ID: 924569258

View in Genome Browser
Species Human (GRCh38)
Location 1:245223166-245223188
Sequence TAGCTGATTCTCTGTGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 316}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924569258_924569266 19 Left 924569258 1:245223166-245223188 CCCCCACCACAGAGAATCAGCTA 0: 1
1: 0
2: 4
3: 31
4: 316
Right 924569266 1:245223208-245223230 CTGAAGCTGAGAACCCCTGCTGG 0: 1
1: 0
2: 3
3: 21
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924569258 Original CRISPR TAGCTGATTCTCTGTGGTGG GGG (reversed) Intronic
901423218 1:9164722-9164744 CAGATGATTTTTTGTGGTGGGGG - Intergenic
901440002 1:9272106-9272128 TCCCTGCTTCTCTGTGGTGATGG + Intergenic
901954178 1:12771946-12771968 TGGAGGATTCTCTGGGGTGGGGG + Intergenic
901955571 1:12782749-12782771 TGGCTGATTCCCTGAAGTGGTGG + Intergenic
901978943 1:13018800-13018822 TGGCTGATTCCCTGAAGTGGTGG + Intronic
902003139 1:13210138-13210160 TGGCTGATTCCCTGAAGTGGTGG - Intergenic
902022364 1:13355888-13355910 TGGCTGATTCCCTGAAGTGGTGG - Intergenic
904457131 1:30654511-30654533 TAGCTCCTTCCATGTGGTGGTGG - Intergenic
905275304 1:36813774-36813796 TAGCTCATCATCTGAGGTGGGGG + Intronic
905398788 1:37686540-37686562 TACATGATTCTCTGTTGTGAAGG + Intronic
906096857 1:43229746-43229768 TAGGTAATTCTCTGTCATGGAGG + Intronic
906778627 1:48552539-48552561 TAAATGATTCTGTGTTGTGGGGG + Intronic
906834058 1:49063859-49063881 TAGCAGATGCTCTGTCCTGGAGG - Intronic
907053681 1:51345784-51345806 GAGCTGATTCTGCTTGGTGGTGG - Intergenic
908497235 1:64706744-64706766 TAGCTGATCCTCAATGTTGGAGG + Intergenic
909378785 1:74972819-74972841 TAGATGATTCTGTGTACTGGTGG - Intergenic
909494228 1:76260315-76260337 AAGCGTATTCTTTGTGGTGGTGG + Intronic
910682003 1:89876190-89876212 TAGCTTTTTCTCTGTGGTTGAGG + Intronic
912404053 1:109421620-109421642 TAGCTTTTTCTCAGTGGGGGTGG - Intronic
916212572 1:162370839-162370861 TGGATGATTCTTTGTTGTGGGGG - Intronic
916857363 1:168764124-168764146 TTGCTGTTTCTCTGTCTTGGAGG + Intergenic
916876304 1:168973247-168973269 TATCTGATTTTCAGTGGTGCAGG + Intergenic
917904900 1:179579011-179579033 TGGATGATTCTTTGTTGTGGAGG + Intergenic
917960285 1:180138208-180138230 CAGATAATTCTTTGTGGTGGGGG + Intergenic
921821897 1:219626565-219626587 TTGTTGATTCTCTGTGGATGTGG - Intergenic
922311212 1:224392850-224392872 TAAGTGATTCTCTGTGGAGGAGG - Intronic
922421848 1:225465746-225465768 GAGCTGATTCTCTGTGCTTCAGG + Intergenic
922731877 1:227952732-227952754 GAGCTGCTTCTGTTTGGTGGGGG - Intergenic
923365521 1:233256928-233256950 TAGCTCATTTTCTGTGCTGTAGG - Intronic
924053310 1:240099386-240099408 TATCAGATATTCTGTGGTGGGGG + Intronic
924569258 1:245223166-245223188 TAGCTGATTCTCTGTGGTGGGGG - Intronic
924650877 1:245926183-245926205 TTGCTGATGCTTTGTGGAGGTGG - Intronic
1064279435 10:13938091-13938113 TAGAAGATTATCTGTAGTGGTGG - Intronic
1066406579 10:35124931-35124953 TAGTTAATTCTCTGTTGGGGAGG - Intergenic
1066681228 10:37938380-37938402 TGGCTGGTGCTCTGTGATGGGGG - Intergenic
1069283471 10:66684280-66684302 TAGATAATTCTCTATTGTGGAGG - Intronic
1069585127 10:69594798-69594820 TAGCTGCTTCTGTGGAGTGGAGG + Intergenic
1070643693 10:78186860-78186882 TGGATGGTTCTCTGTGGTAGGGG - Intergenic
1071603421 10:86969962-86969984 GAGCTCCTTCTCTGTGGGGGAGG - Intronic
1073323140 10:102627814-102627836 TAGCTGCTCCTCTGGGGTAGAGG + Intronic
1074445073 10:113514935-113514957 TAGCTGTTTGTTTGTTGTGGCGG + Intergenic
1075228059 10:120647452-120647474 TGGTTCATTCTCTGGGGTGGAGG + Intergenic
1077118658 11:896829-896851 CAGCTTAGTTTCTGTGGTGGAGG - Intronic
1080101555 11:28465766-28465788 TAGATAATTCTTTGTTGTGGGGG + Intergenic
1081531978 11:43968164-43968186 TAGATAATTCTTTGTTGTGGGGG - Intergenic
1083097670 11:60268160-60268182 TAGTTGTTTCTCTCTGGAGGGGG - Intergenic
1084813621 11:71631731-71631753 TAGCTGCCTCTCTGTGGGGCAGG - Intergenic
1085959973 11:81450276-81450298 TAGCTGAAACACTGTGTTGGTGG - Intergenic
1085997505 11:81937997-81938019 GAGCAGATTCTATGTGGTGGGGG - Intergenic
1087076736 11:94132910-94132932 GAGCAGGTTCTCTGTGGGGGTGG + Intronic
1088390640 11:109310892-109310914 TAGATGATTCTTTGTTTTGGGGG + Intergenic
1089706054 11:120278645-120278667 CAGCTCATTCCCTGTGGGGGTGG - Intronic
1090509012 11:127351894-127351916 TACCTAATTATCTCTGGTGGGGG - Intergenic
1091357112 11:134945669-134945691 TGGCTGGTTCTCAGTGGAGGTGG + Intergenic
1092115091 12:5995016-5995038 TTTTTGCTTCTCTGTGGTGGTGG + Intronic
1092215559 12:6679338-6679360 TAGATAATTCTCAGGGGTGGGGG + Intronic
1093132413 12:15408136-15408158 TGGATGCTTCTCTGTGGGGGTGG + Intronic
1095426337 12:42078275-42078297 TAGCTAATTCTTAGTTGTGGGGG + Intergenic
1096075267 12:48800181-48800203 GAGCTGGTTCTCTGAGGTCGTGG - Intergenic
1098853326 12:75623898-75623920 TGGATGATTCTTTGTTGTGGTGG + Intergenic
1098907258 12:76174952-76174974 TAGCTGATTCTATGTGGGGTAGG + Intergenic
1099209911 12:79771635-79771657 TAACCGATACTTTGTGGTGGTGG - Intergenic
1101293168 12:103392913-103392935 TATCTCATTCTCAGTGGTGGAGG + Intronic
1101925443 12:108967672-108967694 TGGGTCATTCTTTGTGGTGGGGG + Intronic
1102053093 12:109877579-109877601 TGGCTCATTCTTTGTGGTGGTGG - Intronic
1102227329 12:111237901-111237923 TGGATGATTCCTTGTGGTGGGGG + Intronic
1102528042 12:113525877-113525899 TATCAGAATCTCTGGGGTGGGGG + Intergenic
1102637132 12:114334302-114334324 CAGATAATTCTTTGTGGTGGGGG + Intergenic
1102676086 12:114660136-114660158 TGGGTGATTCTCTGTTGTGGGGG - Intergenic
1102766734 12:115440074-115440096 TAGATAATTCTTTGTGGTTGGGG + Intergenic
1102882163 12:116493922-116493944 TGGATGATTCTTTGTGATGGGGG - Intergenic
1103000862 12:117384496-117384518 CAGATAATTCTTTGTGGTGGGGG - Intronic
1103159219 12:118713700-118713722 TTTCTGATTCTCTCTGATGGAGG + Intergenic
1103187865 12:118976994-118977016 TAGCTATTTCTCTGAGCTGGAGG + Intergenic
1103275068 12:119704560-119704582 CAGATCATTCTGTGTGGTGGGGG + Intronic
1105043964 12:132986451-132986473 TGGCTGAGTCTCTGTGGCCGCGG + Exonic
1106934170 13:34699980-34700002 TTGGTGTTTCTGTGTGGTGGTGG - Intergenic
1107888185 13:44891829-44891851 TGGCTGATTCTTTGTTGTGGGGG + Intergenic
1108086569 13:46799329-46799351 CAGATGATTCTTTGTCGTGGAGG + Intergenic
1110081162 13:71314692-71314714 AGGCTGATTATCTGGGGTGGTGG + Intergenic
1111007276 13:82264354-82264376 TAGCTGTTTACCTGTGCTGGAGG - Intergenic
1111007420 13:82266124-82266146 TAGATGATTCTCTGTGGGATGGG - Intergenic
1111221319 13:85208519-85208541 TGGCAGATTCTTTGTGGTGTTGG + Intergenic
1113488983 13:110677253-110677275 TGACTGGGTCTCTGTGGTGGGGG - Intronic
1113489140 13:110677889-110677911 CAGCTGAGTTTCTGTGGTGGGGG - Intronic
1113824448 13:113240300-113240322 CAGGTGATTCTTTGTGGTGAGGG - Intronic
1115161719 14:30403860-30403882 TAGATAATTCTTTGTTGTGGAGG + Intergenic
1119120751 14:72074356-72074378 TAGCTGATTTTTTGTAGGGGTGG + Intronic
1119449400 14:74695604-74695626 TGGCTGATTCTATCTGGTGTGGG - Intronic
1119726419 14:76924397-76924419 TGGCTTCTTCTCTGGGGTGGGGG + Intergenic
1120048188 14:79832624-79832646 GGGATAATTCTCTGTGGTGGGGG - Intronic
1123885040 15:24718355-24718377 GAGCTGGTGCTCTGTGCTGGGGG + Intergenic
1124241466 15:28031636-28031658 TGGATAATTCTTTGTGGTGGGGG + Intronic
1124783913 15:32661243-32661265 CAGATAATTCTCTGTGGTGGAGG + Intronic
1125141718 15:36415968-36415990 TAGCTGCTTCTCACTGTTGGAGG + Intergenic
1125196040 15:37047017-37047039 TTGCTTAATCTCTGTGGTGCAGG + Intronic
1126572075 15:50163548-50163570 CAGTTCAGTCTCTGTGGTGGTGG - Intronic
1127692192 15:61408355-61408377 TAGCTGATTCTTTTTCATGGTGG + Intergenic
1128064792 15:64757811-64757833 TGGCTGATTTTTTGTGGGGGGGG - Intronic
1128379959 15:67105286-67105308 TAGCTGCCTCTGTTTGGTGGTGG + Intronic
1128412075 15:67409660-67409682 CAAGTGATTCGCTGTGGTGGCGG - Intronic
1128809948 15:70563469-70563491 TGGATGATTCTTTGTGGTAGAGG + Intergenic
1129622980 15:77166419-77166441 CAGGTGATTCTTTGTTGTGGAGG + Intronic
1131280682 15:91018728-91018750 TGGATCATTCTTTGTGGTGGGGG - Intronic
1131562602 15:93457539-93457561 TGGCTGATTCTTTGTTGTGAGGG + Intergenic
1133474843 16:6110870-6110892 CAGGTAATTCTTTGTGGTGGGGG - Intronic
1133755366 16:8758570-8758592 CAGATAATTCTGTGTGGTGGGGG + Intronic
1133848624 16:9480642-9480664 TGACTAAATCTCTGTGGTGGTGG - Intergenic
1133985055 16:10662103-10662125 TGGGTGATTCTCCATGGTGGGGG + Intronic
1134004302 16:10807620-10807642 CAGATCATTCTATGTGGTGGAGG - Intronic
1134229656 16:12419054-12419076 TAGGATATTCTCTGTTGTGGAGG - Intronic
1135250635 16:20899031-20899053 TAGCTGATTCTTTGTGTATGGGG - Intronic
1137643667 16:50056039-50056061 TGGATAATTCTCTGTTGTGGAGG - Intergenic
1137932579 16:52603014-52603036 AAGCTGAGACTCTGTGTTGGAGG - Intergenic
1140986677 16:80164497-80164519 TAGATTGTTCTTTGTGGTGGGGG - Intergenic
1141229407 16:82150719-82150741 CAGATAATTCTTTGTGGTGGTGG - Intronic
1141315851 16:82961905-82961927 CAGATAATTCTTTGTGGTGGAGG - Intronic
1141630511 16:85285290-85285312 TAGCTGATTCTGTATGGGTGGGG + Intergenic
1141768223 16:86072559-86072581 TGGCTGATGCTGTGTGGTGGGGG - Intergenic
1142535706 17:616523-616545 GAGGTGGTGCTCTGTGGTGGTGG - Intronic
1143046697 17:4086582-4086604 GAGCTGCTTCTCTGTGCTGCAGG - Exonic
1143063994 17:4228983-4229005 TAGCAGTTACTATGTGGTGGTGG - Intronic
1144455988 17:15418641-15418663 TAGCTGCTTCTCTGAGGAGCTGG + Intergenic
1148883092 17:50747263-50747285 TAGCTGATTTACTGTGCTGTTGG + Intronic
1149227141 17:54486358-54486380 AACCTGAGTCTCTGAGGTGGGGG - Intergenic
1149561743 17:57612368-57612390 TGGCTGAGTCTCGGGGGTGGAGG + Intronic
1151199518 17:72457459-72457481 CAGATCATTCTTTGTGGTGGAGG + Intergenic
1151202492 17:72478885-72478907 TAGACAATTCTCTTTGGTGGGGG - Intergenic
1151265332 17:72950956-72950978 TGGCTCATTCTCTGTTGTGGGGG - Intronic
1152217028 17:79039319-79039341 TAGATAATCCCCTGTGGTGGGGG - Intronic
1155833255 18:30544517-30544539 TAGATAATTCTCTGTGTAGGGGG - Intergenic
1155983740 18:32207984-32208006 TAGCTGATTCTGGATGATGGTGG - Intronic
1156109532 18:33708564-33708586 TGGATAATCCTCTGTGGTGGGGG + Intronic
1158827835 18:61243382-61243404 GAGATGATTCTCTGTGGTTTGGG + Intergenic
1161939149 19:7391827-7391849 TGGATAATTCTCGGTGGTGGTGG - Intronic
1162342855 19:10102394-10102416 TTGCTCAATCTCTGTTGTGGGGG - Intronic
1163275772 19:16283425-16283447 TCTCTGTTCCTCTGTGGTGGAGG + Intergenic
1163283115 19:16329318-16329340 TGGGCTATTCTCTGTGGTGGGGG - Intergenic
1163337205 19:16680868-16680890 TGGATCATTCTTTGTGGTGGGGG + Intronic
1163382785 19:16979738-16979760 AAGATCATTCTCTGTGGTGGAGG - Intronic
1163417632 19:17195997-17196019 CAGATCATTCTCTGCGGTGGGGG + Intronic
1163477291 19:17533764-17533786 CAGATCATTCTCTGCGGTGGGGG + Intronic
1163683250 19:18695912-18695934 TGGATAATTCCCTGTGGTGGGGG - Intronic
1164964090 19:32465610-32465632 TAGCTGATCCTCTCTGCGGGAGG - Intronic
1165711905 19:38017493-38017515 TAGCTGTTGCTATATGGTGGTGG - Intronic
1167440026 19:49502911-49502933 AAACTGAGGCTCTGTGGTGGAGG - Intergenic
1167786507 19:51642242-51642264 TAGCTCATTCTCAGTTTTGGTGG - Intronic
1168148975 19:54434978-54435000 CAGATCATTCTCTGTGGTGACGG - Intronic
1168474610 19:56666874-56666896 TGGCTGATTCTGTCTGGTGAGGG - Intronic
925494603 2:4432727-4432749 TGGGTGATTCTTTGTGGGGGTGG - Intergenic
926475298 2:13314481-13314503 TAGCTGGTGCTCTGTGCTGGGGG + Intergenic
927404147 2:22748595-22748617 TAATTGATTCTCTTTGTTGGGGG - Intergenic
927646713 2:24881919-24881941 TGGATGGTTCTTTGTGGTGGGGG - Intronic
927932986 2:27057641-27057663 TAGGGGATTCTCTGTGATGTGGG - Intronic
928773779 2:34733920-34733942 TAGATAATTCTTTGTTGTGGGGG + Intergenic
929642073 2:43591465-43591487 TCTGTGATTCTCTGTGGAGGTGG - Intronic
931962937 2:67502007-67502029 TAGGTGATTATTTTTGGTGGTGG - Intergenic
932142826 2:69294765-69294787 TAGCTCACTCTCTCTGGTGCTGG - Intergenic
932735123 2:74249028-74249050 TAGATGATTCTTTGCTGTGGAGG + Intronic
935469350 2:103438279-103438301 TATCAGATTCTCTGGGGTTGGGG + Intergenic
936472653 2:112812626-112812648 AAGCTCATTTTCTGTGGAGGGGG + Intergenic
940152822 2:150621661-150621683 TAACTGATTTATTGTGGTGGTGG + Intergenic
940248656 2:151648603-151648625 TGGATGATTCTTTGTTGTGGGGG + Intronic
940635318 2:156292317-156292339 TAGAAAATTCTTTGTGGTGGGGG - Intergenic
941942531 2:171057487-171057509 TACCTGATGCTCTTTGGTTGAGG - Intronic
942600559 2:177636709-177636731 TAGATAATTCTTTATGGTGGGGG + Intronic
943521230 2:188951288-188951310 TAAATGATTTTCTGTGGTGGAGG - Intergenic
944055975 2:195522367-195522389 TGCCTAGTTCTCTGTGGTGGGGG - Intergenic
944721972 2:202432522-202432544 CAGATGATTCTTTGTTGTGGAGG - Intronic
944846169 2:203670326-203670348 TTGCTGCTTCTTTGTGATGGTGG + Intergenic
947095295 2:226560449-226560471 TAGATAATTCTCTGTAATGGGGG + Intergenic
947117958 2:226791709-226791731 ATGCTGATTGGCTGTGGTGGGGG + Intronic
947655697 2:231825062-231825084 TAGATTATTCTCTGATGTGGCGG - Intergenic
947655813 2:231826043-231826065 TAGATTATTCTCTGATGTGGCGG - Intergenic
947656071 2:231828216-231828238 TAGATTATTCTCTGATGTGGCGG - Intergenic
947656157 2:231828959-231828981 CAGATGATTCTCTGATGTGGCGG - Intergenic
947656455 2:231831427-231831449 TAGATTATTCTCTGATGTGGCGG - Intergenic
947656925 2:231835452-231835474 TAGATTATTCTCTGATGTGGCGG - Intergenic
947657070 2:231836602-231836624 CAGATGATTCTCTGATGTGGCGG - Intergenic
947657080 2:231836691-231836713 TAGATTATTCTCTGATGTGGCGG - Intergenic
947657366 2:231839039-231839061 TAGATTATTCTCTGATGTGGCGG - Intergenic
947658384 2:231847823-231847845 TAGATTATTCTCTGATGTGGCGG - Intergenic
948532469 2:238618646-238618668 TTCTTGATTCTCTGTGGAGGCGG + Intergenic
1170838306 20:19903670-19903692 TAGATAATTCTTTGTCGTGGGGG - Intronic
1173113676 20:40219874-40219896 TGGATGATGCTTTGTGGTGGGGG - Intergenic
1173609930 20:44359618-44359640 TGGAAGATTCTCTGTGGTGAGGG + Intronic
1173925456 20:46778096-46778118 TAGCTAATTCTTTGTAGTCGGGG + Intergenic
1174191539 20:48744101-48744123 CAGATGATTCTCTGTTGTCGGGG + Intronic
1174716244 20:52761809-52761831 TGGGTAATTCTCTGTGGTGAGGG + Intergenic
1174785536 20:53429205-53429227 TGCATAATTCTCTGTGGTGGAGG - Intronic
1174917466 20:54668663-54668685 TGGCTCATTCTCTGCGGCGGGGG + Intergenic
1175499003 20:59436099-59436121 CAGCTCATTCTCTGTGGTGAAGG - Intergenic
1175530605 20:59672204-59672226 TAAATGATGCTCTGTGGCGGGGG - Intronic
1175568127 20:59997098-59997120 CAGATAATTCTCTGTGGTAGAGG - Intronic
1175938136 20:62524557-62524579 CTGCAGATTCTCTGTGTTGGGGG + Intergenic
1178490066 21:33044296-33044318 CAGATACTTCTCTGTGGTGGGGG + Intergenic
1178561681 21:33643595-33643617 TAGCGGCTTCTCTGTGGAGTTGG + Intronic
1178753206 21:35323753-35323775 CAGATCATTCTTTGTGGTGGGGG - Intronic
1178762092 21:35412736-35412758 GAGCAGATCCTCTGTGGAGGAGG + Intronic
1178771660 21:35510539-35510561 GAGCTGCTTCTCTGGGGTGATGG - Intronic
1181925967 22:26358895-26358917 TGGATAATTCTTTGTGGTGGGGG - Intronic
1182012355 22:27011443-27011465 TGGGTGATTCTTTGTGGCGGGGG + Intergenic
1182782245 22:32877469-32877491 TGGATAATTCTCTGTTGTGGGGG + Intronic
1182899380 22:33885302-33885324 TAGCTGACCCTCTGCGGAGGGGG + Intronic
1183001433 22:34862714-34862736 TAGCTGTGTGTCTTTGGTGGAGG - Intergenic
1185356493 22:50375236-50375258 TGGCTGTTTTTCTGGGGTGGAGG - Intronic
949602055 3:5610776-5610798 AAGATCATTCTCTGTTGTGGGGG - Intergenic
951148511 3:19258323-19258345 CCACTGATTCTCTGTGGAGGTGG + Intronic
953073528 3:39547068-39547090 CAGATGGTTCTTTGTGGTGGGGG + Intergenic
953159694 3:40406860-40406882 TAGATAATTCTTTGTTGTGGAGG - Intronic
954090323 3:48279030-48279052 TAGCTGAGTCTCTGGTGTAGGGG + Intronic
955341306 3:58127536-58127558 TAGATGATTCTTTGTGGTGTGGG + Intronic
955718612 3:61857875-61857897 TAGCTAATTATTTGTTGTGGGGG + Intronic
955720443 3:61874746-61874768 TAGATCATTCTTTGTTGTGGAGG - Intronic
956320016 3:67986077-67986099 AAGCTGATTCTCTTTGGGGTAGG - Intergenic
956575872 3:70752356-70752378 TAGCTAAGTCTCTCTGGCGGAGG + Intergenic
957910174 3:86609610-86609632 TATGTGATCCTCAGTGGTGGAGG - Intergenic
960684347 3:120282097-120282119 TTGCTGCTTCTGTGGGGTGGAGG + Intronic
961661568 3:128471348-128471370 TGGATGATTCTTTGTGGTGGAGG - Intergenic
961740682 3:129031491-129031513 CATGTGATTCTCTGGGGTGGTGG + Intronic
962099427 3:132326206-132326228 TAGATAATTCTTTGTTGTGGGGG - Intronic
963227890 3:142881336-142881358 CATCTGATTCTCTGGGGTTGGGG - Intronic
963286010 3:143435299-143435321 CACCTGATTCTCTGAGTTGGAGG + Intronic
966064544 3:175802473-175802495 TAGATAATTCTCTATTGTGGTGG - Intronic
966830468 3:184003687-184003709 TACCTGTTTTACTGTGGTGGTGG - Intronic
967234081 3:187367708-187367730 TAGCTGCCTCTCTGTGGGGCAGG - Intergenic
967906368 3:194504272-194504294 TAGATGATTCTTTGCTGTGGGGG + Intergenic
968406661 4:345775-345797 TTGCTTATCTTCTGTGGTGGAGG - Intronic
972336569 4:38112143-38112165 TTGCTGAATCTAGGTGGTGGTGG + Intronic
974123561 4:57667993-57668015 TACATGATTTTCTGTGGAGGAGG - Intergenic
974209021 4:58745008-58745030 TAGCTGATTCTCTGATGTGGGGG - Intergenic
976285836 4:83370470-83370492 TAACAGCCTCTCTGTGGTGGAGG + Intergenic
976657621 4:87505974-87505996 TTGATGATTCTTTGTTGTGGGGG + Intronic
976824451 4:89245322-89245344 TAACTGATTTTCTTTGGTGCTGG - Exonic
978627605 4:110704857-110704879 TGGATAATTCTCTGTTGTGGGGG - Intergenic
980228730 4:130020436-130020458 TAGCTTATTCTCTGTAGAGTTGG + Intergenic
981016230 4:139977305-139977327 TAGATTCTTCTCTGTGGCGGGGG - Intronic
981522662 4:145679596-145679618 AATCAGAATCTCTGTGGTGGGGG + Intergenic
982112469 4:152069638-152069660 AATCTGAGTCTCTGGGGTGGTGG + Intergenic
982228364 4:153186132-153186154 CAGATGATTCTTTGTGGTGGGGG - Intronic
983100314 4:163618035-163618057 TATCTGATTCACTGTGATGGTGG - Intronic
983832092 4:172339938-172339960 TTGCTGTTTCTCTGTGGCTGAGG + Intronic
986395239 5:7322664-7322686 TGGTTAATTCTCTGTTGTGGGGG - Intergenic
988042658 5:25909567-25909589 TAGCTGCTTCCCGGTGGTGTTGG - Intergenic
988534774 5:32057205-32057227 ATGCTGATTCTCTGTGCTTGGGG + Intronic
988693428 5:33595449-33595471 TGGCTGACTCTTTGTTGTGGGGG - Intronic
989076614 5:37570281-37570303 TAGATGATTCACTGAGGTGGAGG + Intronic
990015974 5:51063505-51063527 TTGCTGATTCCCTTGGGTGGAGG - Intergenic
994206109 5:97037685-97037707 TGGCTAATTCTTTGTTGTGGGGG + Intergenic
995733706 5:115274278-115274300 TAGATAATTCTTTGTTGTGGGGG - Intronic
997653282 5:135537386-135537408 TAGCTGACTCTTTGGGTTGGGGG + Intergenic
998629927 5:143886787-143886809 CAGCTGATTTGCTGTGGCGGAGG + Intergenic
998778828 5:145633489-145633511 TAGCTTATTCTCTCTGTTGCTGG - Intronic
999010380 5:148031850-148031872 TAGCTGAATCTCTTTGGTCTAGG + Intronic
999051506 5:148528775-148528797 TAGCTAATTCTGTCTAGTGGTGG - Intronic
999609185 5:153350939-153350961 TAGATAATTCTTTGTTGTGGGGG + Intergenic
999652100 5:153777745-153777767 TAGCATGTTCTCTGTGGGGGAGG - Intronic
1003286691 6:4740459-4740481 CAGATGGTTCTTTGTGGTGGGGG - Intronic
1003522267 6:6868341-6868363 TAGAAGATTCTTTATGGTGGGGG + Intergenic
1003535762 6:6974001-6974023 TGGATAATTCTCTGCGGTGGGGG - Intergenic
1003897425 6:10620963-10620985 TGGATGATTCTTTGTTGTGGGGG - Intronic
1003962632 6:11223114-11223136 CAGGTCATTCTTTGTGGTGGGGG - Intronic
1004528011 6:16427232-16427254 TGGATGATTCTTTGTGGTGGGGG + Intronic
1004916148 6:20334061-20334083 AGGCTGATTCTCTCTGGGGGAGG - Intergenic
1005609997 6:27514636-27514658 CAGGTCATTCTTTGTGGTGGGGG - Intergenic
1006629206 6:35419125-35419147 TGGCTGATTCTCTGGTTTGGAGG + Intronic
1013579373 6:111518002-111518024 TAGGTGACTCTATATGGTGGTGG - Intergenic
1013638695 6:112052886-112052908 CACCAGATTCTCTGTGGTGGAGG + Intergenic
1014516947 6:122391119-122391141 AAGCTGATTTTCAGTGCTGGGGG - Intergenic
1015039212 6:128696651-128696673 TGGATAATTCTCTGTTGTGGTGG - Intergenic
1016078592 6:139828330-139828352 TGGATGATTCTTTGTTGTGGAGG - Intergenic
1016260582 6:142164967-142164989 TAGAAGATTCCCTTTGGTGGGGG + Intronic
1017616367 6:156250790-156250812 TACCTCGTTCTCTGTGGGGGCGG - Intergenic
1019403295 7:868616-868638 GTGCTGGTTCTCTGTGGTGTTGG + Intronic
1019403349 7:868806-868828 GTGCTGGTTCTCTGTGGTGTTGG + Intronic
1020115280 7:5472724-5472746 CTGCTGAGTCACTGTGGTGGAGG + Intronic
1021793029 7:24225407-24225429 TAGATAATTCTTTGTCGTGGGGG + Intergenic
1022380347 7:29853481-29853503 TAGGGGATGCACTGTGGTGGAGG - Intronic
1022751531 7:33231844-33231866 TAGGTAATTCTTTGTTGTGGAGG + Intronic
1023493512 7:40769306-40769328 TACCTGATTCCTTGAGGTGGTGG + Intronic
1024251445 7:47508675-47508697 CAGCTGATTCACTGTGGGAGGGG - Intronic
1024485249 7:49910241-49910263 TAGCTTATGTTCTGTGGTGGTGG - Intronic
1026406467 7:70071261-70071283 TAGCTGCTTCTCTGTAGGGCTGG + Intronic
1026446164 7:70486806-70486828 TGGCTGGTAGTCTGTGGTGGTGG + Intronic
1028221375 7:88201010-88201032 TAGCATATGCTCTGTGGGGGAGG + Intronic
1029731599 7:102442079-102442101 TCACTGGTTCTCTGTGTTGGGGG - Intronic
1031081937 7:117266629-117266651 TTGCTGATTCCCTGAGGTTGTGG + Intergenic
1031172251 7:118307174-118307196 TAGCTAATTGTCTGGGCTGGTGG - Intergenic
1034409790 7:150934327-150934349 TGGCTGATTCTCTGTTGTGGGGG + Intergenic
1036306788 8:7608885-7608907 CAACTGACTCTCAGTGGTGGGGG + Intergenic
1036357638 8:8056873-8056895 CAACTGACTCTCAGTGGTGGGGG + Intergenic
1036958485 8:13216707-13216729 CAACTGATTCTTTGTTGTGGGGG + Intronic
1038357780 8:26846359-26846381 TGGTTAATTCTCTGTTGTGGGGG + Intronic
1038523926 8:28257175-28257197 TGGATTATTCTCTGTGGTGGGGG + Intergenic
1038578523 8:28726585-28726607 CAGATAATTCTCTGTTGTGGGGG + Intronic
1039398160 8:37245127-37245149 TAGCTCAGGCTCGGTGGTGGTGG + Intergenic
1040859119 8:51980881-51980903 AAGCTGGTTTTCTGTGGTGTTGG - Intergenic
1042199717 8:66269581-66269603 TTCCTGATTCTCTGTGGTTATGG + Intergenic
1042385152 8:68165593-68165615 TAGGGAATTCCCTGTGGTGGTGG + Intronic
1044064654 8:87684655-87684677 TGGCTGATTCTCTCTGGTCATGG - Intergenic
1044530154 8:93298414-93298436 TACTTGATTCTCTGTCATGGAGG - Intergenic
1044828927 8:96226061-96226083 TAGATAATTCTTTGTTGTGGGGG - Intronic
1046618902 8:116506927-116506949 TAACTGATTTCCTGGGGTGGAGG - Intergenic
1046638787 8:116702695-116702717 AAGCTGATTCACTGGGGAGGGGG + Intronic
1047566696 8:126051621-126051643 TCAGTGATTTTCTGTGGTGGGGG + Intergenic
1049814744 8:144592929-144592951 ATGCTGACCCTCTGTGGTGGAGG - Intronic
1050296408 9:4209722-4209744 TAGCTAATTCTTTGTTGTGGGGG + Intronic
1050476450 9:6045945-6045967 TAGGTGATTAGCTCTGGTGGAGG + Intergenic
1051070933 9:13166087-13166109 TAGCTTAATCTGGGTGGTGGTGG - Intronic
1054457376 9:65441239-65441261 TCCCTGATTCTCTGTGGTCAGGG - Intergenic
1055124064 9:72698774-72698796 GGGCTGATGCTCTGTGGTGCTGG + Intronic
1055460954 9:76519788-76519810 TAGATAATTCTTTGTTGTGGGGG + Intergenic
1056550641 9:87650862-87650884 TGGGTGATTCTCTGTCGAGGGGG - Intronic
1056929636 9:90863272-90863294 TAGCTGGTGCTCTGGGGCGGTGG - Intronic
1058248977 9:102668305-102668327 CAGCTCAGTCCCTGTGGTGGTGG - Intergenic
1059021663 9:110582470-110582492 TAGATGATTCTTTGTTGTGGTGG - Intergenic
1059664806 9:116436649-116436671 TAGAGAATTCTCTGTGGAGGTGG + Intronic
1060098213 9:120812885-120812907 TGGCTGATTCTTGGTGGAGGGGG - Intergenic
1060220809 9:121763197-121763219 GAGTCCATTCTCTGTGGTGGTGG + Intronic
1060603639 9:124895301-124895323 TGGATGGTTCTCTGTTGTGGAGG - Intronic
1060603672 9:124895530-124895552 TGGATGGTTCTCTGTTGTGGAGG - Intronic
1060603691 9:124895644-124895666 TGGATGGTTCTCTGTCGTGGAGG - Intronic
1061303125 9:129717902-129717924 TAGTTGATTCTAAGTGCTGGAGG + Intronic
1061827034 9:133264915-133264937 TAGCTGATTTTTTGTGGTTTTGG + Intronic
1185825871 X:3249157-3249179 TGGATGATTCTCTGTGGTGGGGG - Intergenic
1185986695 X:4842751-4842773 TGGGTAATTCTTTGTGGTGGGGG + Intergenic
1186101675 X:6164016-6164038 TAGCTCATCTTCTGTGGTTGTGG - Intronic
1186220455 X:7344268-7344290 CAGATCATTCTCTGTGCTGGAGG + Intronic
1186269935 X:7876065-7876087 TGGATAATTCTTTGTGGTGGGGG + Intergenic
1186486553 X:9938112-9938134 TGGATGACTCTCTGTGGGGGGGG - Intronic
1186536679 X:10357131-10357153 TAGATAATTCTTTGTGGTGAAGG - Intergenic
1186582867 X:10839759-10839781 TGGATCATTCTCTGTTGTGGAGG + Intergenic
1186649534 X:11543504-11543526 TGGATAATTCTTTGTGGTGGTGG - Intronic
1187016846 X:15337395-15337417 TTGCTGAGTCTCTGTGGGGGAGG + Intergenic
1187998745 X:24957984-24958006 TAGGTGATTCTTTGTTGTGGAGG + Intronic
1188188920 X:27149739-27149761 TAGATAATTCTTTGTTGTGGGGG + Intergenic
1189738487 X:44095245-44095267 TCGCTGATTCTCTGTTGCGGGGG + Intergenic
1189948314 X:46203196-46203218 TAGCTGATTCTCAGTTATGCAGG + Intergenic
1191867504 X:65716870-65716892 TAGCTGCTTCCCGGTGGTGTTGG - Exonic
1192050861 X:67722711-67722733 TAGATGGTTCCCTGTGGGGGTGG + Intronic
1194079844 X:89447232-89447254 TAGATAATTATTTGTGGTGGGGG - Intergenic
1194196619 X:90902704-90902726 CAGCAGAGTCCCTGTGGTGGTGG - Intergenic
1194923755 X:99798146-99798168 TAGATAATTCTCTGTTTTGGAGG + Intergenic
1195412569 X:104584085-104584107 AATCAGATTCTCTGGGGTGGGGG - Intronic
1195509906 X:105703145-105703167 TAGATTATTCTTTGTTGTGGGGG + Intronic
1195964652 X:110419012-110419034 TAGCTGATTCCTAGTTGTGGTGG + Intronic
1197155586 X:123266575-123266597 TTGCTGTTTATCAGTGGTGGAGG - Intronic
1199522612 X:148753110-148753132 TAGCTGTTTGTCTGTGGGGGAGG + Intronic
1200432464 Y:3102510-3102532 TAGATAATTATTTGTGGTGGGGG - Intergenic
1200542466 Y:4476905-4476927 CAGCAGAGTCCCTGTGGTGGTGG - Intergenic
1201253121 Y:12080680-12080702 TGGATGATTCTCTGTGGTGGGGG + Intergenic
1201906510 Y:19091203-19091225 TCTTTGATTCTCTGTGGTGAGGG - Intergenic