ID: 924580655

View in Genome Browser
Species Human (GRCh38)
Location 1:245321133-245321155
Sequence GGATGAATAGAGAGAGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 844
Summary {0: 1, 1: 0, 2: 5, 3: 103, 4: 735}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924580655_924580664 13 Left 924580655 1:245321133-245321155 CCCTGTTCTCTCTCTATTCATCC 0: 1
1: 0
2: 5
3: 103
4: 735
Right 924580664 1:245321169-245321191 CCCTCATCCCTGGCAGCCAGTGG 0: 1
1: 0
2: 2
3: 45
4: 386
924580655_924580660 3 Left 924580655 1:245321133-245321155 CCCTGTTCTCTCTCTATTCATCC 0: 1
1: 0
2: 5
3: 103
4: 735
Right 924580660 1:245321159-245321181 CCACCATCCACCCTCATCCCTGG 0: 1
1: 1
2: 4
3: 52
4: 487

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924580655 Original CRISPR GGATGAATAGAGAGAGAACA GGG (reversed) Intronic
900756293 1:4437420-4437442 GGAGGAAGAGAGAGAGAAGAGGG + Intergenic
900780333 1:4613805-4613827 GGTTCAAAAGAGAGGGAACATGG + Intergenic
900870908 1:5302103-5302125 GCAAGAATAGGGAGAGAAGAAGG + Intergenic
901360366 1:8693600-8693622 GGATGAATAGGGAGAACATAGGG + Intronic
901380313 1:8869279-8869301 GTATGAAGGGACAGAGAACAAGG + Intronic
902926103 1:19696599-19696621 GGATGGCTAGAGGGAGAAAAGGG + Intronic
903375930 1:22865989-22866011 TGGGGACTAGAGAGAGAACAGGG - Intronic
905979916 1:42215512-42215534 GGAAGAATAAAGAGAGAAAAGGG + Intronic
906515792 1:46438190-46438212 GGATGCAGAGACAGAGAACCAGG + Intergenic
907547390 1:55274197-55274219 GGATGAATAGGTGGAGCACAGGG + Intergenic
908344953 1:63222615-63222637 TTATGAATAGAGAGGGAAAAGGG - Intergenic
908351341 1:63288313-63288335 GGAGGAAGAGAGAGAGAATGGGG + Intergenic
908907428 1:69032184-69032206 TGATGAATAGATAGAGAAAAGGG + Intergenic
909497531 1:76295477-76295499 GGATGACTAGAGAGAGAATAGGG + Intronic
910018672 1:82557883-82557905 GGAGAAAGAGAGAGAGACCAAGG - Intergenic
910252793 1:85215652-85215674 GGATGGAGAGAGAGAGAAAAAGG - Intergenic
910619885 1:89241954-89241976 GGAGGAAGAGAGAGAGAAGGAGG - Intergenic
911276415 1:95864951-95864973 GCATGAATAGGCAGAGCACAGGG - Intergenic
911342969 1:96661790-96661812 AGATGAATAGGTAGAGCACAGGG - Intergenic
911447585 1:98017185-98017207 AGATGAATGGATAGAGAATATGG + Intergenic
911893193 1:103398611-103398633 AGAAGAATAGAGGAAGAACATGG - Intergenic
911921013 1:103761346-103761368 GGATGAAGAGAAAGATTACAGGG + Intergenic
912158033 1:106946506-106946528 GGATGAATAGGCAGAGCACCAGG - Intergenic
912164963 1:107032137-107032159 GAATGAGTATAGAGAGAAGAAGG - Intergenic
912304941 1:108557843-108557865 GAATGAAAAGAGAGAGAGAATGG - Intergenic
912394843 1:109334318-109334340 GGATGAATGGACAAAGAAAATGG + Intronic
912885151 1:113463310-113463332 GGATAAATGGAAAGAGAAGAGGG + Intronic
913032769 1:114927794-114927816 GTAAGAAGAGAGAGAGAATAGGG + Intronic
913468484 1:119168065-119168087 AGATGAATAGATAAAGAAAATGG - Intergenic
913963546 1:143356729-143356751 GGAAGAAAAGGGAGAGAAAAGGG - Intergenic
914004259 1:143718440-143718462 GGGAAAATTGAGAGAGAACACGG + Intergenic
914057906 1:144182318-144182340 GGAAGAAAAGGGAGAGAAAAGGG - Intergenic
914121240 1:144784047-144784069 GGAAGAAAAGGGAGAGAAAAGGG + Intergenic
914244088 1:145873007-145873029 GGATGAAGAGAAGGAGAAAAGGG - Exonic
914857567 1:151363659-151363681 GGAGCAAGAGAGAGAGAGCAAGG - Intergenic
915042374 1:152979813-152979835 AGAGAAAGAGAGAGAGAACAGGG - Intergenic
915263361 1:154695872-154695894 GGATGAATCAAGAAAGAGCATGG + Intergenic
915781581 1:158557225-158557247 GAATGAATACAAAGAAAACATGG + Intergenic
915976867 1:160397061-160397083 GGATGAATAGGGAGTGGTCAAGG + Intergenic
916554077 1:165878119-165878141 GGATGAATGGGCAGAGCACAGGG - Intronic
916651111 1:166835616-166835638 GGAGGGAGAGAGAGAGAAGAAGG - Intergenic
916808540 1:168284088-168284110 GGAGGAAGAGAGAGAGAGAAAGG - Intronic
918110330 1:181450113-181450135 GGAGGAAGAGAGAGAGCAAAGGG + Intronic
918451262 1:184661364-184661386 GGAAGAAAAGAAAGAGAATAGGG - Intergenic
918499540 1:185178633-185178655 CCATGAATAGAGAGAGCAAAGGG + Intronic
919110259 1:193209843-193209865 GGAAGAAGAAAGAGAGAGCAAGG - Intronic
919426141 1:197433538-197433560 GGAATAATAGAGTGAGACCATGG + Intronic
920959541 1:210652176-210652198 GGATTGGAAGAGAGAGAACAGGG + Intronic
920988254 1:210911044-210911066 GGAGGAAGAGAGAGAAAATATGG - Intronic
921434751 1:215105453-215105475 GGATGAATGAAGAAAGAAAATGG - Intronic
921621569 1:217331251-217331273 GGAGGAAGAGAGAGAGAGGAGGG + Intergenic
921698554 1:218240934-218240956 GCATGAATTGAGAGGGAAAAGGG - Intergenic
921754001 1:218831655-218831677 GGATGAATGGATAAAGAAAATGG + Intergenic
921769920 1:219023697-219023719 GGAGGTAGAGAGAGAGATCAAGG + Intergenic
923793632 1:237132860-237132882 GGATGATGTGAGAGTGAACAGGG + Intronic
924580655 1:245321133-245321155 GGATGAATAGAGAGAGAACAGGG - Intronic
924802279 1:247336216-247336238 AGATCAATAGAGAGAGATGAGGG - Intergenic
1062803461 10:397010-397032 GGATGGGAAGGGAGAGAACACGG - Intronic
1063164563 10:3448505-3448527 GGATGAATGGATAAAGAAAATGG - Intergenic
1063732823 10:8719076-8719098 GAAGGAAAAGAGAGAGAAAAGGG - Intergenic
1063756780 10:9019928-9019950 AGATATATGGAGAGAGAACATGG + Intergenic
1063922866 10:10949227-10949249 GGATGAAAGGAGAGAGAATATGG - Intergenic
1065175907 10:23074674-23074696 GTATGGATAGAGAGAGAATTGGG - Intergenic
1065259191 10:23907333-23907355 AGATGGAGAGAGAGAGAAGAGGG + Intronic
1065312344 10:24428425-24428447 GGATGAGTGGAGAGGGGACATGG + Intronic
1065692132 10:28345364-28345386 GGAGTAAGAGAGAGAGAAGAAGG - Intergenic
1066371490 10:34821759-34821781 GGAAGGAGAGAGAGAGAAAAGGG + Intergenic
1066512192 10:36113391-36113413 AGAAGAATGGAGAGAGAACAAGG - Intergenic
1066513593 10:36130248-36130270 GGGAGAAGAGAGAGAGAAAAGGG - Intergenic
1066538915 10:36422801-36422823 GGAAGAGGAGGGAGAGAACAAGG - Intergenic
1068251773 10:54452325-54452347 TGTTGAATAGAGAAAGAAAAAGG - Intronic
1068584824 10:58785583-58785605 ATATGTATAGAGAGAGAACAGGG + Intronic
1068765105 10:60754270-60754292 GAATGAGTAGAGAGAGGACAAGG + Intergenic
1068792458 10:61041915-61041937 GGATGCACAGAGAGACACCAGGG + Intergenic
1068915732 10:62429169-62429191 GGATGCATAGAGAAAGAAGTGGG + Intronic
1069022746 10:63506905-63506927 GGGTGAATAATCAGAGAACAGGG - Intergenic
1069248011 10:66231859-66231881 GGAGGAGTAGAGAGAGAATGGGG - Intronic
1071342030 10:84658261-84658283 GGAAGAATCGAGAAAGACCATGG + Intergenic
1071349544 10:84726356-84726378 GGATGAATAGGTAGAGCACAGGG - Intergenic
1071590104 10:86864765-86864787 GGATGAATTGAGAAACTACAAGG - Intronic
1071951432 10:90707367-90707389 GGAGAAATAGAGAGAGCACAGGG - Intergenic
1072574904 10:96690581-96690603 TGAGGAATAGAGAAAGAACGGGG - Intronic
1072743014 10:97921688-97921710 GGAGGAATGGAGAGAGGCCAAGG - Intronic
1073200220 10:101729318-101729340 GGATGAATAGATAAATAAAATGG - Intergenic
1074008715 10:109455794-109455816 GGATTTATGGAGAGAGAAGAGGG - Intergenic
1075160162 10:120016949-120016971 GGATGAATGGATAAAGAAAATGG + Intergenic
1075513906 10:123094397-123094419 GGAGGAAGAGAAAGAGAACAGGG - Intergenic
1075526988 10:123195264-123195286 GGATAAACAGAGTGAGAAAATGG - Intergenic
1075792969 10:125098628-125098650 GGGTGAACAGAGAGAGAAATGGG + Intronic
1076070232 10:127482969-127482991 GGATGAACAGGGAGTGGACAAGG - Intergenic
1077597109 11:3543195-3543217 GGATGAATGGATAAAGAAAATGG + Intergenic
1077642236 11:3892241-3892263 GGAAGAAAACAGAGAAAACATGG + Intronic
1078276049 11:9847946-9847968 GGGAGAATTGAGAGAGAAGATGG + Intronic
1078707189 11:13755819-13755841 GGATGGATAGACAGATAAAAAGG + Intergenic
1078811096 11:14764253-14764275 TGAGGAGTAGAGAGAGATCAAGG - Intronic
1078872377 11:15360855-15360877 GGATGAAAAGAGATAGAAGGTGG - Intergenic
1079007125 11:16799904-16799926 GCATGAATAGAGGGACAGCAGGG + Intronic
1079314757 11:19398237-19398259 GGAGCAAGAGAGAGAGAGCAAGG + Intronic
1079384516 11:19966918-19966940 GAATGAAAAGAGAGAGAAAGGGG + Intronic
1079553119 11:21725996-21726018 GGATGAATGGATACAGAAAAAGG - Intergenic
1079691411 11:23422592-23422614 GGAATAATCGAGAGAGAACAGGG + Intergenic
1079881482 11:25932826-25932848 GGAAGAAAAGAGGGAGAAAATGG - Intergenic
1080134325 11:28836710-28836732 GGATGCACAGAGTGGGAACAAGG + Intergenic
1080373327 11:31677986-31678008 AGATGAATAGGTAGAGAACAGGG - Intronic
1080561869 11:33471473-33471495 GAATGAGGAGAGAGAGAAGAAGG - Intergenic
1080658958 11:34280482-34280504 GGAGGAAAAGAGAGAGAAAGAGG - Intronic
1080802416 11:35619959-35619981 GGAGGAAAAGAGAGAGATCTGGG + Exonic
1081376276 11:42362390-42362412 AGATTGAGAGAGAGAGAACAAGG - Intergenic
1081395918 11:42586106-42586128 GGAGGAAGAGAGAGAGAAGGAGG + Intergenic
1081430756 11:42974103-42974125 GGAAGGAAAGAGAAAGAACAGGG + Intergenic
1081947738 11:47013450-47013472 AGATGAACAGTGAGAAAACATGG - Intronic
1082721364 11:56681001-56681023 GGAGGAATTGAGAGAGAAGGGGG - Intergenic
1082801341 11:57417062-57417084 GGATGAAATCAGAGAGCACATGG + Intronic
1082931972 11:58617874-58617896 GGAGCAACAGAGGGAGAACAGGG - Exonic
1083378792 11:62247422-62247444 TGATGAAGTGAGAGAGAACTTGG - Intergenic
1084125148 11:67094485-67094507 GAATGAAAAGAGAGAGAAAGAGG + Intergenic
1084253034 11:67917165-67917187 GGATGAATGGATAAAGAAAATGG + Intergenic
1084366422 11:68703883-68703905 GGATGAACAGGCAGAGCACAGGG + Intergenic
1084785570 11:71440021-71440043 GGATGGATGGATAGATAACAGGG + Intronic
1085418527 11:76336042-76336064 GGAGGAAGAGAGAGAGGAAAGGG - Intergenic
1086367124 11:86118691-86118713 GGATCAAAAGAGAGAACACAGGG + Intergenic
1086588728 11:88485901-88485923 GAGTGAAGAGAGAGAGAGCAGGG - Intergenic
1086796876 11:91116024-91116046 AGATGAACAGAGAAAGAAAATGG + Intergenic
1087832974 11:102839663-102839685 GGATGAGTACAGGGAGAACTGGG + Intronic
1087913035 11:103775172-103775194 GGGTGAACAGAGAGGGAAAATGG - Intergenic
1088397590 11:109385585-109385607 GGATGAACAGGCAGAGCACAGGG - Intergenic
1088529666 11:110794667-110794689 GGATAAAATGAGAGAGCACATGG + Intergenic
1088577367 11:111284853-111284875 GGAAGGATTGAGAGAGAACAAGG - Intronic
1088630617 11:111770800-111770822 GGAGGAATAGAGACAGGATATGG - Intergenic
1088790242 11:113218903-113218925 GGATGAGTAGTGAAATAACATGG - Intronic
1089026723 11:115278587-115278609 CGATGAGTATAGAGGGAACAGGG + Intronic
1089153052 11:116379222-116379244 GGCTAAAAAGAGAGAGAACTAGG - Intergenic
1089239186 11:117060646-117060668 GGATGAATAGGTACAGCACAGGG + Intronic
1089726456 11:120484724-120484746 AGGTGAAAAGAGAGAGAAGAGGG - Intronic
1090527379 11:127552060-127552082 GGAGGAATAGAGAGAGGAAGAGG - Intergenic
1090893775 11:130951107-130951129 TGAGGAAGAGAGAGAGAACTTGG + Intergenic
1091032332 11:132201916-132201938 GGATGAAAAGGGAGAGTATATGG + Intronic
1091232592 11:133998373-133998395 GGATGAGGAGGGAGAGAACATGG - Intergenic
1091595668 12:1877457-1877479 TTCTGAATAGAGAGAGATCAGGG - Intronic
1092423280 12:8352033-8352055 GGATGAATGGATAAAGAAAATGG + Intergenic
1092851052 12:12627057-12627079 GGAGGAATAGATGGAGCACAGGG + Intronic
1093123064 12:15295976-15295998 GGAGGAAGAGAGAGAGAAAGGGG - Intronic
1093316630 12:17659516-17659538 GTACGCATAGAGAGAGAAAAGGG + Intergenic
1093586847 12:20847792-20847814 AGGAGAATAGAGAGAGAAAAGGG + Intronic
1093599896 12:21009232-21009254 AGAAGAATAGAGAGAGGACAGGG + Intergenic
1093905986 12:24692308-24692330 TGAGGAATTGAGAGAGCACAGGG - Intergenic
1094100995 12:26762140-26762162 GAAGGAATAGAGAAAGAAAAAGG + Intronic
1094661996 12:32478712-32478734 GGAAGAACAAAGAGAGAAAAAGG - Intronic
1095663077 12:44760812-44760834 TGATGAATAAAAAGAGGACAGGG + Intronic
1096638219 12:52974686-52974708 GAGAGAACAGAGAGAGAACAGGG - Intergenic
1098116646 12:67185285-67185307 AGATGAGGAGAGAGAAAACAGGG - Intergenic
1098289204 12:68940421-68940443 GGATGAATAGGTGGAGCACAGGG - Intronic
1098627160 12:72686014-72686036 GTTTGAATACAGAGAGAACAGGG + Intergenic
1098800784 12:74955112-74955134 GGATGAATGGATAAAGAAAATGG - Intergenic
1098917186 12:76269675-76269697 GGAAGAATAGAGTGAGAGTAAGG + Intergenic
1099226994 12:79981656-79981678 TGATGAACAGAGAGAGAAAGAGG + Intergenic
1099586933 12:84530666-84530688 GGATGAATAGAGAGATAGGTAGG + Intergenic
1099739899 12:86620851-86620873 GGAGGAAGAGAGAGAGAAAGGGG - Intronic
1099940419 12:89181233-89181255 GGAGGAATAGCCAGAGCACAGGG + Intergenic
1100435431 12:94566748-94566770 GGATGAATAGATGGAGCACAGGG + Intergenic
1100777764 12:97991174-97991196 TTATGAATAGAGAGAGAGCTGGG - Intergenic
1100891432 12:99130582-99130604 GGATGAGTAGAGAGGGAAGAAGG - Intronic
1100905074 12:99287963-99287985 GGAGGTAAAGAGAGAGATCAGGG + Intronic
1101143150 12:101816809-101816831 GGATGAATGGATAAAGAAAATGG + Intronic
1101187544 12:102294878-102294900 GGACAAATAGAGAGACACCAGGG + Intergenic
1101432752 12:104640609-104640631 GGATGAACAGGAAGAGCACAAGG + Intronic
1101664608 12:106800350-106800372 GGAGGAAGAGAGAGAGAAGGGGG + Intronic
1101983881 12:109430566-109430588 GGCTGAACAGAGGAAGAACATGG + Intronic
1102186980 12:110956838-110956860 TGTTGGAGAGAGAGAGAACACGG - Intergenic
1102703298 12:114859096-114859118 GTATCAATAAAGAGAGAACAGGG + Intergenic
1104289018 12:127451458-127451480 GGAGGAAGAGAGAGAGAAGGGGG + Intergenic
1104482183 12:129117285-129117307 GAATGAATAGATGGAGAAGAGGG + Intronic
1105766421 13:23564537-23564559 GGATGAATAGGTGGAGCACAGGG + Intergenic
1106193000 13:27470471-27470493 GGATGAATAGGCAGAGCTCAGGG + Intergenic
1106676437 13:31964029-31964051 GGATGAAAAGAGACTCAACAAGG + Intergenic
1106794421 13:33189782-33189804 GGATGAACACAGGGAGGACACGG - Intronic
1107255205 13:38417795-38417817 GGATGAATAGGAAGAACACAGGG + Intergenic
1107291447 13:38858991-38859013 GGAGGAAAAAAGAGAGAATAAGG + Intronic
1107337927 13:39375383-39375405 GAAAGCATAGAGAGTGAACAGGG + Intronic
1107379362 13:39839533-39839555 TGATGAATAGAGGGTGAAGAAGG + Intergenic
1107914337 13:45133924-45133946 GGAGGACCAGAGAGAGACCATGG - Intronic
1108097234 13:46915903-46915925 GGATGAATAGACAGAGCACAGGG - Intergenic
1108101302 13:46959175-46959197 GACTGACTAGAGAGAAAACAAGG - Intergenic
1108482314 13:50886447-50886469 GGATGAATAGGTGGAGCACAGGG + Intergenic
1108512478 13:51168859-51168881 GGAGGAAGAGAGAGAGAGCAGGG - Intergenic
1108877316 13:55062006-55062028 GGATGAATAGATAAAGAAACTGG + Intergenic
1109315701 13:60746622-60746644 GAATGAATAGAGAAATAAGAGGG + Intergenic
1109867387 13:68282989-68283011 GGATGAATAGATGGAGCACAGGG + Intergenic
1110098438 13:71562402-71562424 GGAAGAGGAGAGAGAAAACAAGG + Intronic
1110121074 13:71882543-71882565 GGATGCTTAGAGAGACACCAGGG - Intergenic
1110350565 13:74502425-74502447 GGAAGAACAGGGAGAGAACTGGG + Intergenic
1110371923 13:74750219-74750241 AGATGAATAGACAGTGATCAGGG + Intergenic
1110542061 13:76717887-76717909 GGAGCAAGAAAGAGAGAACATGG + Intergenic
1110867998 13:80419918-80419940 GGGAGAAGAGAGAGAGAAGAAGG - Intergenic
1111024063 13:82495227-82495249 AGATGATTAGAGAGAGAAAAAGG + Intergenic
1111299525 13:86329539-86329561 GGAGTAATAGAAAGAGAAGACGG - Intergenic
1111306099 13:86414778-86414800 GGCAGAAAAGAGAGAGAGCAAGG - Intergenic
1111314982 13:86543766-86543788 GAATGAATAGGCAGAGCACAGGG + Intergenic
1111731621 13:92084151-92084173 GGATAAATAGCTAGTGAACAGGG + Intronic
1112610807 13:100952942-100952964 GGATGAATAGAGAGGGCAGCAGG - Intergenic
1113400191 13:109985403-109985425 ATATGAATAGAGAGAGGAAATGG + Intergenic
1113929619 13:113959762-113959784 GGATAAAAAGAGAGATAACTTGG - Intergenic
1114367971 14:22050599-22050621 GGAGGAAGAGAGAGAGGACGGGG + Intergenic
1114916629 14:27275366-27275388 TCATGAATAGAGACAGAACATGG + Intergenic
1114985658 14:28225697-28225719 GGATGGATAGAAAGTGAAGAGGG + Intergenic
1115042331 14:28946828-28946850 AGATGAATAGATAAAGAAAATGG - Intergenic
1116133175 14:40886583-40886605 GGAGCAAGAGAGAGAGAGCAAGG - Intergenic
1116946847 14:50843640-50843662 GGAAGGGGAGAGAGAGAACAAGG - Intergenic
1117085697 14:52197889-52197911 GGATGAATAGGCAGAGCACAGGG + Intergenic
1117500389 14:56345440-56345462 GGAAGAAGTGAGAGAGAAAACGG + Intergenic
1117902113 14:60545161-60545183 GGATGAATAGATGGAGCACAGGG - Intergenic
1118093971 14:62515883-62515905 GGATGACTCCAAAGAGAACATGG + Intergenic
1118096486 14:62543184-62543206 GCATAAATAGAGAGTGAGCAAGG + Intergenic
1118107446 14:62676120-62676142 GTGTGAACGGAGAGAGAACAAGG - Intergenic
1118177002 14:63450448-63450470 GGAGGAAAAGAGGGAGAAAACGG + Intronic
1118685307 14:68284962-68284984 GAAGGAAGAGAGTGAGAACAGGG - Intronic
1119118019 14:72045138-72045160 GGATAAATAGATAGACAAGAGGG - Intronic
1119662725 14:76463144-76463166 GGATGGGAAGAGAGGGAACAAGG - Intronic
1120398026 14:83993061-83993083 TGTGGAATAGAGAGAGAGCAAGG + Intergenic
1120682076 14:87491960-87491982 GGAGGAAGAGTGAGAGAATAAGG + Intergenic
1120703425 14:87723545-87723567 GGAAGAATAGAGAGAGGATAAGG + Intergenic
1120831795 14:89003944-89003966 GTATGGTTAGAGAGAGTACAAGG - Intergenic
1121433056 14:93900792-93900814 GGAGGAAGTGAAAGAGAACAAGG - Intergenic
1121630575 14:95418930-95418952 GGAGGAAGAGAGGGAGAAGAGGG - Intronic
1121784546 14:96647157-96647179 GGCTGAATAGAGGAAGAAAATGG - Intergenic
1122419101 14:101564181-101564203 GGATGAAGAGAGAGAGACCAGGG + Intergenic
1124411596 15:29441995-29442017 GGAGGGATGGAGAGAGAACTGGG - Intronic
1124551722 15:30687248-30687270 GGATGAATAGAGAAATAAGTGGG + Intronic
1124679528 15:31718417-31718439 GGATGAATAGAGAAATAAATGGG - Intronic
1125036595 15:35132084-35132106 GGATGAACAGACAAAGAAAATGG + Intergenic
1125442289 15:39715855-39715877 AGAGGAAGAGAGAGAGAAGAGGG - Intronic
1125732090 15:41898494-41898516 GGGTGAACTGAGAGAGAAGAGGG - Exonic
1125802358 15:42461079-42461101 GGCTACATAGAGAAAGAACAGGG - Intronic
1126194446 15:45916809-45916831 GGATGAACAGAGGGAGAACAAGG - Intergenic
1126215256 15:46146718-46146740 GGATAAGTGGAGGGAGAACAAGG - Intergenic
1126380965 15:48046498-48046520 GAATAAATTGAGAAAGAACAGGG + Intergenic
1126723455 15:51606854-51606876 GGATAAAAAGATAGAAAACATGG + Intronic
1126733394 15:51707669-51707691 GGATGAAGAGTCAGAAAACATGG - Intronic
1126897139 15:53271029-53271051 AGAGGAAGAGAAAGAGAACAGGG - Intergenic
1126948196 15:53848883-53848905 CAATGAATAGAGAGAGAAGCTGG - Intergenic
1127755743 15:62090298-62090320 GGAAGAAGAAAGAGAGAGCAGGG - Intergenic
1127870190 15:63065989-63066011 GGATGCTAAGAGAGAGAACCAGG - Intronic
1129672971 15:77617271-77617293 GGGTGGATGGAGAGAGAAGAGGG - Intronic
1130731130 15:86493240-86493262 GGAGGTAAAGAGAGACAACACGG + Intronic
1131136335 15:89939150-89939172 GGATGAATAGTTAAAGAAAATGG + Intergenic
1131186924 15:90282361-90282383 GGATCAAATGAGAGAGAATATGG - Intronic
1131644726 15:94329517-94329539 GGAGCAAGAGAGAGAGAGCAGGG + Intronic
1131993124 15:98109569-98109591 GGAAGAAGTGAGAGAGAAGATGG - Intergenic
1132087607 15:98921146-98921168 GGACGAATGGTGAGAAAACAGGG - Intronic
1132349453 15:101130301-101130323 GAATGAATGGATAAAGAACATGG + Intergenic
1132378284 15:101347414-101347436 GGATGAATAAAGGGAAAACATGG + Intronic
1132407980 15:101556143-101556165 GGAGGAAGAGAGAAGGAACAAGG + Intergenic
1133375005 16:5277875-5277897 GGATGAATGGATAAAGAAAATGG - Intergenic
1133667071 16:7978988-7979010 GGATGAATAGATGGAGCATAGGG + Intergenic
1134092252 16:11397850-11397872 GGATGGAGAGAGAGGGTACATGG + Intronic
1135433645 16:22409237-22409259 GGATGAATAGGTAGAGCACAGGG - Intronic
1135739637 16:24962951-24962973 GTATGCATAGAGAGAGAAGGAGG + Intronic
1136073649 16:27804016-27804038 GGATGAATAGATAGATTAGATGG + Intronic
1137274927 16:46927143-46927165 GGGTGACTCGAGAGAGGACAGGG - Intronic
1138250243 16:55496697-55496719 GGAGGTAGAGGGAGAGAACAGGG + Intronic
1138815044 16:60194251-60194273 GGATGATTAGAGAAAGAGCTGGG - Intergenic
1138984476 16:62311292-62311314 GGATGGATAGAGAGAGAGAGAGG - Intergenic
1139141678 16:64270969-64270991 GGGAGAATAGAGAGAAAAAAAGG + Intergenic
1139432662 16:66919394-66919416 GTATTAATAGAGATAGCACATGG - Intergenic
1139497036 16:67327147-67327169 CGAGGAATTGAGAGAGAAGAGGG + Intronic
1140490080 16:75328056-75328078 GGAAGAATGGAAAGAGAACTGGG + Intronic
1140677989 16:77352659-77352681 GGAGGAATAGGGAGAGAAAGAGG + Intronic
1141209813 16:81967379-81967401 AGATGAATGGACAAAGAACATGG - Intergenic
1141329332 16:83094377-83094399 GGTTGGATAGAGAGAGAAGTTGG + Intronic
1141825303 16:86474826-86474848 GGATGAATAGGAAGAGCACAGGG + Intergenic
1142874423 17:2842903-2842925 GGAGGAAGAGAGAGAAAAGAAGG - Intronic
1143701109 17:8660868-8660890 GGAGGAAAAGAGAGAGAGGAAGG - Intergenic
1143738822 17:8936397-8936419 GGATGAATAGATGGAGTATAGGG - Intronic
1144184818 17:12787131-12787153 GGTTGAACAAAGAGAAAACATGG - Intergenic
1144746241 17:17616811-17616833 GGATGAACAGGCAGAGCACAGGG - Intergenic
1145287214 17:21514752-21514774 GGATGAACAGGCAGAGCACAGGG + Intergenic
1145390411 17:22451599-22451621 GGATGAACAGGCAGAGCACAGGG - Intergenic
1145912740 17:28552131-28552153 GGAGGCACAGAGAGAGATCAAGG + Intronic
1146663182 17:34678753-34678775 GGATGAATAGAGTGAATACTGGG - Intergenic
1147319091 17:39635473-39635495 GGAAGCATGGAGAGAGAACTGGG - Intronic
1147510411 17:41064250-41064272 GGATGAATAAAAAGTGAAGAGGG - Intergenic
1147601893 17:41751824-41751846 GGATGAAATGAGAAAGCACAGGG - Intergenic
1147973882 17:44236644-44236666 GGAGGAAAAGAGTAAGAACACGG + Intergenic
1149197989 17:54146461-54146483 GGAGAAAGAGAGAGAGAAGAAGG - Intergenic
1149307432 17:55362737-55362759 GGAAGAATATAGAAAGAAAAGGG + Intergenic
1149510698 17:57238856-57238878 GGATGAAGATACAGAGAAAAGGG + Intergenic
1149711834 17:58750456-58750478 GAATGAATAGGTAGAGCACAGGG - Intergenic
1149840717 17:59962273-59962295 GGATTAAAAGAGTTAGAACACGG - Intronic
1150464985 17:65385246-65385268 GGAAGAAGAGAGAAAGAAAAGGG - Intergenic
1150867605 17:68870220-68870242 AGATGAACAGTGAGAGAAAAGGG - Intronic
1151006444 17:70443241-70443263 GGATGAATAGGCAGAGAACAGGG + Intergenic
1151622105 17:75252460-75252482 GGATGAGGAGAGAGGGAAGAAGG - Intronic
1152331599 17:79676616-79676638 GGATGGAGAGAGAGAGGAGAGGG + Intergenic
1152352661 17:79792034-79792056 GGATGAGTACTGAGAGAAGAGGG + Intergenic
1153544166 18:6188832-6188854 GGATCACTAGAGGGAGTACAGGG + Intronic
1153795663 18:8619696-8619718 TGATGAGCAGAGAGAGGACAGGG - Intronic
1154961123 18:21309699-21309721 AGATGAATTGAGAGAGAAAATGG - Intronic
1155123987 18:22853067-22853089 GAATGAATGGAGAAAGAACATGG - Intronic
1155310105 18:24514998-24515020 GAAGGAAGAGAGAGAGAACAAGG + Intergenic
1155922791 18:31619945-31619967 GGTTGGAGAGAGAGAGAGCAGGG + Intergenic
1156146467 18:34187167-34187189 GGATGAATAGGCAGAGCACAAGG - Intronic
1157608783 18:48942950-48942972 GGATGAAGGCAGAGAGGACATGG - Intronic
1157953821 18:52072043-52072065 AGATGAATAGACAAAGAAAATGG - Intergenic
1157997398 18:52575208-52575230 GAATGGATACAGAGAGAAGATGG - Intronic
1159291979 18:66434887-66434909 GCATGAAAAAAGGGAGAACACGG - Intergenic
1159296198 18:66492414-66492436 GGTTGAATAGATAAAGCACAGGG + Intergenic
1159836706 18:73345742-73345764 AAATGAATAGATAGAAAACAGGG + Intergenic
1160083152 18:75749958-75749980 GAAGAAAAAGAGAGAGAACAGGG - Intergenic
1160285626 18:77540214-77540236 GGATGCAGAGACACAGAACAAGG - Intergenic
1160676893 19:395759-395781 GGATGAATAGAGAAGGACGATGG + Intergenic
1161228557 19:3160336-3160358 AGATGGAGACAGAGAGAACAGGG - Intronic
1161267407 19:3370715-3370737 GGAGGAACAGAGAGAGAGGAAGG - Intronic
1161477779 19:4495972-4495994 GGAGTGACAGAGAGAGAACACGG - Intronic
1163246427 19:16097833-16097855 GGATGAATAGAGAGAGTAATGGG - Intronic
1164784394 19:30918627-30918649 GGAAGAATGGAGGGAGACCACGG - Intergenic
1164937071 19:32223342-32223364 GGAAGAAAAAAGAGAGAAAAAGG + Intergenic
1165259504 19:34599742-34599764 GGGGGAAGAGGGAGAGAACAGGG - Intronic
1165459871 19:35937909-35937931 AGATGATCAGAGAGAGAAAAAGG - Intronic
1165467016 19:35980803-35980825 GGATTGATTGAGGGAGAACAGGG - Intergenic
1165604501 19:37089568-37089590 GACTGAATACAGAGAGATCAGGG + Intronic
1165707666 19:37987994-37988016 GGGAGAATAGAGAGAGAATTTGG - Intronic
1166258345 19:41621105-41621127 GGGTGGAGAGAGAGAGGACAAGG - Intronic
1166499947 19:43332951-43332973 GGGTGAACATAGGGAGAACATGG - Intergenic
1166900364 19:46056900-46056922 GGGTGTATAGGGAGAGAAGAGGG - Intronic
1168089745 19:54074745-54074767 GGAGGAACAGAGGGAGAAAAGGG - Intronic
1202697389 1_KI270712v1_random:134986-135008 GGAAGAAAAGGGAGAGAAAAGGG - Intergenic
925252631 2:2453068-2453090 GAATGGATTGAGAGAGAACAAGG + Intergenic
925507695 2:4586723-4586745 GGATAAAGAGAGAGAGAGAAAGG - Intergenic
925871509 2:8275723-8275745 AGATGAAAAGACAGACAACATGG - Intergenic
925921015 2:8637894-8637916 GGGGGAAGAGAGAGAGAGCAGGG + Intergenic
926023189 2:9515144-9515166 GGATGAATAGGTGGAGAGCAGGG - Intronic
926331218 2:11827606-11827628 GGATGAAGAAAGAGAGGAGAAGG + Intergenic
926473693 2:13294289-13294311 GGAGAAATACAGAGAAAACAGGG - Intergenic
926543653 2:14211453-14211475 GTATGAAAAGAGAGCAAACAAGG + Intergenic
926798458 2:16638233-16638255 GGATGAAGATTCAGAGAACAAGG + Intronic
927625826 2:24717505-24717527 GGATGAATAAGGAGAACACAGGG + Intronic
927836536 2:26403412-26403434 GGATGAATAAGCAGAGCACAGGG - Intronic
928069720 2:28202403-28202425 GGAGGAAGAGAGAGAAGACAGGG - Intronic
928365885 2:30702225-30702247 AGGTGAAGAGGGAGAGAACAGGG - Intergenic
929119620 2:38473693-38473715 GGATGAAAAGAGGGAGAGCGTGG + Intergenic
929264250 2:39900437-39900459 GGCAGAACAGAGAGAGAGCAGGG - Intergenic
929446908 2:42009115-42009137 GGATGAATCAAGAGAGGAGAGGG + Intergenic
929741218 2:44602684-44602706 AGCTGGAGAGAGAGAGAACAAGG + Intronic
929767923 2:44865479-44865501 GGATGAATAGACATAGCATAGGG + Intergenic
930142087 2:47962599-47962621 TGATGAATACAGAGAGTAGAAGG + Intergenic
930269216 2:49236179-49236201 GGATAAATTGTGAGAGAATAGGG - Intergenic
930455001 2:51596699-51596721 GGCTGAAGAGAAAGAGAAGAAGG - Intergenic
930671191 2:54152530-54152552 GGATGAATAAGCAGAGCACATGG - Intronic
930925500 2:56813532-56813554 GGATGAATAGGCAGAGCACAGGG + Intergenic
931362325 2:61588260-61588282 GGTTGAATAGGCAGAGCACAGGG - Intergenic
931705359 2:64942414-64942436 GGATGCATAGAGATTGACCAGGG - Intergenic
931884609 2:66603499-66603521 GGATGAAAAGGAAGAGAAGAAGG - Intergenic
931891307 2:66675549-66675571 GGAAGAAGAGAGAGAACACAAGG - Intergenic
931923661 2:67047669-67047691 GGATGTAGGGAGAGAAAACAGGG + Intergenic
932528803 2:72503328-72503350 GGATGAATAGGCAGAGCACAGGG - Intronic
932595477 2:73090752-73090774 CGATGAATAGGCAGAGCACAGGG + Intronic
933171141 2:79127481-79127503 AGATGAGAAGAGAAAGAACAAGG + Intergenic
933236487 2:79870434-79870456 GGAGAAAGGGAGAGAGAACAGGG + Intronic
933292071 2:80448882-80448904 GGAGGAAAAGATAGAGAAAAAGG - Intronic
933444182 2:82356068-82356090 GGATGAATAGATGAAGCACAGGG - Intergenic
933786701 2:85848684-85848706 GGTTGAAGAGAGGGAGAAAAGGG + Intronic
934278557 2:91592011-91592033 GGAAGAAAAGGGAGAGAAAAGGG - Intergenic
934926167 2:98383166-98383188 GGGGGAAGAGAGAGTGAACATGG - Intronic
936536501 2:113315741-113315763 GAATGGATAGAGGGAGAAGATGG + Intergenic
937163563 2:119790739-119790761 AGATGAATAGAGAAACAAAAGGG - Intronic
937770172 2:125711349-125711371 GGATGTATGGATAAAGAACAAGG + Intergenic
938753494 2:134358160-134358182 TGATGGATAGAGAGAGGACTGGG - Intronic
939098071 2:137858986-137859008 GGATGATTAGATAAAGAAAATGG - Intergenic
939255314 2:139736700-139736722 GGATGAATAGGTAGAGCATAGGG - Intergenic
939371242 2:141303644-141303666 GGATGAATGGATAAAGAAAATGG - Intronic
939414331 2:141873992-141874014 GTATGCATAGAGAGACAAAAAGG + Intronic
939834498 2:147112110-147112132 GGAGCAAGAGAGAGAGAGCAGGG - Intergenic
939929674 2:148217364-148217386 AGATGCAGAGAGAGAGCACAAGG - Intronic
940382058 2:153026367-153026389 GGATAAATAGATAGAGCAAAGGG - Intergenic
940628256 2:156204210-156204232 GGGTGTATTGAGAGAGAAGAGGG - Intergenic
940892329 2:159047083-159047105 GGATGAATTCAGAGAGACCTGGG - Intronic
941553669 2:166948067-166948089 GGATGAATAGAAGTAGCACAGGG + Intronic
942212865 2:173688997-173689019 GGGAGAAAAGAGAGGGAACATGG + Intergenic
942908194 2:181208433-181208455 GGAGGAGTAGAGAGAGTATAGGG - Intergenic
943068866 2:183118023-183118045 GGAGGAACAGAAAGAGTACAAGG - Intronic
943474284 2:188335311-188335333 TGATGAATCAAGAGAGAAAAGGG - Intronic
943710529 2:191089916-191089938 TGATGAATAGGTGGAGAACAGGG + Intronic
943794095 2:191970141-191970163 GGTTAAATAGAGGGACAACACGG - Intronic
943917403 2:193653836-193653858 GGATGAGTAGATGGAGAAGAGGG - Intergenic
944145666 2:196504516-196504538 GGATAGATAGAGAGAGAGGAAGG - Intronic
944941386 2:204632176-204632198 GGAGCAAGAGAGAGTGAACAGGG - Intronic
945020580 2:205567184-205567206 GTATGTATAGAGAGAGAAAGAGG + Intronic
945284444 2:208068568-208068590 GGAAGAAAGGAGAGAGAAAATGG - Intergenic
946390002 2:219409407-219409429 GGAAAAAAAGAGAGAGAAGAGGG + Intergenic
946569768 2:221010736-221010758 GGAGGAAGAGAGAGAGGAGAGGG - Intergenic
946834237 2:223756410-223756432 GGAAGGAGAGAGAGAGAAGAAGG + Intronic
946881609 2:224182397-224182419 GGAAGAGTACAGAGAGAAAAGGG + Intergenic
947330037 2:229019002-229019024 GGATGAATGGATAAAGAAAAGGG - Intronic
947680751 2:232030282-232030304 GGATCACTAGAGAGAGAGCAAGG - Intronic
947747337 2:232515376-232515398 GCATGAATATAGAGAGGGCAGGG - Intergenic
948012273 2:234658740-234658762 GGAGAAAGAGAGAGAGAAGAGGG + Intergenic
948526785 2:238575635-238575657 TGAAGAATAGAAAGAGAATAAGG - Intergenic
1168743982 20:220331-220353 GGATGTAGAGGGAGAGAAAAGGG + Intergenic
1169748852 20:8970875-8970897 GGATGATTATAGAGAGAACTGGG + Intergenic
1170117806 20:12879454-12879476 AGATGATAAGAGAGAGAAGATGG + Intergenic
1170345033 20:15376313-15376335 GGTTGGATACAGAGAGAACTTGG + Intronic
1170414248 20:16123274-16123296 GGAGGAATAGAGAAAGAGAAAGG + Intergenic
1171088397 20:22261149-22261171 GGAGAAATAAAGACAGAACAAGG + Intergenic
1171261793 20:23740458-23740480 AGAGGAAGAGAGAGAGAAAAAGG + Intergenic
1171801809 20:29627669-29627691 GGAGGAATAGGGAGAGTATATGG - Intergenic
1171819022 20:29816389-29816411 GGATGAATGGATAGAGAAGCAGG - Intergenic
1172903290 20:38350416-38350438 GGATGTATTGAGAGAGAGGAGGG + Intronic
1172927951 20:38557489-38557511 GGATGAATAGGTGGAGTACAGGG - Intronic
1172928623 20:38564756-38564778 GGAGCCATAGAGAGAGACCAGGG + Intronic
1173484852 20:43433483-43433505 GGAAGGATAGAGAGAGAAGAAGG + Intergenic
1174008894 20:47433024-47433046 GGAAGAAGAGAAAGAGAAGAGGG + Intergenic
1174041660 20:47704827-47704849 GGATGAAGAGAGAAAGGCCAGGG + Intronic
1174766724 20:53261321-53261343 GCATTAAAAGAAAGAGAACAAGG - Intronic
1174945093 20:54976313-54976335 GGGTGGTTAGAGAGAGAAAAAGG + Intergenic
1176379035 21:6102498-6102520 GGACGACAAGGGAGAGAACACGG - Intergenic
1177183184 21:17765667-17765689 GCATGAGTAGAGAGAGAAGGAGG + Intergenic
1177324314 21:19563955-19563977 TGATGAATGGATAAAGAACATGG + Intergenic
1177397000 21:20549325-20549347 GGAGGAAGAGAGAGAGAAGAGGG - Intergenic
1178493374 21:33068266-33068288 GGAAGGAGAGAGAGAGACCAAGG - Intergenic
1178568755 21:33714289-33714311 GGAGGGAAAGAGAGAGAACGTGG + Intronic
1178578666 21:33817468-33817490 GCAGGAATAAAGAGAAAACAGGG - Intronic
1178601266 21:33996794-33996816 GGATGAACAAAGAGAGAGAATGG + Intergenic
1179130769 21:38635148-38635170 GGATGAATAGGGAGAGCCCGGGG + Intronic
1179417060 21:41207595-41207617 GGAGGCAGAGAGAGAGAACAAGG - Intronic
1179744439 21:43435739-43435761 GGACGACAAGGGAGAGAACACGG + Intergenic
1180204940 21:46253990-46254012 GGAGGAAGAGAGAGAGAAGGGGG - Intronic
1180322998 22:11341087-11341109 GGATGAATGGATAGAGAAGCAGG - Intergenic
1183102623 22:35593254-35593276 GGATGGAAAGAGAGAAAAGAAGG + Intergenic
1183801492 22:40168916-40168938 GTATAAATAGAGATATAACATGG - Intronic
1184295842 22:43524660-43524682 GGAGGAAAAGAAAGAGAACATGG - Intergenic
1184897812 22:47422134-47422156 GGCTTCAAAGAGAGAGAACAGGG + Intergenic
1184964640 22:47962252-47962274 GGATGAATAAATAGACAACTTGG + Intergenic
1185104232 22:48858178-48858200 GGATGGACAGAGAGAGAGCATGG - Intergenic
1185293927 22:50043870-50043892 GGATGAAGAGACAGAGCACAGGG + Intronic
949114952 3:309402-309424 GGAAGAAAAGAGAGAAAGCAAGG - Intronic
949820641 3:8112211-8112233 AGATGAGTACAGAGAGAACACGG + Intergenic
949936355 3:9119207-9119229 GGAGGAAAAGAGAGGCAACAAGG - Intronic
950112309 3:10427152-10427174 GGATTGAAAGAGAGAGAAGATGG - Intronic
950187963 3:10957081-10957103 GGATGTGTAGACAGAAAACACGG + Intergenic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
950582138 3:13869565-13869587 GAATGAAGAGAGAGAGAGAAAGG + Intronic
951142275 3:19177657-19177679 GAAAGAAAGGAGAGAGAACAAGG + Intronic
951322561 3:21263864-21263886 AGAGGAATAGAGAGGGAAAATGG - Intergenic
951461846 3:22959629-22959651 GTAGGAATAAACAGAGAACAAGG + Intergenic
952089261 3:29864901-29864923 GGAGGAAGAGAGAGAGAGGAAGG + Intronic
952315842 3:32231631-32231653 GAAGGAATGGAGAGGGAACAGGG + Intergenic
952969160 3:38639994-38640016 GGCTGCATAGAGGGAGAACCAGG - Intronic
953095172 3:39767852-39767874 GGAGGAAGAGAGAGAGAAAAGGG + Intergenic
953361149 3:42297884-42297906 GGGAGAAAAGAGAGAGAAGAGGG + Intergenic
953519405 3:43627020-43627042 GGATGAACAGTGAAAGTACATGG - Intronic
953623643 3:44553190-44553212 GGATGAACTGAGAGGAAACAAGG + Intergenic
953857152 3:46508139-46508161 TGATAAACACAGAGAGAACATGG + Intergenic
954879778 3:53825628-53825650 GAAAGAAGAGACAGAGAACAAGG + Intronic
955459673 3:59167993-59168015 GGAAGAAAAGAAAGAGAAGAAGG + Intergenic
955583068 3:60445829-60445851 AGATGAGTAGAGGGATAACAGGG - Intronic
955690602 3:61586830-61586852 GAATAAACAGGGAGAGAACACGG - Intronic
955861734 3:63337871-63337893 GGATGAATAGGTGGAGCACAGGG + Intronic
956021124 3:64934266-64934288 AATTGAATAGAGAGAGAATAGGG + Intergenic
956144829 3:66182105-66182127 GGACAAAAAGAAAGAGAACAGGG + Intronic
956506858 3:69949904-69949926 GGATGAACAGACTGAGAATATGG + Intronic
957067106 3:75533663-75533685 GGATGAATGGATAAAGAAAATGG + Intergenic
957293285 3:78305506-78305528 GGAGGAAGAGAAAGAGAAGAGGG - Intergenic
957293543 3:78307529-78307551 GGAGGAAGAGAGAGAGAAGAGGG - Intergenic
957312968 3:78543415-78543437 GGAGGAAAAGAGAGACAAGACGG + Intergenic
957979885 3:87494785-87494807 GGAAGCATAGAGGGAGAAGAGGG + Intergenic
959175412 3:102903892-102903914 CGATGAGTGGAGAGACAACAGGG + Intergenic
959302970 3:104626028-104626050 TGATTAATAGGCAGAGAACAGGG + Intergenic
959745129 3:109767342-109767364 GGATGAATAGGTAAAGCACAGGG - Intergenic
960048683 3:113220798-113220820 GGAGGAATTGAGAGAGGAAAAGG + Intronic
960121642 3:113953175-113953197 GTATGAATAGAGAGGGAGTAAGG - Intronic
960338694 3:116448366-116448388 GGAAGAAAAGAGAGATAAAAGGG + Intronic
960377351 3:116919639-116919661 GGATGAGTTAAGAGACAACAGGG - Intronic
960495928 3:118374863-118374885 GGGTGGAGAGAGAGAAAACAGGG + Intergenic
960690619 3:120342381-120342403 GGAAGAAGACAGAGAGAAGATGG + Intronic
961286045 3:125804326-125804348 GGATGAATGGATAAAGAAAATGG - Intergenic
961900704 3:130208543-130208565 GGATGAATGGATAAAGAAAATGG + Intergenic
961904547 3:130249067-130249089 GGATGGGAACAGAGAGAACATGG - Intergenic
962052970 3:131837701-131837723 AGATGAAGAGAGAAAGTACATGG + Intronic
962202981 3:133415492-133415514 GGGTGAATAGGGAGAGGGCAGGG - Intronic
962699927 3:137988000-137988022 GGATGAATAGGTGGAGCACAGGG - Intergenic
963206006 3:142635616-142635638 GTTTGAATAGAGATATAACATGG + Intronic
963433549 3:145240590-145240612 GGAAGAAGAGAGAGAGAGGATGG + Intergenic
963494100 3:146038309-146038331 GATTGAATATAGAGAGAAGATGG - Intergenic
964002951 3:151798102-151798124 GGATGAATAAAGTTAGAACATGG - Intergenic
964018772 3:151981245-151981267 GGATGAAAAGAAAGAGTTCATGG - Intergenic
964072257 3:152648675-152648697 GGAGGAATAGAAAAAGCACAAGG + Intergenic
964085944 3:152818393-152818415 GGATGAATAGGCAGAGTGCAGGG - Intergenic
964421257 3:156505839-156505861 GGAGTAAGAGAGAGAGAAAAGGG + Intronic
964558622 3:157968298-157968320 GCAGGAATAGAGAGAGATCTGGG + Intergenic
965033836 3:163408591-163408613 GGAGGAAGAGAGAGTGAAGAGGG - Intergenic
965330624 3:167370300-167370322 GACTGATTAGAGAGGGAACAAGG + Intronic
965624011 3:170668946-170668968 GGATGCAAAGAGAAAAAACAGGG + Intronic
965639156 3:170814553-170814575 GACTGAATAGAGAGAGGCCACGG - Intronic
965799864 3:172480655-172480677 GGATGAATGGATAAAGAAAATGG - Intergenic
966382070 3:179354473-179354495 GAATGAATTGAATGAGAACAGGG + Intronic
966902435 3:184496438-184496460 GGATGAGTAGATAGACAACAGGG - Intronic
966965417 3:184987059-184987081 GGATGAATAGGTGGAGCACAGGG - Intronic
967109894 3:186283996-186284018 GGAAGAATGGAAAGAGAAGAAGG - Intronic
967727622 3:192876646-192876668 GCAAGAATTGAGAGGGAACAGGG - Intronic
967751299 3:193119225-193119247 GAATGAATAGATGGTGAACAGGG - Intergenic
968591403 4:1461465-1461487 GGATGAACAGAGGGTGAACAAGG + Intergenic
968757274 4:2423334-2423356 GGCTGAATTCAGAGAGAGCAGGG + Intronic
968957457 4:3726532-3726554 GGATGGAGAGAGAGAGAAGGAGG + Intergenic
969011698 4:4070258-4070280 GGATGAATGGATAAAGAAAATGG + Intergenic
969256395 4:6004932-6004954 GGATGAAATGAGAAAGTACAGGG - Intergenic
969345924 4:6569976-6569998 GGAAGAAAAGAGAGAGAGGAAGG + Intergenic
969495998 4:7526521-7526543 GGATGAATCGGCGGAGAACAGGG + Intronic
969742382 4:9039470-9039492 GGATGAATGGATAAAGAAAATGG - Intergenic
969801765 4:9572339-9572361 GGATGAATGGATAAAGAAAATGG - Intergenic
970566204 4:17334722-17334744 GGAGGAAGAGAGAGAGAATGGGG - Intergenic
970757897 4:19449214-19449236 GGATGAATAGTTGGAGAAAAGGG - Intergenic
971041347 4:22755820-22755842 GGATGAATGGATAAAGAAAATGG - Intergenic
971149231 4:24013437-24013459 CGATGAATACAAAGAGAAGAAGG - Intergenic
971550641 4:27951702-27951724 AGAGCAATAGAGAGAGAGCAGGG + Intergenic
971912883 4:32818518-32818540 GGAGCAAGAGAGAGAGAAGAGGG + Intergenic
971987299 4:33842983-33843005 GGATAAAAAGAGTAAGAACATGG - Intergenic
972061708 4:34882665-34882687 GGAGGAAGAGAGAGAGAGCGTGG + Intergenic
972221888 4:36965436-36965458 GGATGAATAGGCAGAGCAGAGGG - Intergenic
972445485 4:39139398-39139420 GGATGAGCAGACAGAGCACAGGG + Intergenic
972863112 4:43196191-43196213 TGATGGATAGAGAAAAAACAGGG + Intergenic
972982125 4:44717714-44717736 GGATGAATAGAGGAGGAACATGG - Intronic
973331808 4:48916965-48916987 GGACAAATAGGGAGAGCACAGGG - Intergenic
974256994 4:59470613-59470635 AGCTGCACAGAGAGAGAACAAGG - Intergenic
976280597 4:83323180-83323202 GGATGAATAGGTGGAGAACAGGG + Intronic
977216775 4:94293949-94293971 GGATGAATTGAGAAACAAAATGG + Intergenic
977364753 4:96054054-96054076 GGATGAACAGAGGGAGTATAGGG - Intergenic
977685630 4:99844163-99844185 GGATGAAAAGAAAGAAAAGAGGG + Intronic
977804183 4:101277034-101277056 GGATGAATAGGTGGAGCACAGGG - Intronic
978056328 4:104272513-104272535 GGAGGAAGAGAGAGAGAAGGGGG + Intergenic
978276992 4:106963790-106963812 GGATGAATTGATAAAGAAAATGG + Intronic
978360693 4:107928663-107928685 GCATGAACAGAGAGAGTGCATGG - Intergenic
979515086 4:121598447-121598469 GGATGAATAGGCAGAGCACAGGG + Intergenic
979524924 4:121706615-121706637 GGTTGGATAGTGAGAAAACATGG - Intergenic
979825471 4:125227955-125227977 GGATGAAAAAGGAGAGAATATGG - Intergenic
979917851 4:126460092-126460114 GGATGAATAGAAAGAAAATGTGG - Intergenic
980227080 4:130000210-130000232 GGATGTAGAGACAGAGATCAGGG + Intergenic
980232724 4:130065051-130065073 GGAAGGAGAGAGAAAGAACAAGG - Intergenic
980552977 4:134364548-134364570 GGAGGAAGAGAGAGAGAATAGGG + Intergenic
980711412 4:136573297-136573319 GGAGGAAGAGAGAGAGAGAAGGG - Intergenic
981362402 4:143862865-143862887 GGTTGGGTAGAGAGAGAAGATGG + Intergenic
981373132 4:143983633-143983655 GGTTGGGTAGAGAGAGAAGATGG + Intergenic
981382227 4:144086908-144086930 GGTTGGGTAGAGAGAGAAGATGG + Intergenic
981556097 4:145996426-145996448 AGATGAATGGAGAAAGAAAATGG - Intergenic
981978463 4:150761230-150761252 AGATGAAAAGAGAGATAAAAGGG - Intronic
982799290 4:159683538-159683560 GGATGAATAGGTGGAGCACAGGG + Intergenic
983553897 4:169042962-169042984 GGATAAATAGAAGGAGCACAAGG - Intergenic
983770243 4:171539995-171540017 GGATGAATAGATAGATGAGAAGG - Intergenic
983862655 4:172726838-172726860 GGACTATTAGAGAGAGAATAGGG - Intronic
984022323 4:174500746-174500768 GGATGAACAGGTGGAGAACAGGG + Intronic
984293709 4:177827764-177827786 GAATGAAAAGAGAGAGGACTAGG + Intronic
984470281 4:180161607-180161629 GGAGGGAGAGAGAGAGAAGATGG + Intergenic
984754158 4:183310061-183310083 GGAGGAATAGGCAGAGCACAGGG + Intronic
984857523 4:184207748-184207770 GAATGAATACACAGAGAATAGGG - Intronic
984931603 4:184852656-184852678 GTAAGTATAGAGAGAGAACTCGG - Intergenic
985063094 4:186097349-186097371 AGATAAAAAGAGAGAGAAGAGGG - Intergenic
985270798 4:188192953-188192975 AGATGAATAGAGAAAGAAAGGGG + Intergenic
985471836 5:51423-51445 GGAAGAAAAGAAAAAGAACAAGG - Intergenic
986124864 5:4875530-4875552 GGAGGAAGAGAGACAGAGCAAGG + Intergenic
986389264 5:7268598-7268620 GGATGAATTGAGAAACTACATGG - Intergenic
986459680 5:7957585-7957607 GGAGAAAGAGAGAGAGAAAAAGG + Intergenic
986802879 5:11279807-11279829 GGAGCAAGAGAGAGAGAGCATGG + Intronic
986928308 5:12786313-12786335 GGATGCATAGATAAAGCACAGGG - Intergenic
987024058 5:13906112-13906134 GGATGAATAGGTGGAGCACAGGG + Intronic
987298933 5:16579593-16579615 GGATGAATAGATGGAGGACAGGG - Intronic
987550585 5:19375181-19375203 GGATGAACAGTGAGAACACATGG + Intergenic
987970570 5:24938890-24938912 CTAGGGATAGAGAGAGAACAGGG - Intergenic
988300712 5:29422417-29422439 AGATGAAGGTAGAGAGAACATGG + Intergenic
988342489 5:29991486-29991508 GGGTGAAGAGAGAGAGAGGAAGG - Intergenic
988373002 5:30396510-30396532 GGATGAATAGGCAGAGCACAGGG - Intergenic
990621361 5:57563089-57563111 GGATGAGGACAAAGAGAACATGG - Intergenic
990864805 5:60368771-60368793 GGAAGAAGAGAGAGAGAAGGGGG - Intronic
992522358 5:77567815-77567837 GGATGAATAAAGGAAGAAGAAGG - Intronic
992839507 5:80673903-80673925 GGAAGAATGGAGAGATAAGAAGG + Intronic
993049018 5:82903836-82903858 GGATAAATAGGCAGAGCACAGGG - Intergenic
993233783 5:85276022-85276044 GGACAGATCGAGAGAGAACAGGG - Intergenic
993472097 5:88318612-88318634 GGAGGAATAGAAGGAGAAGAAGG + Intergenic
994030509 5:95136449-95136471 GGATGAAGAGGGAGAGGAGAAGG + Intronic
994289788 5:98015086-98015108 GGATAAATAGGTGGAGAACAGGG - Intergenic
994499092 5:100551559-100551581 GGATAAAGAGAGAGAGGAAAGGG - Intronic
994567809 5:101474684-101474706 GGAGGAAGAGAGAGAGAAAGTGG + Intergenic
994579859 5:101627940-101627962 GGAGGAAGAGAGAGAGAAGGGGG + Intergenic
994588672 5:101745733-101745755 GGATGAAGAGAGGGAGGAGAAGG - Intergenic
994751696 5:103745995-103746017 GTATGGATACAGAGACAACATGG - Intergenic
994901188 5:105771654-105771676 GGAAGAAAAGAGAGAGAAAAAGG + Intergenic
995410632 5:111853247-111853269 GGATGAATAGGTGGAGCACAGGG + Intronic
995638040 5:114218593-114218615 AGATGAATAGTTAGAGCACAGGG + Intergenic
995672714 5:114625176-114625198 GAATGAAAAGGGAGAGAAAAAGG - Intergenic
995800727 5:115991180-115991202 GGATAAATAGATGGAGAACAGGG - Intronic
995964262 5:117885166-117885188 GGATGAACAGGCAGAGAACAGGG - Intergenic
996213367 5:120838389-120838411 TGATGAATAGAGAGAAATCAAGG + Intergenic
996213530 5:120840412-120840434 TGATGGATAGAGAGAAATCAAGG + Intergenic
997139067 5:131359803-131359825 GGAGGAATAGTGAGAGAAAAAGG + Intronic
997333537 5:133085745-133085767 GGATGAATAGTTGGAGCACAGGG + Intronic
997333542 5:133085770-133085792 GGATGAATAGTTGGAGCACAGGG + Intronic
997400921 5:133601582-133601604 GGATGAACAGAGTGTGAGCAAGG + Intronic
997905316 5:137810847-137810869 GAATGAATAAAGAGAGAATAAGG - Intergenic
998949789 5:147381783-147381805 GGAGGAGAAGAGAGAGAAAAAGG - Intronic
999964754 5:156797293-156797315 GGAAGAAAAGAGAGACAGCAAGG + Intergenic
1000539178 5:162518999-162519021 GGAGAGATAGAGAGAGATCAGGG - Intergenic
1000670039 5:164050045-164050067 GGAGAAAGAGAGAGAGAAGATGG - Intergenic
1001163632 5:169343700-169343722 GGCTGAAGAGAGAGAGAAATTGG + Intergenic
1001265348 5:170270189-170270211 GAATGAATGGAGAGAGAAGTGGG + Intronic
1002196175 5:177502823-177502845 AGATGAAACGAGAGAGAACAGGG + Intronic
1003667015 6:8120885-8120907 GGAGGAAGAGAGAGAGAAGGGGG + Intergenic
1005192556 6:23242590-23242612 GGATTAATAGAGAATGAAAATGG + Intergenic
1005224157 6:23621911-23621933 GAAAGAAAAGAGAGAGAAAATGG + Intergenic
1005410762 6:25543466-25543488 GGATCAAAAGAGGGAAAACAGGG - Intronic
1005777251 6:29148295-29148317 TGATGAATGGAAGGAGAACAGGG - Intergenic
1005950030 6:30625123-30625145 GGATGGAAAGACAAAGAACAAGG - Intronic
1005970852 6:30760479-30760501 GGAGGACTGGAGAGAAAACATGG - Intergenic
1006325501 6:33350736-33350758 GGATGAATTGAGAGACTAAACGG - Intergenic
1007117347 6:39352412-39352434 GGATGAATAGATGGAGCACAGGG - Intronic
1007881328 6:45170935-45170957 TGAGGAATATAGAAAGAACATGG + Intronic
1008745476 6:54664875-54664897 GGCTGAATAAGGGGAGAACATGG - Intergenic
1008823003 6:55656526-55656548 GGATGAAAAGAGAGATATCAAGG - Intergenic
1008929693 6:56925692-56925714 GGATAAATATAAAGAGAACTTGG - Intronic
1009026885 6:58010726-58010748 GAATGAAAAGAGAAAGAATAAGG + Intergenic
1009202427 6:60762198-60762220 GAATGAAAAGAGAAAGAATAAGG + Intergenic
1009764372 6:68050533-68050555 GGATGAATAGATGCAGAACAGGG - Intergenic
1009897327 6:69769101-69769123 GAATGAAAAGAGAAAGAAGAGGG - Intronic
1010331647 6:74630052-74630074 GGATGGAGAGAGAGAGAGAAAGG - Intergenic
1010913606 6:81588770-81588792 GGATGAATAGGTAGAATACAGGG + Intronic
1011080775 6:83488409-83488431 AGATGAGTAGATAGAGCACAAGG - Intergenic
1011264467 6:85500526-85500548 GGAGCAAGAGAGAGAGAGCAGGG - Intergenic
1011268908 6:85555576-85555598 GGATGAACAGAGAAAGCACAGGG + Intronic
1011656716 6:89558578-89558600 GGATGAATAGGCAGAGCACAGGG + Intronic
1012305054 6:97644993-97645015 GGGTGAAGAAAGAGAGCACAAGG - Intergenic
1012682489 6:102200043-102200065 GAAAGAATAGAAAGAGAAAATGG - Intergenic
1012984454 6:105859904-105859926 GGAAGAGAAGAGAGAGAACGAGG + Intergenic
1013177006 6:107686492-107686514 GGAGGAAAAGAGAGAAAAGAAGG - Intergenic
1014415717 6:121181389-121181411 GGAGGAAGAGAGAGAGAAGTGGG - Intronic
1014853105 6:126365457-126365479 GGAAGAAGAGAGAGAGAAGGGGG + Intergenic
1015104798 6:129523292-129523314 GGAGCAAGAGAGAGAGAAGACGG + Intergenic
1015819821 6:137248887-137248909 TTATGAACAGAAAGAGAACAGGG + Intergenic
1016027099 6:139298916-139298938 GGAGGAAGAAGGAGAGAACATGG - Intergenic
1016142599 6:140630851-140630873 GGATGCATAAAAAGAGAAGAAGG - Intergenic
1016145263 6:140664003-140664025 GGAGGAAGAGAGAGAGAAGGGGG - Intergenic
1016435072 6:144027948-144027970 TTTTGAAAAGAGAGAGAACAAGG + Intronic
1017037119 6:150276666-150276688 GGAGGAAAAGAGGGAGAAAAAGG - Intergenic
1017092092 6:150768921-150768943 GGATGGAGAGAGAGAGAATATGG - Intronic
1017218411 6:151936987-151937009 GGAGGCATAGAAAAAGAACAAGG + Intronic
1017413161 6:154191250-154191272 GGATGAATAGATGGAGCACAGGG + Intronic
1017586937 6:155936871-155936893 GGAAAAATAGAGAGAGAAGGAGG + Intergenic
1017953501 6:159158792-159158814 GGAGGAAGAGAGAGAGAAGAAGG + Intergenic
1018902393 6:168058145-168058167 GGCTGGATGGAGAGAGAACAGGG - Intronic
1018902402 6:168058180-168058202 GGCTGGATGGAGAGAGAACAGGG - Intronic
1018902420 6:168058251-168058273 GGCTGGATGGAGAGAGAACAGGG - Intronic
1018902449 6:168058396-168058418 GGCTGGATGGAGAGAGAAGAGGG - Intronic
1019127046 6:169847527-169847549 GGAGGAAGAGAGAGAGAGAAGGG - Intergenic
1019963950 7:4483924-4483946 GGAGGGAAAGAGAGAGAAGAGGG + Intergenic
1020046423 7:5044381-5044403 GGAGGAAAAGAGAGAGAGGAAGG - Intronic
1021165940 7:17340766-17340788 GGAGGAATAGCTAGAGAACATGG - Intronic
1021346462 7:19535017-19535039 GAATGAATACATAGAGAACTGGG + Intergenic
1021360957 7:19711184-19711206 GCATGATTTGAGAGCGAACAAGG + Intergenic
1021513987 7:21462779-21462801 AGAGAAATAGAAAGAGAACAGGG + Intronic
1022033146 7:26510401-26510423 GGAGGAATAAAGAGAGAAGGGGG - Intergenic
1022770594 7:33468134-33468156 AGATGAAAAGAGAGAGATCGGGG + Intronic
1022790019 7:33678852-33678874 GGATGACTAGGGAGAGAATATGG - Intergenic
1022828567 7:34041730-34041752 GGAAGAAAAGAGAGAGAAGTTGG - Intronic
1022890549 7:34693074-34693096 GAATCAAGAGAGAGAGAGCAGGG - Intronic
1023057507 7:36301923-36301945 GGGTGAATAGATGGAGAACAAGG - Intergenic
1023337263 7:39183440-39183462 GGAGGAAGAGAGAGAGAAGGGGG + Intronic
1023578259 7:41653214-41653236 GGTTGAGTAGAGAGAGGACAAGG - Intergenic
1024859882 7:53826174-53826196 GGAGGAAGAGAGAGAGAAAGAGG + Intergenic
1024876658 7:54032618-54032640 GGATGAATAGATGGAGCACCAGG - Intergenic
1024878723 7:54059483-54059505 GGATGAATAGATGGAGCACAAGG + Intergenic
1025107269 7:56182209-56182231 GGAGGAAAGGAAAGAGAACAAGG - Intergenic
1025888284 7:65620411-65620433 GTATAAACAGAGACAGAACAAGG + Intergenic
1026310977 7:69184004-69184026 GGAGGAAAGGAAAGAGAACAAGG + Intergenic
1026576949 7:71580032-71580054 GGATGGATAGATAGAGATGATGG + Intronic
1026857245 7:73762835-73762857 GGAGGAAAAGAGAGAGAAAGAGG - Intergenic
1027424668 7:78050577-78050599 GTATGATTAGAGAGAAAGCAGGG + Intronic
1027543171 7:79493607-79493629 GGATGGAGAGAGAGAGAAGGGGG - Intergenic
1028268260 7:88755656-88755678 GGATGAACAGATGGAGCACAGGG + Intergenic
1028271593 7:88797530-88797552 GGATTAAACCAGAGAGAACATGG + Intronic
1028720525 7:94025813-94025835 GGAAGAGTTGAGAGAGAAAATGG + Intergenic
1028788984 7:94831946-94831968 GGATGAAGCTAGAGAGAACTAGG - Intergenic
1029070991 7:97897868-97897890 GGATGAATGGATAAAGAAAATGG + Intergenic
1029508010 7:100974277-100974299 AGGAGAAGAGAGAGAGAACAGGG - Intronic
1029704462 7:102268788-102268810 GGAGGAAGAGAGAGAGAATGGGG + Intronic
1030495997 7:110301422-110301444 GGATCAGTAGAAAGAGAAGAAGG - Intergenic
1030594149 7:111516374-111516396 GGAGGAAGAGAGAGAGAAGAGGG + Intronic
1031765019 7:125767150-125767172 GAATGAAAAGAAACAGAACAAGG - Intergenic
1031925721 7:127636454-127636476 GGAGGAAAAGAGAAAGAAGAAGG + Intergenic
1032548264 7:132761612-132761634 GGCTGGAAACAGAGAGAACATGG + Intergenic
1032757288 7:134903172-134903194 GGATGAATAGGCAGAGCACAGGG + Intronic
1032815292 7:135467800-135467822 GAAAGAACAGAGAGAAAACAAGG + Intronic
1032894897 7:136239425-136239447 CAATGAAGAGAGATAGAACAAGG - Intergenic
1032905091 7:136355532-136355554 GGAGGAACAGAGGAAGAACATGG - Intergenic
1032998877 7:137480893-137480915 GGTAGAATAAAGAGAGAACTAGG - Intronic
1033469279 7:141629790-141629812 AGATGAAGAAAGAGAAAACAGGG + Intronic
1033849593 7:145479410-145479432 GCATAAATACAGAGTGAACAGGG - Intergenic
1035165007 7:156981816-156981838 GGAAGAGCAGAGAGAGTACAGGG - Intergenic
1035405561 7:158594893-158594915 GGAGGAAGAGAGAGAGAAGCAGG - Intergenic
1035487554 7:159237907-159237929 AGAAGAAGAGAGAGTGAACAGGG + Intergenic
1036141226 8:6210642-6210664 AGATGAATGGAGAAAGAAAATGG - Intergenic
1036179836 8:6574827-6574849 AGAAGAAGGGAGAGAGAACAGGG + Intronic
1036247587 8:7132080-7132102 GGATGAATGGATAAAGAAAATGG - Intergenic
1036253229 8:7182347-7182369 GGATGAATGGATAAAGAAAATGG + Intergenic
1036364266 8:8105131-8105153 GGATGAATGGATAAAGAAAATGG - Intergenic
1036886676 8:12561926-12561948 GGATGAATGGATAAAGAAAATGG + Intergenic
1037272077 8:17141373-17141395 GGACGAAGAGGGAGAGAAAAGGG - Intergenic
1037480888 8:19304076-19304098 GGATGAAGAGAGAGAGAGTGGGG + Intergenic
1037590758 8:20310287-20310309 GGAAGACTAGAGAGAGCAAAGGG - Intergenic
1037596282 8:20357100-20357122 GGAGGAAGAGAGAGAGAAGGGGG + Intergenic
1037735147 8:21559910-21559932 GGATGAATTGAGAGAGAATGAGG + Intergenic
1038146893 8:24905469-24905491 GGTTGACAAGACAGAGAACATGG - Intergenic
1038183943 8:25255533-25255555 GGATGAAGAGGTAGAGCACAGGG + Intronic
1038698421 8:29827108-29827130 GGAAGAAACGAGAGAGAACCTGG + Intergenic
1039381494 8:37089827-37089849 AGAGGAAAAGAGAGAGAAAAAGG - Intergenic
1039438737 8:37579872-37579894 GGATGGAGAGAGAGAGAAAAGGG - Intergenic
1040362183 8:46676661-46676683 GGGAGAAAAGAGACAGAACAAGG - Intergenic
1041162964 8:55063501-55063523 GGAAGAAGACAGAGAGACCAAGG + Intergenic
1041486674 8:58385118-58385140 GGATTAATAGGGGGAGCACAGGG - Intergenic
1041844575 8:62313042-62313064 AGGTGAATAGTGAGACAACATGG + Intronic
1041935758 8:63330128-63330150 GGATGAATAGAGAAAGGGGAAGG - Intergenic
1042000033 8:64111777-64111799 GGGACAATAGAGAGAGAAAAGGG + Intergenic
1042162406 8:65910218-65910240 GAATGATTGGAGAGAGAAAAGGG + Intergenic
1042847866 8:73186308-73186330 GGAAGAAAAGAAAGAGAAGAAGG - Intergenic
1042851235 8:73217983-73218005 GGCAGGAGAGAGAGAGAACAAGG - Intergenic
1043180531 8:77082552-77082574 GGACAACTAGAGAGTGAACAAGG + Intergenic
1043234662 8:77847886-77847908 GGATGAATAGGCAGAGCACAGGG - Intergenic
1043373528 8:79621368-79621390 GAATGAGTAAAGAGGGAACAAGG + Intronic
1043756779 8:84013231-84013253 AGATGAATAGGGAGAAAGCAGGG + Intergenic
1043826137 8:84930794-84930816 GGAGGGAGAGAGAGAGAATAGGG + Intergenic
1043868018 8:85397840-85397862 GGATGAATTGGCAGAGCACAGGG + Intronic
1044120634 8:88390340-88390362 GGATGAATGGATAAAGAAAATGG + Intergenic
1045519416 8:102890562-102890584 GGATGAATAGGCAGAACACAGGG + Intronic
1045949982 8:107840643-107840665 GGAGGAAGAGAGAGAAAAGAGGG - Intergenic
1046034989 8:108829864-108829886 GTATGAGTGGAAAGAGAACATGG + Intergenic
1046057607 8:109097398-109097420 GGATGAACAAAGACAGAAAAGGG - Intronic
1046207489 8:111020528-111020550 GGAAAAATAGAGAGGGAGCAAGG - Intergenic
1046346930 8:112942080-112942102 GGATGAAGAGAGGGTGCACAGGG - Intronic
1046373600 8:113346141-113346163 AGATCAATAGAGATAGACCATGG + Intronic
1046669624 8:117043400-117043422 GCGTGAATAGAGAGACACCAGGG + Intronic
1047449090 8:124946848-124946870 GAAGGAAAAGAGAGAGAAAAAGG + Intergenic
1047597149 8:126390219-126390241 TGATGAATAAAGAAAGAAGAAGG + Intergenic
1047691592 8:127360381-127360403 GGAGGAAGAGAGAGAGAAGGGGG + Intergenic
1048069058 8:131002860-131002882 GAATGAAAAGAAAAAGAACAGGG + Intronic
1048339661 8:133528949-133528971 GGATGAATAAACAGAAAAAATGG + Intronic
1050314857 9:4390998-4391020 GGATGAGTAGACAGAGAAATAGG - Intergenic
1051434157 9:17013187-17013209 GGAGGTATAGAGAGAGAGCAAGG + Intergenic
1051816491 9:21113106-21113128 GGAGGAAAAGAGAGAGAAAAGGG + Intergenic
1052483702 9:29067024-29067046 GGGAGAATAGAGAAAGAATAAGG + Intergenic
1052636553 9:31113675-31113697 GGATAAATAGAGAAAGCATAGGG - Intergenic
1052779793 9:32769582-32769604 GAATCAAAAGAGAGACAACATGG + Intergenic
1052855944 9:33406684-33406706 AGATGATTCGAGAGAGACCAGGG - Intergenic
1053020952 9:34693658-34693680 GGAGGAGAATAGAGAGAACAGGG + Intergenic
1053023554 9:34712387-34712409 GGAGGAGAAGAGAGGGAACAGGG - Intergenic
1053098886 9:35352606-35352628 GGATCAACAGAGAGAGCACCAGG + Intronic
1053389180 9:37721268-37721290 GGATGAATAGACAGGTCACAGGG - Intronic
1055296235 9:74836634-74836656 GGATGAATAGGGGAATAACATGG - Intronic
1055472888 9:76631310-76631332 ACATCAATAAAGAGAGAACATGG - Intronic
1055527873 9:77153535-77153557 GGAGGAATAGAGAGAGCAAAGGG - Intergenic
1055603034 9:77939557-77939579 AGATGAATTGGGAGAGAAAAGGG - Intronic
1056004416 9:82252703-82252725 GGATGAATAGGTAGAGCATAGGG - Intergenic
1056086142 9:83151301-83151323 GAATGAATTGAAAGAGAGCAAGG + Intergenic
1056097144 9:83266872-83266894 GGATGAAAAGAGAGAGAGGAAGG - Intronic
1056545319 9:87608015-87608037 GGAGGAAGAGAGAGAGAAGGGGG + Intronic
1057366692 9:94428804-94428826 GGATGAATAGGCAGAGCACAGGG - Intronic
1057447750 9:95129809-95129831 GGATGACTAGGGAGCGAAGATGG + Intronic
1057656642 9:96959258-96959280 GGATGAATAGGCAGAGCACAGGG + Intronic
1058170005 9:101669277-101669299 GGTTCAATCCAGAGAGAACATGG + Intronic
1058763256 9:108157170-108157192 GGGTGAATAGATAGAGAAGGGGG + Intergenic
1058831413 9:108820584-108820606 GGAGGAAGAGAGAGAGAGCCAGG - Intergenic
1058930434 9:109713763-109713785 GGATGAATAGGCAGAGCACAGGG + Intronic
1059275587 9:113094086-113094108 TGATGAATAGGCAGAGCACAGGG + Intergenic
1059607393 9:115848848-115848870 GGATGGAAAGATAGAGAAGAAGG - Intergenic
1059650998 9:116315782-116315804 GAATGAAGAGACAGAGAAAAAGG + Intronic
1059755246 9:117287413-117287435 GGATGCATAGAGAAGGAAAATGG + Intronic
1060752594 9:126183169-126183191 GGATGAGGAGAGAGAGAAAGAGG + Intergenic
1061654057 9:132074733-132074755 GAAAGAAAAGAGGGAGAACAAGG - Intronic
1062050607 9:134444645-134444667 GGAGGAAAAGAAAGAGAAGAGGG - Intergenic
1062248064 9:135579886-135579908 GGATGAATAGATAGTGAATGGGG - Intergenic
1062706123 9:137944377-137944399 GGAGGAAGAGAAAGAGAATAAGG - Intronic
1203370682 Un_KI270442v1:301657-301679 GGATGAATGGATAGAGAAGCAGG - Intergenic
1186028172 X:5337142-5337164 GGAGGAAGAGAGAGAAAAGAAGG + Intergenic
1186221513 X:7354269-7354291 GGATTTATAGACAGGGAACAGGG - Exonic
1186277857 X:7959386-7959408 GGAGGAAGAGAGAAAGAAGAAGG - Intergenic
1186523993 X:10230980-10231002 GGATAAATAGGCAGAGCACAGGG - Intronic
1186653718 X:11590047-11590069 GGGTGAAGAGAGGGAGAATAAGG + Intronic
1186762424 X:12736725-12736747 GGATGAACTGAGGCAGAACATGG + Intergenic
1187148514 X:16659937-16659959 AGATGAATAGATAAAGAAAATGG - Intronic
1187164280 X:16790305-16790327 GGATGAATAGGTAGAGCACAAGG - Intronic
1187312443 X:18158203-18158225 GGAGGAAGAGGGAGAGAAGAGGG - Intergenic
1187643641 X:21322102-21322124 GAATGAATAGGTAGAGCACATGG - Intergenic
1187755601 X:22522328-22522350 AGATGAGTTGAAAGAGAACAAGG + Intergenic
1187790759 X:22947606-22947628 GGATGAATCAAAAGAGAAAAGGG + Intergenic
1188305042 X:28551295-28551317 GAATGAATAGGGAGAGCAGAAGG + Intergenic
1188466264 X:30485174-30485196 TGAAGAATAGAAAGAGAAGAAGG - Intergenic
1188530591 X:31136262-31136284 GGAGGAAGAGAGAGAGAAAGAGG - Intronic
1188767230 X:34109204-34109226 GGAGCAAGAAAGAGAGAACATGG - Intergenic
1190172488 X:48122540-48122562 GGATAGATAAAGAGTGAACATGG + Intergenic
1190190035 X:48269278-48269300 GGATAGATAAAGAGTGAACATGG + Intronic
1190197261 X:48329975-48329997 GGATAGATAAAGAGTGAACATGG + Intergenic
1190199005 X:48344439-48344461 GGATAGATAAAGAGTGAACACGG - Intergenic
1190575062 X:51827393-51827415 GGATGAATAGACGGAGCACATGG + Intronic
1190659537 X:52642073-52642095 GGATAGATAAAGAGTGAACATGG - Intergenic
1190665765 X:52694907-52694929 GGATAGATAAAGAGTGAACATGG - Intronic
1190673653 X:52763503-52763525 GGATAGATAAAGAGTGAACATGG + Intronic
1190677192 X:52792271-52792293 GGATAGATAAAGAGTGAACATGG + Intergenic
1191157287 X:57287360-57287382 GGAAGAATAGAGAGAGAGAAAGG - Intronic
1191957554 X:66661637-66661659 GGAAGGAAAGAGAGAGAGCAAGG - Intergenic
1192429373 X:71102049-71102071 GGAAGAAGAAACAGAGAACAAGG - Intronic
1192508615 X:71707987-71708009 GGAGCAAGAGAGAGAGAACAGGG + Intergenic
1192518082 X:71773566-71773588 GGAGCAAGAGAGAGAGAACAGGG - Intergenic
1192606010 X:72518712-72518734 GGATGAATAGCTAAAGCACAGGG - Intronic
1192866563 X:75139400-75139422 AGATGATTAGAGAAAGAAGAAGG - Intronic
1192894521 X:75427301-75427323 GAGGGAATAGAAAGAGAACAAGG + Intronic
1193277972 X:79612737-79612759 GGAGGAAAAGAGAGAGAGGAGGG - Intergenic
1193292885 X:79797283-79797305 GGATGATCAGAGAGAGACCTTGG - Intergenic
1193820142 X:86150915-86150937 GGGGGAAGAGAGAAAGAACAGGG - Intronic
1193837173 X:86358050-86358072 GGATGAAGAAAGATAAAACAGGG - Intronic
1193920605 X:87421065-87421087 GCATGAATAGATAGCCAACATGG + Intergenic
1193943238 X:87702715-87702737 GGAGGAAGAGAGAGAGAAAAAGG + Intergenic
1193947470 X:87755803-87755825 GGAAAAAGAGAGAGAGAAAAGGG + Intergenic
1194004581 X:88474766-88474788 GGATCAAGAGAGAGAGACAATGG + Intergenic
1194075098 X:89381379-89381401 CCATGAATAGAGAGAGAAAATGG - Intergenic
1194076873 X:89405936-89405958 GGATGAATAGATGGAACACAGGG - Intergenic
1194398376 X:93413694-93413716 GGAGGTAGAGAGAGAGATCAGGG + Intergenic
1194488106 X:94511687-94511709 GGATGACTAGGGAGAGGACAGGG + Intergenic
1194793640 X:98182594-98182616 GGAGGAAAAAAGAGAGAACCAGG + Intergenic
1194848471 X:98841396-98841418 CGATGAATAGGTAAAGAACATGG - Intergenic
1194875314 X:99179930-99179952 GGAAGAAAAGAGAGGAAACAAGG - Intergenic
1195146516 X:102022930-102022952 AGGAGAAGAGAGAGAGAACAGGG + Intergenic
1195334795 X:103841845-103841867 GAATCTATCGAGAGAGAACATGG + Intergenic
1195858429 X:109355639-109355661 GGATGAGAAGAGGAAGAACAAGG + Intergenic
1196671671 X:118374797-118374819 GGATGAAGTGAGTGAGTACATGG - Intronic
1196716767 X:118819646-118819668 GGATGAATGGATAAAGAAAATGG - Intergenic
1196978787 X:121188709-121188731 GGAGGAGGAGAGAGAGAAAATGG + Intergenic
1197854094 X:130896511-130896533 GTATAAAAAGAGAAAGAACAAGG - Intronic
1199115901 X:143991776-143991798 TGATGAATAGAGACAGATAATGG + Intergenic
1199373900 X:147084372-147084394 GGAGGAAGAGAGAGTGAAGAAGG - Intergenic
1199498818 X:148486470-148486492 GAATGAATAGGCAGAAAACAGGG + Intergenic
1200012716 X:153131802-153131824 GGATGAAGACAGAGAGATGATGG + Intergenic
1200026884 X:153268115-153268137 GGATGAAGACAGAGAGATGATGG - Intergenic
1200712094 Y:6494847-6494869 GGAAGAATGGAGAGTGAACTGGG + Intergenic
1200730698 Y:6735560-6735582 CCATGAATAGAGAGAGAAAATGG - Intergenic
1201021837 Y:9667122-9667144 GGAAGAATGGAGAGTGAACTGGG - Intergenic
1201067635 Y:10113411-10113433 GGATGAATAGATAGAGAAGCAGG + Intergenic
1201474382 Y:14364699-14364721 GGAAGAAAAGAAGGAGAACAAGG + Intergenic
1201643803 Y:16205411-16205433 GGAAGAAAAAAGAGAGAAAAAGG - Intergenic
1201659012 Y:16379910-16379932 GGAAGAAAAAAGAGAGAAAAAGG + Intergenic
1201695996 Y:16827006-16827028 AGAGGAAGAGAGAGAGAAAAAGG - Intergenic