ID: 924572630

View in Genome Browser
Species Human (GRCh38)
Location 1:245251263-245251285
Sequence GTTCCTACCATTCCTAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924572630_924572635 28 Left 924572630 1:245251263-245251285 CCAGTTCTAGGAATGGTAGGAAC 0: 1
1: 0
2: 5
3: 22
4: 99
Right 924572635 1:245251314-245251336 CAGCCAAGAGTCAACCTTGCAGG 0: 1
1: 1
2: 4
3: 13
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924572630 Original CRISPR GTTCCTACCATTCCTAGAAC TGG (reversed) Intronic
900587296 1:3439521-3439543 GTTCCTAACAGGCCAAGAACTGG + Intergenic
901101546 1:6722953-6722975 GTTCCTACCACTCCAAGACCTGG - Intergenic
901332411 1:8421378-8421400 TTTCTTACCCTTCCCAGAACAGG - Intronic
907334754 1:53692830-53692852 GTGCCTACCATCCAGAGAACTGG - Intronic
910120393 1:83782126-83782148 GTTCCAACCATTCCTAGGACTGG - Intergenic
911663283 1:100527420-100527442 GTTCCTACTATCCCTTGAACAGG - Intergenic
921505996 1:215971244-215971266 CTTCATAGCATTCCTATAACAGG + Intronic
922550161 1:226488858-226488880 GTTCCTGTCCTTCCTAGAACAGG + Intergenic
923369904 1:233299511-233299533 GCACCTACCACTCCTAGGACTGG + Intergenic
924572630 1:245251263-245251285 GTTCCTACCATTCCTAGAACTGG - Intronic
1063182347 10:3615667-3615689 GTTTCTACCATTAGTGGAACTGG - Intergenic
1063230542 10:4062156-4062178 GCTCCTCTCATTCCAAGAACAGG + Intergenic
1066452584 10:35544746-35544768 GCTCCTAGCATTCCCAGGACAGG - Intronic
1069625751 10:69866800-69866822 GCTCCTCCCATTCCCAGAGCCGG - Intronic
1073868132 10:107828718-107828740 GGTCCAATCAATCCTAGAACAGG + Intergenic
1076131771 10:128018521-128018543 TTTCCTGCTATTCCTAGAGCAGG + Intronic
1078650941 11:13191576-13191598 GGTCCTACCATTCTCAGATCTGG + Intergenic
1080749206 11:35137451-35137473 GGTGCTACCATTCCTAGAGAAGG - Intergenic
1081783977 11:45733355-45733377 GTTCCTGCCAATCCTAGGTCTGG - Intergenic
1089143284 11:116305381-116305403 GCAGCTACCATCCCTAGAACCGG - Intergenic
1092226566 12:6752192-6752214 GTTCCAACCATTCCTAGCAATGG + Intronic
1092653055 12:10655040-10655062 ATTTCTACCATTCCTACAACTGG - Intronic
1098949435 12:76624266-76624288 GTTCCCACCATTCCCAGAACTGG - Intergenic
1104020287 12:124987711-124987733 GTTCCTAGCATTTCTGGAAAGGG - Intronic
1104778929 12:131407360-131407382 GTTCCTGCCCCTCCTAGAACAGG + Intergenic
1105303512 13:19154389-19154411 GTTCCTACCCTTACCAGACCAGG - Intergenic
1105831792 13:24169156-24169178 TTTCCTGCCCTTCCTAGAAAAGG + Intronic
1108434964 13:50392837-50392859 GTTGCTCCCATTCCTATAACTGG + Intronic
1112986195 13:105453066-105453088 GTGACTACCATTCCTGGAACTGG - Intergenic
1113985249 13:114309776-114309798 GTGCCTGCCATTCCCAGAACAGG + Intergenic
1115616836 14:35103281-35103303 CTTCCTTCTGTTCCTAGAACAGG + Intronic
1118391551 14:65300025-65300047 GTACATACAATTCCTAGCACAGG - Intergenic
1118405424 14:65418732-65418754 TTTCTTACCATTGCTAGAAGAGG - Intronic
1119294685 14:73523224-73523246 GTTCCTCCCATTCCCTTAACAGG - Exonic
1119777193 14:77256678-77256700 GTTCCAGCCCTTCCTGGAACTGG - Exonic
1120216311 14:81683880-81683902 GTTACCACTATTCCCAGAACTGG - Intergenic
1122194876 14:100077375-100077397 GTTGCTTCCATTCCTTGAAATGG + Intronic
1122519357 14:102332522-102332544 GTCCCCTCCATCCCTAGAACAGG - Intronic
1128915012 15:71551901-71551923 GTTCCCATCATTCCCAGAACTGG - Intronic
1130526763 15:84713919-84713941 TTTCCTACCACTGCTAGAACAGG + Intronic
1130755611 15:86759992-86760014 GTTCCTACAGTTCCTATAAATGG - Intronic
1133520691 16:6553695-6553717 CTTCCAACCATTCATAGAAGTGG - Intronic
1136384551 16:29915059-29915081 GTTCCTAGCATTTCTCCAACTGG - Intronic
1136503655 16:30688479-30688501 GCCCATACCCTTCCTAGAACTGG + Intergenic
1140535971 16:75710029-75710051 ATTTTTACCATTCCTACAACTGG - Intronic
1141244391 16:82292704-82292726 GTTCCCTCCATTCTCAGAACTGG - Intergenic
1145351485 17:22088605-22088627 GTTCCTCCCCTCCCCAGAACGGG + Intergenic
1149829659 17:59861097-59861119 CTTCACTCCATTCCTAGAACTGG - Intronic
1150194771 17:63285901-63285923 GTTCTTACCATTCCCAGAACTGG - Intronic
1150794939 17:68229401-68229423 GTTCCTGCCTGTGCTAGAACTGG + Intergenic
1150901793 17:69287008-69287030 GTTCCTACTATTCTCAAAACAGG + Intronic
1154345202 18:13537597-13537619 GTTCCTAACAGTCCATGAACCGG + Intronic
1155327252 18:24677115-24677137 GTTCCTGAGATTCCTAGAACAGG + Intergenic
1155342508 18:24826917-24826939 CTTCCTAACATTCCTAGCAGGGG + Intergenic
1156067374 18:33160688-33160710 TTTACTACCATTCCTGGATCTGG + Intronic
1156845577 18:41661961-41661983 GATGCTACTATCCCTAGAACTGG - Intergenic
1158891105 18:61872363-61872385 GTTCCTTCCAGTCCTAGAGGTGG + Intronic
1159796297 18:72848242-72848264 CTTCCTACCAATCCTAAATCTGG + Intronic
1164544721 19:29150749-29150771 GGTTCTACCATGCCTGGAACCGG - Intergenic
1164837480 19:31366652-31366674 GATGCCACCCTTCCTAGAACGGG + Intergenic
1165211126 19:34236648-34236670 GTTCCCGCCATTCCCAGAACTGG - Intergenic
1168441857 19:56375119-56375141 GTTTCTACCATTCCCGGAACTGG - Intergenic
925584766 2:5453565-5453587 GTTCCTGCCTTTCCTAGACCTGG + Intergenic
926569556 2:14514479-14514501 TCTCCTACCCTTCCTATAACAGG - Intergenic
926692629 2:15747965-15747987 ATTCCTAACATTCCTAGGGCTGG + Intergenic
927247675 2:20970833-20970855 GTGCCTAGCATTGCTAGAACAGG - Intergenic
929639560 2:43563730-43563752 GTTTCTGCCTTTCCTAGACCAGG - Intronic
932576658 2:72965989-72966011 GTTCCTACCTCTTCTGGAACAGG + Intronic
935543493 2:104376586-104376608 GTGCCCACCCCTCCTAGAACAGG - Intergenic
939026732 2:137023197-137023219 GCTGCTACCATTCCTAGACTTGG + Intronic
944166193 2:196723935-196723957 GTTCCTCCCATTCTAAAAACAGG - Intronic
945961812 2:216143343-216143365 GCTCCTACCTTTCCTACAAATGG - Intronic
947488514 2:230574170-230574192 GTTCCATAGATTCCTAGAACAGG + Intergenic
1175494698 20:59405438-59405460 CTTCCTGCCATTCCTCAAACGGG - Intergenic
951031800 3:17890976-17890998 GTTCCTAACAGGCCTAGGACTGG + Intronic
951994509 3:28712677-28712699 ATTCCTTCCATTCATAGAATTGG - Intergenic
955514002 3:59708814-59708836 GTTCCTATGACTCCAAGAACAGG + Intergenic
960169082 3:114437435-114437457 TTTCCTTCCTTTCCTAGAGCAGG + Intronic
973233253 4:47866724-47866746 GTTCCCACCATTCCCAGAACTGG + Intronic
975588987 4:75981364-75981386 GGTCCTACCATTCGCAGATCTGG + Exonic
977989565 4:103424550-103424572 CTTCCTACCATTCCTCAGACAGG - Intergenic
981186620 4:141811168-141811190 GCTCCTACCATCCCCAGAACTGG + Intergenic
981310190 4:143290372-143290394 GTCCTACCCATTCCTAGAACTGG + Intergenic
981917081 4:150046243-150046265 GTTCCTACCATTTCTAAAAAGGG - Intergenic
987873683 5:23651732-23651754 GTTCCCATCTCTCCTAGAACAGG - Intergenic
988815397 5:34829722-34829744 GTTTCTTGCATTCCTAGAAAGGG - Exonic
996689853 5:126328825-126328847 GTTCCTACCATTGTTAACACAGG - Intergenic
1003356027 6:5371036-5371058 GTTAGTAACATGCCTAGAACTGG + Intronic
1007138379 6:39545487-39545509 GATCCTAACCTTCCAAGAACTGG + Intronic
1007170679 6:39861124-39861146 GTTCCTCCAACACCTAGAACAGG - Intronic
1007996856 6:46316766-46316788 CAGCCTACCTTTCCTAGAACAGG - Intronic
1012589763 6:100966888-100966910 GGGCCCACTATTCCTAGAACAGG + Intergenic
1013044720 6:106473364-106473386 GTTCATACCGATGCTAGAACTGG - Intergenic
1014163221 6:118194711-118194733 GTTTTTACCATTCCTTTAACCGG + Intronic
1015377430 6:132526750-132526772 ATTTTTACCATTCCTACAACTGG - Intergenic
1017213390 6:151881483-151881505 GCTCCTAATATTCCCAGAACTGG - Intronic
1019858873 7:3637980-3638002 TTTCCAAAGATTCCTAGAACTGG - Intronic
1020500060 7:8906679-8906701 GTCCCTACCATTCCCTGAAATGG - Intergenic
1021863486 7:24931099-24931121 GTTCCTTCCATTTCTAGAATAGG + Intronic
1023987325 7:45104438-45104460 GTGCCTACCATGCATAGGACAGG + Intronic
1024767069 7:52672113-52672135 GTGACTACAATTCCTAGAGCTGG + Intergenic
1026315120 7:69221240-69221262 GTTCCTAACAGTCCAAGGACTGG + Intergenic
1028725355 7:94080847-94080869 GTTCCTTCCATTCCCAGAACTGG - Intergenic
1028896578 7:96048335-96048357 GTCCCCACCATTACTAGAGCAGG + Intronic
1029858944 7:103548568-103548590 GTTTATACCATTCTGAGAACAGG + Intronic
1034233010 7:149547383-149547405 GTTCCCATCACACCTAGAACAGG - Intergenic
1036676339 8:10837085-10837107 GTTCCCACCATTCGCAGAACTGG + Intronic
1044907103 8:97016815-97016837 TTTCCTACCAGTCCCTGAACAGG - Intronic
1045244636 8:100432410-100432432 CTTCCTTCCATTCGTATAACAGG - Intergenic
1046886515 8:119373373-119373395 GTTCATGCCTTTCCTAGAAGAGG - Intergenic
1047126378 8:121965694-121965716 GTCCCTGATATTCCTAGAACTGG + Intergenic
1051322553 9:15923904-15923926 GTTACTACAAATCCTAGATCTGG - Intronic
1051593944 9:18805136-18805158 TTTCCTAGCATTTCTAGAAGTGG + Intronic
1052697058 9:31891494-31891516 GTTCCTGCCCTTTCTAGAGCTGG - Intergenic
1059071508 9:111142191-111142213 GTTCCCACCATTTGCAGAACTGG - Intergenic
1186516759 X:10172022-10172044 GTTCCCACCATTCCCAGAGCTGG - Intronic
1187728351 X:22227226-22227248 GTTCTTTCCATTCCTAGCAGGGG - Intronic
1188170083 X:26912974-26912996 ATTCCTACCATTCCAATAATGGG + Intergenic
1189766617 X:44378635-44378657 GTTCCCACCATTTCTAGAATTGG - Intergenic
1189796248 X:44648507-44648529 GTCCGTACAATTCCTTGAACAGG + Intergenic
1194471648 X:94304654-94304676 GAACCTACCATTCCCAGGACTGG + Intergenic
1194714158 X:97271204-97271226 TTTCCTACCACACCTAGCACAGG + Intronic
1195219953 X:102737501-102737523 ATTTCTACCATTCCTACTACTGG + Intronic
1196136082 X:112210942-112210964 GTTCTTGCCATTCCTATTACTGG - Intergenic
1197705446 X:129631415-129631437 GGCCCTACCATTCCTAAAAGAGG - Intergenic
1198811608 X:140541588-140541610 ATTCCTACCTTGCCTAGCACAGG - Intergenic
1200816569 Y:7539445-7539467 GTTCCTACCAGGCCAAGGACTGG + Intergenic