ID: 924584549

View in Genome Browser
Species Human (GRCh38)
Location 1:245350586-245350608
Sequence ACCTGGGCTTTGATGGTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 189}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924584549_924584555 19 Left 924584549 1:245350586-245350608 CCTGGGACCATCAAAGCCCAGGT 0: 1
1: 0
2: 1
3: 10
4: 189
Right 924584555 1:245350628-245350650 TTTTCTAGCCAGCCATGCCCTGG 0: 1
1: 0
2: 1
3: 16
4: 137
924584549_924584557 21 Left 924584549 1:245350586-245350608 CCTGGGACCATCAAAGCCCAGGT 0: 1
1: 0
2: 1
3: 10
4: 189
Right 924584557 1:245350630-245350652 TTCTAGCCAGCCATGCCCTGGGG 0: 1
1: 0
2: 1
3: 16
4: 188
924584549_924584558 22 Left 924584549 1:245350586-245350608 CCTGGGACCATCAAAGCCCAGGT 0: 1
1: 0
2: 1
3: 10
4: 189
Right 924584558 1:245350631-245350653 TCTAGCCAGCCATGCCCTGGGGG 0: 1
1: 0
2: 2
3: 16
4: 170
924584549_924584556 20 Left 924584549 1:245350586-245350608 CCTGGGACCATCAAAGCCCAGGT 0: 1
1: 0
2: 1
3: 10
4: 189
Right 924584556 1:245350629-245350651 TTTCTAGCCAGCCATGCCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924584549 Original CRISPR ACCTGGGCTTTGATGGTCCC AGG (reversed) Intronic
900013083 1:132694-132716 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
900043149 1:488681-488703 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
900064586 1:723678-723700 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
900413472 1:2524347-2524369 ACTTTGGCTTTGAGGGTTCCTGG + Intronic
900797910 1:4720481-4720503 ACCTTGGCTCAGATGGACCCAGG + Intronic
902226044 1:14996971-14996993 CCCTGTGCTTTGCTGATCCCTGG + Intronic
903207658 1:21795050-21795072 ACCTGGGCTTTGCTTGGCCCCGG + Intergenic
903911466 1:26729603-26729625 ACCTGAGCTTTGATGGCCTCTGG - Intronic
904914577 1:33960625-33960647 CCCTGGGCTTCCATGGTGCCTGG - Intronic
905670184 1:39786317-39786339 ACCTGGGCACTGTTGGCCCCAGG - Intronic
907526259 1:55055971-55055993 ACCTTGGCTTTGTTCCTCCCAGG + Exonic
909102526 1:71367346-71367368 AGCAGGGCTGTGATGGTCCATGG - Intergenic
911053917 1:93694963-93694985 ACCTGGGCCTTGTTATTCCCTGG + Intronic
914226125 1:145720975-145720997 TCCTCATCTTTGATGGTCCCCGG - Intronic
915037027 1:152936362-152936384 ACCTGGGCCTTGCTGGCCACTGG - Intergenic
919183355 1:194114333-194114355 ACCTGGGCATTGATAGCCTCTGG - Intergenic
919662463 1:200260681-200260703 ACCTGGGGAGTGATTGTCCCAGG - Intergenic
922099484 1:222469694-222469716 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
922230226 1:223679412-223679434 ACCAGAGCCTTGATGGTGCCAGG + Intergenic
922261522 1:223949190-223949212 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
922735556 1:227976554-227976576 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
923180375 1:231512307-231512329 ACATGGGCCTAGATGGTCACAGG + Intergenic
924342685 1:243051366-243051388 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
924584549 1:245350586-245350608 ACCTGGGCTTTGATGGTCCCAGG - Intronic
924776195 1:247115608-247115630 GCTTGGGCTGTGAGGGTCCCGGG + Intergenic
1063785075 10:9372976-9372998 ATCTGTGCTTTCATGGTCTCAGG + Intergenic
1068030105 10:51696170-51696192 ACCTGGGCCTTGATTATTCCTGG + Exonic
1069732045 10:70623153-70623175 CCCTGGGCTTTTATGGGCCTTGG - Intergenic
1069829316 10:71272760-71272782 ACGTGGGCTCAGATGGTGCCAGG + Intronic
1069956200 10:72053523-72053545 CTCTGGGATTTGATGATCCCAGG + Intergenic
1076332363 10:129679466-129679488 AGCTGTGCTTTGCGGGTCCCTGG - Intronic
1076969420 11:124898-124920 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
1077991301 11:7414627-7414649 AGCTAGGCTTTGCTGGTTCCTGG - Intronic
1078065141 11:8073755-8073777 AGCTGGGCTTAGATGCCCCCTGG + Intronic
1079128382 11:17734437-17734459 ACCAGGGATCAGATGGTCCCTGG + Intergenic
1080312537 11:30911724-30911746 GCCCGGGCTATGAAGGTCCCAGG - Intronic
1081402682 11:42661479-42661501 ACCTGGTCTTTCATGGTCCAGGG - Intergenic
1081463042 11:43289328-43289350 TCCTGGGCTTTTATGGGCACAGG - Intergenic
1084326478 11:68403322-68403344 ACCTGGTGTTTTATGGTACCTGG + Intronic
1084495653 11:69501642-69501664 ACCTGGGCTTGGCAGGTCACTGG - Intergenic
1086009687 11:82085656-82085678 CCCAGGCCTCTGATGGTCCCTGG + Intergenic
1086164795 11:83765067-83765089 ACCTGGGATTTGAGGGTACAGGG - Intronic
1202814012 11_KI270721v1_random:39063-39085 GCCTGGGCTCAGATGGACCCTGG - Intergenic
1096550879 12:52370849-52370871 ACCTGAGCTGGGATGCTCCCTGG + Intergenic
1096600543 12:52725487-52725509 ACCTGGCCCTTGATGGGCTCAGG - Intergenic
1096619792 12:52857086-52857108 ACCTGGGCTCCCATGGTGCCTGG - Intergenic
1097071969 12:56361726-56361748 TCCTGTGCTTTGCTGCTCCCTGG + Exonic
1099093628 12:78343705-78343727 ACCTGGGCTTAGATGCTGTCTGG + Intergenic
1102542476 12:113632293-113632315 ACCTGGCCTGTGATGGAGCCAGG - Intergenic
1102737792 12:115178742-115178764 AATTGGGCTTTCCTGGTCCCAGG + Intergenic
1102933971 12:116881668-116881690 TCCTGGGCTTTGGGGGTCTCGGG + Intergenic
1105679725 13:22713893-22713915 ACCAGGGCTTTGGTGGGCACAGG + Intergenic
1109080344 13:57891722-57891744 GCCTGGAGTTTGATGGCCCCAGG - Intergenic
1110309445 13:74031133-74031155 AGATGGGCTTTGATGGTCCAAGG - Intronic
1110638846 13:77798318-77798340 ACCTGGGCTTAGATGACCACAGG - Intergenic
1112072808 13:95873744-95873766 ACCTGGTCTGGGATAGTCCCTGG - Intronic
1113616103 13:111681622-111681644 ACCTGGGCTCCCACGGTCCCAGG - Intergenic
1113621571 13:111766515-111766537 ACCTGGGCTCCCACGGTCCCAGG - Intergenic
1113776853 13:112952826-112952848 ACCTAGCGTTTTATGGTCCCAGG + Intronic
1114495845 14:23131593-23131615 AGCTGGGGCTTGGTGGTCCCTGG - Intronic
1119646520 14:76352564-76352586 ACCTGGGATTTGAAGGCCCAGGG - Intronic
1121300054 14:92862913-92862935 ACCTGGGCTCTGACTGTCCTGGG + Intergenic
1122973661 14:105162463-105162485 CCCTGGGCTTTGAGGTGCCCTGG - Intronic
1125765707 15:42134141-42134163 CCCTGGGCTGTGATGGCTCCTGG - Intergenic
1125927675 15:43576601-43576623 CCCTAGGCCTAGATGGTCCCAGG + Intronic
1125940818 15:43676166-43676188 CCCTAGGCCTAGATGGTCCCAGG + Intergenic
1128793969 15:70451457-70451479 AGCGTGGCTTTGATGCTCCCTGG - Intergenic
1130149744 15:81302313-81302335 TCCTGGGGGATGATGGTCCCAGG - Intronic
1130206501 15:81880409-81880431 ATCTGGGCTTTGATGGACGTAGG + Intergenic
1130232405 15:82107102-82107124 ACCTGGCCATGGCTGGTCCCAGG + Intergenic
1135327963 16:21539435-21539457 ACCTTGACTTTGCTGGGCCCTGG + Intergenic
1136338315 16:29625459-29625481 ACCTTGACTTTGCTGGGCCCTGG + Intergenic
1139141467 16:64267878-64267900 TCTTGGTCTTTGATGGACCCTGG + Intergenic
1139271593 16:65688700-65688722 CCCTGGGCTTGGAGGGTTCCTGG + Intergenic
1140533489 16:75687753-75687775 ACCTCTACTTTGATAGTCCCTGG - Intronic
1142041046 16:87894369-87894391 ACCTTGACTTTGCTGGGCCCTGG + Intronic
1142266371 16:89065696-89065718 ACCTGGGCTTCCAGGTTCCCCGG + Intergenic
1142451252 16:90174224-90174246 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
1144347044 17:14358950-14358972 ACCTGGTGTTTGATGGTCCAGGG + Intergenic
1147243324 17:39105068-39105090 ACCTGGGCTTTGATGGGGCCTGG - Intronic
1149555235 17:57568905-57568927 ACCTGGGCCTGGCTGGTACCGGG + Intronic
1150334027 17:64317313-64317335 TCCTGGCCTCTGATGGTTCCTGG - Intergenic
1153446449 18:5178269-5178291 ACCTGGGCATGGATGGTGGCTGG + Intronic
1154502494 18:15003734-15003756 GGCTGGGCATTGGTGGTCCCCGG - Intergenic
1156492326 18:37503524-37503546 ACCTTGGCTTGGAGTGTCCCTGG - Intronic
1160347691 18:78147553-78147575 ACCTTGGCTCTGAAGGTCCTCGG + Intergenic
1160646225 19:194824-194846 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
1160921642 19:1523624-1523646 ACCTGGGGCTTGATGGCCCTGGG - Intergenic
1161840979 19:6680117-6680139 GCCTGGGGTCTGATGGTTCCAGG - Intronic
1163084791 19:14971575-14971597 ACCTGGGCTTTGTTTGGCCAAGG + Intronic
1164610667 19:29629380-29629402 ACCTGGCCTGTGATGGCTCCTGG - Intergenic
1166009932 19:39934718-39934740 ACCTCAGCCTTCATGGTCCCAGG - Intergenic
1166233243 19:41438161-41438183 ACCTGGGCTCTGGTGGGCCAGGG + Intronic
1168240171 19:55084928-55084950 ACCTGGGCTACCCTGGTCCCGGG + Intronic
927135212 2:20091976-20091998 ACCAGGGCTTTGCTAGACCCCGG - Intergenic
930107983 2:47654983-47655005 ACCTGGGGGCTGCTGGTCCCAGG + Intergenic
933462894 2:82612108-82612130 CCCTGGAGTTTGGTGGTCCCTGG - Intergenic
934721459 2:96579898-96579920 AACGGGGCTTTGAAGCTCCCAGG - Intergenic
940366366 2:152852641-152852663 TCCTGGACTTTCAGGGTCCCTGG + Intergenic
942931533 2:181500055-181500077 ACCATGGCTTTGATGGTAGCAGG + Intronic
944518734 2:200541301-200541323 TCCTCTGCTTTGATCGTCCCAGG + Intronic
1168940999 20:1711532-1711554 GCCTGGACTTTCAGGGTCCCTGG - Intergenic
1169489687 20:6060850-6060872 TCCTGGGCTTAAATGGTGCCTGG + Intergenic
1172188073 20:33043959-33043981 CCCTGGGCCTAGGTGGTCCCTGG + Intronic
1172701993 20:36859311-36859333 ACCGGGTCTTTGAAGGTCTCAGG + Intronic
1172838730 20:37889142-37889164 ACCTGTGCTTCCCTGGTCCCTGG - Intergenic
1173671105 20:44799463-44799485 GCCAGGGCTTGGATGGGCCCCGG + Intronic
1173976629 20:47191648-47191670 GACTGGGATTTCATGGTCCCAGG + Intergenic
1174769253 20:53283026-53283048 TTCAGGGCTTTGATGGTGCCTGG - Intronic
1176117279 20:63438585-63438607 ACAAGGGCTGTGCTGGTCCCCGG + Intronic
1176279281 20:64291392-64291414 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
1177424526 21:20905134-20905156 ACCTGGGCTCTGATGTTCGAGGG - Intergenic
1179255384 21:39711328-39711350 ACTTAGACTTTGATGGTCCAGGG + Intergenic
1179552545 21:42152679-42152701 TCCTGGGCTGTGATGCTGCCTGG + Intergenic
1181236309 22:21449730-21449752 AGCTGGGCTTGGAGGGGCCCTGG - Exonic
1181310817 22:21943825-21943847 CCCTGGGCTCTGTTGTTCCCCGG + Intronic
1181323812 22:22029595-22029617 ACCTGGCCTTTGATAGGCCCCGG - Intergenic
1181802203 22:25354951-25354973 ACCTGGCGTTTTATGGTACCTGG - Intronic
1182436749 22:30335728-30335750 ACCTGGACTTTGATGGACACTGG + Exonic
1182526682 22:30924810-30924832 ACCTGTCCCTTGATGTTCCCAGG + Intergenic
1184381119 22:44145461-44145483 ACCTGGGCTCTGCGGCTCCCAGG + Intronic
1184639450 22:45861553-45861575 AGCTGTGCTTTGATGATGCCTGG + Intergenic
1185035545 22:48474877-48474899 ACCTGGGATTTGTTGGTCATTGG - Intergenic
949417257 3:3828291-3828313 ACCTGGGGTCTGATGTTCCAGGG + Intronic
951099798 3:18673976-18673998 ACCTGGGATTTGCTGGTCCATGG - Intergenic
953260739 3:41336721-41336743 GCCTGGGATTGGATGGTACCTGG + Intronic
955620969 3:60863646-60863668 GCCTCCTCTTTGATGGTCCCTGG + Intronic
962380292 3:134893135-134893157 CCCTGGGTGCTGATGGTCCCAGG + Intronic
962652352 3:137509475-137509497 ACCTGGGCTTTCCTGGCGCCAGG + Intergenic
962957790 3:140282206-140282228 AGCTTGGCTTTGATGCTTCCTGG + Intronic
967109963 3:186284419-186284441 TCCTGAGATTTGATGATCCCAGG + Intronic
967306517 3:188064774-188064796 ACCTTTGCTTTGAAGGCCCCTGG + Intergenic
968371456 3:198224702-198224724 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
969629389 4:8327286-8327308 TCCTGGGCTCTGATTCTCCCAGG - Intergenic
979260142 4:118637175-118637197 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
979328233 4:119403453-119403475 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
982627045 4:157780534-157780556 ACCCTGGCTTTGATCTTCCCTGG - Intergenic
988456022 5:31388018-31388040 ACATGGGATTTGAAGGTCCAGGG - Intergenic
989635741 5:43530970-43530992 ACCAGACCTTTGAGGGTCCCAGG - Intronic
990499585 5:56382240-56382262 ACATAGGCTTTGATTGTCTCGGG + Intergenic
992027647 5:72686502-72686524 ACATGGGCTTTGAGGTGCCCCGG + Intergenic
993683562 5:90909717-90909739 ACTTGAGCTTTGAAGGTCACTGG - Intronic
994591958 5:101784481-101784503 ACCTGTGCCTTGGTGGTCCTGGG + Intergenic
995401104 5:111742672-111742694 TTCTGGGCTTTGATGGTACATGG + Intronic
995973552 5:118003326-118003348 ACCTGGGGTCTGAGGGTACCCGG - Intergenic
1000534868 5:162467960-162467982 ACCTGGGCTGGGATGGTTTCTGG + Intergenic
1000988476 5:167887068-167887090 ACCTGTGCTTAGATGGACACTGG - Intronic
1001270531 5:170308031-170308053 ACATGGGCGTACATGGTCCCGGG + Intergenic
1001305742 5:170571277-170571299 AGCTGGGCTGTGATGGTCAAAGG - Intronic
1001953191 5:175830377-175830399 ACCTGGGCTCTGCTGCTCCCTGG - Intronic
1002457890 5:179356131-179356153 ACCTTGGCCTTGCTGGACCCTGG + Intergenic
1002730694 5:181330248-181330270 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
1002753836 6:143856-143878 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
1003151538 6:3555791-3555813 TCCTGGGCTTTTCTGGTCCTGGG - Intergenic
1004140141 6:13010632-13010654 ACCTGGGATCTGCTGGTCCTTGG + Intronic
1006167287 6:32072349-32072371 CCCTGGGCTTTGAGGGCCTCAGG + Intronic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1007264307 6:40585674-40585696 CCCTGGGCTGTGAAGTTCCCAGG - Intronic
1012079249 6:94735491-94735513 CCCTGGGCTTTCAGGCTCCCCGG - Intergenic
1014899648 6:126947354-126947376 ACCTGGGCTTGGGTCTTCCCTGG + Intergenic
1017045684 6:150345255-150345277 ACCTGGGGGTTGATGGTGCAGGG - Intergenic
1018290108 6:162284118-162284140 TCTTGGGCTTTCATGGGCCCAGG + Intronic
1018458841 6:163978045-163978067 ACCTGGCCTCTGAAGGACCCGGG + Intergenic
1019594146 7:1850635-1850657 ACCATGGCTTTGGGGGTCCCCGG - Intronic
1021087979 7:16446375-16446397 ACCTGAGATTTAATGGCCCCTGG - Intergenic
1023401858 7:39796776-39796798 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
1024075838 7:45817418-45817440 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
1024370907 7:48582653-48582675 GCATGGGCTCTGAGGGTCCCCGG - Intronic
1024647760 7:51383886-51383908 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
1025051599 7:55738373-55738395 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
1025128562 7:56364040-56364062 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic
1026506997 7:70993380-70993402 GCCTAGCCTTTGGTGGTCCCAGG + Intergenic
1029403062 7:100357295-100357317 AGCTGGGCTGTGGTGGTGCCTGG + Intronic
1031979768 7:128116960-128116982 GAGTGGGCTTGGATGGTCCCAGG - Intergenic
1035246065 7:157562582-157562604 CCCCGGACTTTGAAGGTCCCCGG - Intronic
1038321800 8:26533993-26534015 CCATGGGCTTTGAAGGTCCAAGG + Intronic
1039178774 8:34839818-34839840 ACCTTGACTTGGATGGACCCTGG - Intergenic
1039953268 8:42188527-42188549 ACCCTGTCTTTCATGGTCCCCGG - Intronic
1040772549 8:50995227-50995249 ACATGGGATATTATGGTCCCTGG - Intergenic
1043417931 8:80070674-80070696 ACCTGGGCGTTGGGGATCCCTGG + Intronic
1045348462 8:101316234-101316256 AGCTGGGCTTTCATGCTCCTGGG - Intergenic
1049785551 8:144449025-144449047 TCCTGTGCTTTGCTGGTCACGGG - Intergenic
1050981153 9:12017779-12017801 ACTTGGGCTTTGAGAGTCACAGG - Intergenic
1058055739 9:100447067-100447089 CCCTTGGCTTTCCTGGTCCCAGG + Intronic
1059417294 9:114169717-114169739 CCCTGGGCTTTGGTTGGCCCAGG + Intronic
1060269316 9:122129629-122129651 GCTTGAGCTTTGATGCTCCCCGG - Intergenic
1062020864 9:134318826-134318848 TCCTGGACTTTGAGGGGCCCAGG - Intronic
1062270003 9:135704005-135704027 ACCTGGGCTTGGCTGGGCTCGGG + Intronic
1062453074 9:136623581-136623603 ATCTGGGCTGTGGTGGGCCCTGG - Intergenic
1062755103 9:138282758-138282780 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
1203579011 Un_KI270745v1:26927-26949 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
1185906418 X:3937888-3937910 GCCTGGGCTTTGAGGTTCCTTGG - Intergenic
1187029362 X:15469893-15469915 ACCTATGCTTTCATGGTCCAGGG - Intronic
1189544669 X:42029219-42029241 AGCTGGGCTTTGATACTCCTAGG - Intergenic
1189866477 X:45335200-45335222 ATCTGGGCTTTGAGGGTGACTGG + Intergenic
1190168150 X:48090141-48090163 ACCTGTTCCTTGATAGTCCCTGG - Intergenic
1192153489 X:68726313-68726335 CCCTGGGCTTTGCTGGTCACTGG - Intergenic
1199808552 X:151326828-151326850 TCCTGGGCTTCTACGGTCCCTGG - Intergenic
1201151107 Y:11096133-11096155 ACCTGGGCTCTGGTGTTCACTGG - Intergenic
1202381631 Y:24279545-24279567 TCCTGGGCTTTGAAGGCTCCTGG + Intergenic
1202489154 Y:25390581-25390603 TCCTGGGCTTTGAAGGCTCCTGG - Intergenic