Intergenic
1001700346 5:173702220-173702242 CAAGACTGGCTGGCTTAGGATGG - Intergenic
1002386943 5:178875421-178875443 CAGGAGGAGCTGGCAGGGGAAGG + Intronic
1003706067 6:8531543-8531565 AAAGACTATATGGCTGAGGAAGG + Intergenic
1005932884 6:30496989-30497011 CTGGGCTAGCTGGCTGAGAGGGG - Intergenic
1006361178 6:33588256-33588278 CAGGGCAGGCTGGCTGGGGAGGG - Intergenic
1006451472 6:34108072-34108094 CAGCACAGGCTGGGTGAGGAGGG + Intronic
1006576021 6:35046903-35046925 GAGGACTGGCTGGCTAAGGAAGG - Intronic
1006592557 6:35169121-35169143 CAGGCCAGACTGGCTGAGGAGGG + Intergenic
1007708443 6:43805969-43805991 CAGGACTAGCTGGCAGTGAGAGG + Intergenic
1015399044 6:132768174-132768196 CAAGACCACCGGGCTGAGGAAGG + Intergenic
1015462323 6:133505591-133505613 CAGGAAGAGCTGGCAGAGGATGG - Intronic
1017307454 6:152935682-152935704 CAGCACTGGGAGGCTGAGGAGGG - Intergenic
1019580283 7:1758549-1758571 GGAGACTAGCTGGCTGAGGGTGG + Intergenic
1019614138 7:1951269-1951291 CAGGACCAGCTGGTGGATGAAGG + Intronic
1020100284 7:5390528-5390550 CTGACCCAGCTGGCTGAGGAGGG + Exonic
1020326644 7:6979490-6979512 CTGGACCATCTGGCCGAGGAGGG - Intergenic
1020545029 7:9517074-9517096 CTGGAATGGCTGGCTGAGGTGGG - Intergenic
1020659588 7:10966299-10966321 CAGGACTACCTGCCTGAGGATGG - Intergenic
1021189230 7:17601476-17601498 AAGGACTGGATGGCTGAGGTGGG - Intergenic
1021631810 7:22654971-22654993 CAGGACTATCTGCCTGAGCCAGG + Intergenic
1021843854 7:24745303-24745325 CAGGCCTAGGTGGCCAAGGAAGG - Intronic
1023865175 7:44235033-44235055 CAGGACTAGCTGTGTCAGGTTGG + Intronic
1023925526 7:44666696-44666718 CAGGACAAGCCAGATGAGGAGGG - Intronic
1024980370 7:55153118-55153140 CAGGTCTTGCTGGCTGGGGCTGG + Intronic
1027581694 7:80004913-80004935 CAGGACTGAGTGGCTGAGGCAGG + Intergenic
1029547610 7:101218596-101218618 CAGGACCCGAGGGCTGAGGAAGG - Intronic
1030045689 7:105493383-105493405 CAGGAATAGGTGGGTGGGGAGGG - Intronic
1030076166 7:105738928-105738950 CAGTACTAGGTGGATGAGGTGGG + Intronic
1031964675 7:128019094-128019116 AGGAACTAGCTGGCTGAGGTGGG - Intronic
1032079048 7:128849598-128849620 CAAGACTAGATGGCTGGGGAGGG + Intronic
1034047594 7:147946551-147946573 CAGGAATAGTTGGTCGAGGATGG + Intronic
1034677977 7:152905424-152905446 GAGGACAAGCTCCCTGAGGATGG + Intergenic
1039032796 8:33328175-33328197 CAGGACAGGCTGTCCGAGGAGGG + Intergenic
1040072226 8:43197875-43197897 CAGGACCAGCAGGATGAAGAAGG - Exonic
1042591322 8:70402284-70402306 GAGGACGAGGTGGCGGAGGAAGG + Intronic
1043289693 8:78582062-78582084 CTGTACTAGCTGCCTGAAGAAGG - Intronic
1043658833 8:82708790-82708812 CAGGTCCAGTTGGCTGATGAAGG + Intergenic
1046944900 8:119965317-119965339 CTGGACTGGCTGGTTCAGGAAGG + Exonic
1048990637 8:139758206-139758228 CTGGACTTGCTGGCTGGGGCTGG + Intronic
1049214888 8:141402958-141402980 CAGGAATAGATGTCTCAGGAGGG + Intronic
1049592704 8:143469785-143469807 CAGGACCAGCCTGCTGAGGGCGG + Intronic
1051304594 9:15695485-15695507 TTGGCCTAGCTGGCTGAGAAAGG + Intronic
1051735321 9:20192131-20192153 CAGGATTAGGTGGTTGAAGATGG + Intergenic
1053016119 9:34663271-34663293 CAGGCCCTTCTGGCTGAGGAGGG + Intronic
1053458517 9:38250489-38250511 CAGGACAAGCGGGCATAGGATGG - Intergenic
1056839773 9:89989308-89989330 CAGAAGTAACTCGCTGAGGATGG + Intergenic
1057142827 9:92737970-92737992 GAGGCCTATGTGGCTGAGGAGGG - Intronic
1057205127 9:93167311-93167333 ATGGAATCGCTGGCTGAGGATGG - Intergenic
1058666484 9:107322021-107322043 CAGTACTAGCTGCTTGAGGGGGG - Exonic
1061401004 9:130368347-130368369 CAGGCCCAGCTGGCTCAGGAAGG + Intronic
1062285920 9:135772428-135772450 CAGCACCAGATGCCTGAGGAGGG - Intronic
1187267300 X:17747081-17747103 CAGGACTAGGGAGCTGAGGTAGG - Intronic
1187273314 X:17798049-17798071 CAGCACTGGCTGGGTGAGAAAGG - Intergenic
1187317151 X:18206780-18206802 CAGGACTAGAGGGCTGAGGTAGG + Intronic
1187456585 X:19446627-19446649 GAGAAATAGATGGCTGAGGAGGG - Intronic
1187633644 X:21203044-21203066 AAAGACTGGCTGACTGAGGAAGG + Intergenic
1194314394 X:92357010-92357032 CAAGAGCAGGTGGCTGAGGATGG + Intronic
1199948056 X:152683048-152683070 CAGCACTACATGCCTGAGGAAGG + Intergenic
1199961623 X:152785406-152785428 CAGCACTACATGCCTGAGGAAGG - Intergenic
1200142882 X:153910496-153910518 CAGCACTCACTGGTTGAGGAAGG + Exonic
1200622455 Y:5468540-5468562 CAAGAGCAGGTGGCTGAGGATGG + Intronic
1200921555 Y:8617965-8617987 CAGGTCTTGCTGGAGGAGGATGG - Intergenic
1201294348 Y:12450954-12450976 CAGGACCAGCAGACTGAGGTGGG + Intergenic