ID: 924568214

View in Genome Browser
Species Human (GRCh38)
Location 1:245215297-245215319
Sequence TTACCTGGACCGTGTCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 64}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924568214_924568222 4 Left 924568214 1:245215297-245215319 CCAGCATGACACGGTCCAGGTAA 0: 1
1: 0
2: 0
3: 1
4: 64
Right 924568222 1:245215324-245215346 CCTTCACCGTGCTATTGGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 66
924568214_924568225 20 Left 924568214 1:245215297-245215319 CCAGCATGACACGGTCCAGGTAA 0: 1
1: 0
2: 0
3: 1
4: 64
Right 924568225 1:245215340-245215362 GGGAGGGTGTTTTCCAGGACTGG 0: 1
1: 0
2: 0
3: 23
4: 214
924568214_924568220 3 Left 924568214 1:245215297-245215319 CCAGCATGACACGGTCCAGGTAA 0: 1
1: 0
2: 0
3: 1
4: 64
Right 924568220 1:245215323-245215345 CCCTTCACCGTGCTATTGGGAGG No data
924568214_924568218 0 Left 924568214 1:245215297-245215319 CCAGCATGACACGGTCCAGGTAA 0: 1
1: 0
2: 0
3: 1
4: 64
Right 924568218 1:245215320-245215342 CCTCCCTTCACCGTGCTATTGGG 0: 1
1: 0
2: 0
3: 4
4: 78
924568214_924568216 -1 Left 924568214 1:245215297-245215319 CCAGCATGACACGGTCCAGGTAA 0: 1
1: 0
2: 0
3: 1
4: 64
Right 924568216 1:245215319-245215341 ACCTCCCTTCACCGTGCTATTGG 0: 1
1: 0
2: 0
3: 4
4: 71
924568214_924568224 15 Left 924568214 1:245215297-245215319 CCAGCATGACACGGTCCAGGTAA 0: 1
1: 0
2: 0
3: 1
4: 64
Right 924568224 1:245215335-245215357 CTATTGGGAGGGTGTTTTCCAGG 0: 1
1: 0
2: 1
3: 6
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924568214 Original CRISPR TTACCTGGACCGTGTCATGC TGG (reversed) Intronic
900609752 1:3539516-3539538 TGACTTGGCCCGGGTCATGCAGG + Intronic
915092881 1:153438850-153438872 CTGCATGCACCGTGTCATGCAGG - Intronic
920075882 1:203336173-203336195 TTTCCTGGACCGTGTGGTCCAGG - Intergenic
920202164 1:204266279-204266301 TGGCCTGGACTCTGTCATGCAGG - Intronic
922139021 1:222862877-222862899 TTACCTGGAATGTGTGATCCTGG - Intergenic
924568214 1:245215297-245215319 TTACCTGGACCGTGTCATGCTGG - Intronic
1067158961 10:43806763-43806785 TTAGCTGGACATGGTCATGCAGG - Intergenic
1068042123 10:51838567-51838589 TTACTTGGAAAGTGTCCTGCAGG + Intronic
1075091018 10:119444273-119444295 ATCCCTAGACCCTGTCATGCAGG - Intronic
1076091803 10:127693083-127693105 TTACCTGGTCCCTGTCCTGGTGG + Intergenic
1076617594 10:131766322-131766344 TGCCATGGACCGTGTCGTGCAGG - Intergenic
1076886078 10:133263075-133263097 CTAGCTGGACCGTGGAATGCTGG + Exonic
1077465880 11:2733448-2733470 TTCCCTGGGCGGTGTCAGGCAGG + Intronic
1078564045 11:12398335-12398357 TCACCTGGTCCCTGTCATGCAGG - Intronic
1085917144 11:80903390-80903412 TTATCTCTACTGTGTCATGCAGG - Intergenic
1101309255 12:103561406-103561428 TTACCAGAACCTGGTCATGCTGG - Intergenic
1101364441 12:104058682-104058704 TTACCTGGACTGTTTCATTTGGG - Intronic
1106786261 13:33110769-33110791 TTACCTGAACCATCTCATCCAGG - Exonic
1122089757 14:99330516-99330538 TGCCCTGGACCTTGGCATGCTGG + Intergenic
1122229537 14:100298838-100298860 TCACCTTGACCGTGTCAAACGGG + Exonic
1132484945 16:185995-186017 TTACCTGCACCTTTTCCTGCAGG - Intergenic
1132554624 16:567057-567079 TTACCTGGGCCCTGTCTCGCTGG - Exonic
1135226701 16:20666017-20666039 TTGCCTGGTCAGTGTGATGCTGG - Intronic
1135924196 16:26677858-26677880 TGACTTGGACCCAGTCATGCAGG - Intergenic
1145929708 17:28676412-28676434 TTACCTGGAACCTCTCAGGCAGG - Exonic
1151809823 17:76432400-76432422 TCACATGTACCGTGGCATGCTGG - Intronic
1158157501 18:54442380-54442402 TTACATAGACCCTGTCATACAGG + Intergenic
1161097495 19:2401286-2401308 TCACCTTGACCTTGACATGCAGG + Intronic
925939026 2:8797217-8797239 TTACCTGGACGTTGACAGGCTGG - Intronic
926628759 2:15118128-15118150 CTATCTCGACCGTGTCAGGCGGG + Intergenic
931683066 2:64768682-64768704 ATACCTGGACAGGGTCAAGCTGG - Intergenic
932056248 2:68447199-68447221 TCACCTGGACCGTGAGATGGTGG + Intergenic
932772191 2:74506768-74506790 CAAACTGGACCGGGTCATGCAGG - Exonic
937850660 2:126631482-126631504 TAACCAGGACAGTGTCATACTGG + Intergenic
938739058 2:134213865-134213887 TTCCCTGAACCCTGTCATGTGGG + Intronic
941806649 2:169716905-169716927 TTACCTGTGCTGTGTCCTGCAGG + Intronic
1173827575 20:46057542-46057564 GCACCTGGACCGGGTGATGCTGG + Exonic
1185015565 22:48340712-48340734 TTGGCTGGACCCTGTCGTGCTGG + Intergenic
953485434 3:43290000-43290022 TTGCCTGGACCGTTTAATGTAGG + Intronic
957980686 3:87505997-87506019 TTACTTTGACAGTCTCATGCAGG + Intergenic
960057585 3:113286273-113286295 TAAACTGGACCGTGTCAATCTGG + Intronic
968787905 4:2637703-2637725 ATAACTGGACCGGGGCATGCAGG - Intronic
971089540 4:23324835-23324857 TTTCCTGGACCCTGTGATTCTGG + Intergenic
971865577 4:32166378-32166400 TAACCTGGAGATTGTCATGCTGG + Intergenic
975392067 4:73832090-73832112 TTACCTGCACTGTGTCCAGCTGG - Intergenic
976623033 4:87148529-87148551 TTGCCTGGACAGTGTAAGGCAGG - Intergenic
978335655 4:107665828-107665850 TTACCTGGACACTGGCAGGCAGG + Intronic
983271224 4:165564229-165564251 TTGCCTGGACCATGTCCTGATGG - Intergenic
985827173 5:2201144-2201166 CTACCTGGACTGTGCCAGGCTGG - Intergenic
986217999 5:5738928-5738950 GTTCCTGGACTGTGTGATGCTGG - Intergenic
988681701 5:33489917-33489939 TTACCTGGGCCCTGTGATCCTGG + Intergenic
993096249 5:83482238-83482260 TTCCCTGGACATTATCATGCTGG - Intronic
994304038 5:98180650-98180672 CTGCCTGTACTGTGTCATGCAGG - Intergenic
997765745 5:136501496-136501518 TTGCCTCTACTGTGTCATGCAGG + Intergenic
1004425833 6:15506451-15506473 TTAACTGGACCCTATGATGCTGG + Intronic
1020309218 7:6855946-6855968 TTTCCTGGACCGCCTCCTGCAGG + Intergenic
1022631786 7:32092351-32092373 TTACCTGGACCTAGCCCTGCTGG + Intronic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1031644110 7:124202335-124202357 TAACCTGGAAAGTGTGATGCTGG - Intergenic
1035019061 7:155789497-155789519 TGACCTGGACCCAGTCCTGCAGG - Intergenic
1037478130 8:19277673-19277695 TTTCCTGGAGCATGTCAGGCAGG + Intergenic
1039731228 8:40280775-40280797 TTACCTGCCACGTGACATGCTGG + Intergenic
1043484545 8:80686209-80686231 TTAACTGGCCCCTGTCAGGCAGG - Intronic
1052058264 9:23926956-23926978 TTGCCTGGTACATGTCATGCAGG - Intergenic
1188024485 X:25194344-25194366 TTAGCTGGACCTTGTCTTCCAGG - Intergenic
1191080351 X:56504232-56504254 TTGTCTCTACCGTGTCATGCAGG - Intergenic