ID: 924588597

View in Genome Browser
Species Human (GRCh38)
Location 1:245381662-245381684
Sequence CAGAGTATTCTGGAGGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 7, 3: 37, 4: 373}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924588597 Original CRISPR CAGAGTATTCTGGAGGTGGA TGG (reversed) Intronic
900768404 1:4520765-4520787 CCGTGTATGGTGGAGGTGGAGGG - Intergenic
901257027 1:7838296-7838318 AAGAGAGTTCTGGAGATGGATGG - Intronic
903501865 1:23804895-23804917 GAGAGTAGCCTGGAGGTGGTGGG - Intronic
903595258 1:24489224-24489246 AAAAGTGTTCTGGAGATGGATGG + Intergenic
904939911 1:34158434-34158456 CAGTGCATTCTCGAGGTAGAGGG + Intronic
904954068 1:34268396-34268418 CAGAGGATGCTGGAGCTGGGAGG - Intergenic
906651704 1:47517350-47517372 GAAACTATTCTGGATGTGGAGGG + Intergenic
906771454 1:48488805-48488827 CACAGCCTTCTGTAGGTGGAGGG + Intergenic
908345728 1:63230389-63230411 CAAAAAATTCTGGAGATGGATGG - Intergenic
908631298 1:66111352-66111374 GAAAATATTCTGGAGATGGATGG - Intronic
908771405 1:67600111-67600133 CAAAGAGTTCTGGAGATGGATGG - Intergenic
909156007 1:72077313-72077335 CAGTGTTTTTTAGAGGTGGAGGG + Intronic
911121781 1:94303466-94303488 GAAAGTGTTCTGGAGATGGACGG + Intergenic
911293459 1:96084814-96084836 CAGAGTATTGGAGATGTGGAGGG - Intergenic
912542037 1:110424188-110424210 AAAAGTGTTCTGGAGATGGATGG + Intergenic
912694070 1:111827801-111827823 CAGGGTATCCTGGAGCAGGAGGG - Intronic
913252066 1:116919969-116919991 CAAAGAATTCTGGAGATGGAAGG - Intronic
913508794 1:119543787-119543809 CAGAGTAGACTGAATGTGGAGGG - Intergenic
913511903 1:119569755-119569777 CAGAGTAGACTGAATGTGGAGGG - Intergenic
913516136 1:119607069-119607091 CAGAGTAGACTGAATGTGGAGGG - Intergenic
913971417 1:143420824-143420846 CAGAGTATTGAGGAGGTGGAGGG + Intergenic
914065794 1:144246437-144246459 CAGAGTATTGAGGAGGTGGAGGG + Intergenic
914113357 1:144719917-144719939 CAGAGTATTGAGGAGGTGGAGGG - Intergenic
914429880 1:147611627-147611649 CAGAGAATGCTGGAGCTGCAAGG + Exonic
914691113 1:150028531-150028553 AAAAGAATTCTGGAGTTGGATGG - Intergenic
915595987 1:156896770-156896792 CTGAGTCACCTGGAGGTGGAGGG - Intronic
916587691 1:166162943-166162965 CAGGGTGTTCTAGAGGTGAATGG - Intronic
916764235 1:167844972-167844994 CAGAGGATTCAGGGGGTGTAAGG - Intronic
916918297 1:169434996-169435018 TAAAGTGTTCTGGAGATGGATGG + Intronic
916983801 1:170168313-170168335 TAGAGTATTCTGGTGGGGGTGGG + Intergenic
918448317 1:184635710-184635732 CAGAGCACTCTGGAGGGGCAGGG - Intergenic
918593224 1:186262850-186262872 CAGAGTGAACTGGAAGTGGATGG + Intergenic
919662054 1:200256914-200256936 GAGAAAGTTCTGGAGGTGGATGG + Intergenic
919742541 1:200989603-200989625 TTGAGTCTGCTGGAGGTGGAGGG - Intronic
920778896 1:208968858-208968880 CAGAGTGGTTTGGAGGTAGAAGG - Intergenic
921960953 1:221033945-221033967 GACAGTAAGCTGGAGGTGGAGGG + Intergenic
922349169 1:224721831-224721853 GGGGGGATTCTGGAGGTGGAAGG + Intronic
922353979 1:224758938-224758960 GAGAGTATTCTGGAGGAAGGGGG + Intergenic
922970073 1:229728816-229728838 GAGAGAATTCTGGAGGTGTCCGG - Intergenic
924582372 1:245333503-245333525 CAGAGCGTTCTGGAGGTGGGCGG + Intronic
924588597 1:245381662-245381684 CAGAGTATTCTGGAGGTGGATGG - Intronic
1063347219 10:5323333-5323355 CAGAGAACTCTGAAGTTGGAAGG + Intergenic
1064106984 10:12508544-12508566 GAAAAAATTCTGGAGGTGGACGG + Intronic
1064198670 10:13266140-13266162 GAAAGTGTTCTGGAGATGGATGG - Intergenic
1064453990 10:15469644-15469666 CAGAGAAATCTGCAGGTGAATGG - Intergenic
1064615271 10:17147491-17147513 GAGAAAGTTCTGGAGGTGGATGG - Exonic
1065936110 10:30521822-30521844 CAAAGAGTTCTGGAGATGGATGG + Intergenic
1067190403 10:44063571-44063593 CAAAGCATTCTGGAGCTGCAGGG - Intergenic
1067678829 10:48412877-48412899 AAAAGAATTCTGGAGATGGATGG - Intronic
1067790194 10:49281935-49281957 CAATGTATCCTGGAGGTGGAGGG - Intergenic
1070515279 10:77199778-77199800 CAGTGCATTCTGGGAGTGGAAGG + Intronic
1073074721 10:100816660-100816682 CAGCTAATTGTGGAGGTGGAAGG - Intronic
1073118103 10:101104083-101104105 CAGATGATTCTGGAATTGGAAGG - Intronic
1074010396 10:109472942-109472964 CAGTGTTTTCTGAAGGTCGAGGG + Intergenic
1074183920 10:111085273-111085295 CAGAGAATTCTGGAGGGGATGGG + Intergenic
1074976389 10:118585320-118585342 CAAAGAAGTCTGGAGGTGGGTGG - Intergenic
1075341149 10:121647776-121647798 CAGAGGATTTAGGATGTGGAGGG + Intergenic
1075953837 10:126505446-126505468 GACAGAATTCTGGAGGTGGCTGG + Intronic
1076064021 10:127434508-127434530 TAAAGAGTTCTGGAGGTGGATGG - Intronic
1077308465 11:1878203-1878225 CAGAGTGTTGAGGAGGTGGAGGG - Intronic
1078030239 11:7743229-7743251 CAGAATATTCTCTAGGTTGAAGG - Intergenic
1078199486 11:9167355-9167377 CAGAATATTTTGGAGGAGGGTGG - Intronic
1078916053 11:15779954-15779976 CAGAGTAATTTGGAGCTGGAAGG - Intergenic
1079161391 11:17997931-17997953 CAAAATGTTCTGGAGATGGATGG + Intronic
1079323189 11:19469543-19469565 CAGAATATTCAGGAGGGTGAAGG - Intronic
1080952013 11:37044902-37044924 CAGGGAATTCTGGAGGTATATGG - Intergenic
1081498127 11:43636874-43636896 CAGAGAATTTTCGAGATGGAGGG + Intronic
1081684593 11:45033262-45033284 CAGAGAATGCTGGATCTGGATGG - Intergenic
1084616244 11:70237967-70237989 AACAGAATTCTGGAGATGGATGG - Intergenic
1085563919 11:77495944-77495966 GAAAGTATTCTGAAGATGGATGG + Intergenic
1085595141 11:77802482-77802504 CAGAGTATTCTGTGGATAGAAGG + Intronic
1085645389 11:78219164-78219186 CAGAGTAGAGAGGAGGTGGATGG + Exonic
1085816037 11:79738623-79738645 CAGAGTGTTCGGGAGCTGGAAGG + Intergenic
1086278041 11:85155452-85155474 CATAGTGTTCTGGAAGAGGAAGG + Intronic
1086843650 11:91720542-91720564 CATAGGATTTTGGAGGTGTAGGG + Intergenic
1087246987 11:95851009-95851031 AAGCATATTCAGGAGGTGGAAGG + Intronic
1088010332 11:104993399-104993421 GAAAGAATTCTGGAGGTAGATGG - Intergenic
1088660186 11:112037544-112037566 CATAGAATCTTGGAGGTGGAAGG - Intronic
1089776556 11:120841200-120841222 AAAAATGTTCTGGAGGTGGATGG - Intronic
1089825160 11:121268563-121268585 GAGAGAATTCTGGAGGTGTCTGG + Intergenic
1090921572 11:131210834-131210856 CAGAGACTACTGGAGGTGGTGGG + Intergenic
1090964117 11:131583300-131583322 CAGTATATTGGGGAGGTGGATGG - Intronic
1091288322 11:134421673-134421695 CAGAGTATTCTGTAGGAGTGTGG - Intergenic
1091386344 12:98245-98267 CACAGCATTTTAGAGGTGGAAGG + Intronic
1091514299 12:1163322-1163344 AGGAGTGTTCTGGAAGTGGAAGG - Intronic
1091638680 12:2217312-2217334 CAAAGTGTTCTGGAGATGGATGG + Intronic
1092418330 12:8308997-8309019 GAAAGCATTCTGGAGATGGATGG + Intergenic
1093512409 12:19944903-19944925 CAGAGTTGTCTGGCAGTGGATGG + Intergenic
1096048606 12:48586516-48586538 CAGTGTCTCCTGGAGGGGGATGG - Intergenic
1097021743 12:56025673-56025695 CAGAGTTTTATGGAGGTGGAGGG + Intronic
1097861379 12:64521894-64521916 CAGAGGGTTCTGAAGGTGGGAGG - Intergenic
1100365287 12:93914929-93914951 GAAAGTGTTCTGGAGGTAGATGG + Intergenic
1101156294 12:101930683-101930705 AAGAGGGTTCTGGAGATGGATGG - Intronic
1101338558 12:103819869-103819891 AAAAGAATTCTGGAGCTGGATGG - Intronic
1103808329 12:123592306-123592328 CAGCCCATTCTGGAGTTGGAAGG + Intronic
1104071535 12:125350084-125350106 CAGTGTCCTCTGGAGGAGGAAGG + Exonic
1104997365 12:132666768-132666790 CGAAGAATTCTGGAGGTAGATGG + Intronic
1105255847 13:18743684-18743706 CAGAGGATTCTGGAGGTTTCCGG + Intergenic
1105918931 13:24942687-24942709 CAGTGTTTTCTGGAGGTGCCTGG + Intergenic
1105939343 13:25133285-25133307 CAGAATATTTTGTAGGTGCAGGG + Intergenic
1106063622 13:26321436-26321458 AAAAGTGTTCTGGAGATGGATGG + Intronic
1106109275 13:26762092-26762114 CAGACTATTCTGGAGGTAGCAGG - Intergenic
1106158515 13:27179686-27179708 AAAAGAATTCTGGAGATGGATGG + Intergenic
1106181138 13:27370356-27370378 TAAAAAATTCTGGAGGTGGATGG - Intergenic
1106198120 13:27511250-27511272 GAAAGAATTCTGGAGATGGATGG - Intergenic
1106338188 13:28803737-28803759 GAAAGAGTTCTGGAGGTGGATGG - Intergenic
1110700610 13:78543382-78543404 CAGAGTATTATGGTGGTGGAAGG - Intergenic
1110738385 13:78965250-78965272 TAGATTAATCTGAAGGTGGAGGG + Intergenic
1111199598 13:84916049-84916071 CAGAAAATTCTGAAGTTGGAAGG - Intergenic
1111376054 13:87380137-87380159 CAGAGTAAGCTGCACGTGGAGGG - Intergenic
1112633086 13:101182774-101182796 CAGAAGATTCAGGAGGTGCAGGG + Intronic
1114319855 14:21538256-21538278 CAGTGTATTGTGGAGATGGAGGG - Intergenic
1117327902 14:54685773-54685795 CATGGAATTCTGGAGATGGAAGG - Intronic
1117989020 14:61415771-61415793 AAAAGAATTCTGGAGATGGATGG - Intronic
1118536084 14:66766276-66766298 CAGAGATTTCAGGAGGTGCATGG + Intronic
1119314885 14:73685205-73685227 AAGAGAGTTCTGGAGATGGATGG - Intronic
1121041646 14:90753890-90753912 CACAGAATTGTGGAGCTGGAAGG - Intronic
1121213286 14:92225944-92225966 AAGAGAGTTCTGGAGATGGAGGG - Intergenic
1121883237 14:97518967-97518989 AAGAGTATTATGGAGTTGGAGGG - Intergenic
1122364518 14:101186656-101186678 AAGATTATTCTGGAGGCGGTGGG + Intergenic
1122763540 14:104048730-104048752 CAGACTATTCAGGAGGTAAAAGG - Intronic
1122892191 14:104737618-104737640 AAGAAAGTTCTGGAGGTGGATGG - Intronic
1202870197 14_GL000225v1_random:155869-155891 AAGAATGTTCTGGAGATGGATGG - Intergenic
1124720115 15:32104430-32104452 CAGAGTGGGCTGGAGGTGGAGGG - Intronic
1124887606 15:33701631-33701653 CAGAGCAACCTGGAGGGGGAGGG + Intronic
1125519573 15:40340377-40340399 CAGGGGATTCGGGAGGTCGAGGG + Intronic
1125673555 15:41490414-41490436 CTGACTAGTATGGAGGTGGAAGG - Intergenic
1126199194 15:45966516-45966538 AAGAGAATTCTGGAGATGGGAGG + Intergenic
1126450198 15:48799407-48799429 CAGAGTATGTTGGAGGTGGGTGG + Intronic
1129266335 15:74395483-74395505 CAGAGTGTTCTGGAAGTGTTTGG - Intergenic
1129787313 15:78318334-78318356 TAGAGTATTTTGGGGGTGAATGG + Intergenic
1129947690 15:79555135-79555157 GAAAGCATTCTGGAGATGGATGG - Intergenic
1130981979 15:88818812-88818834 AAAAGCATTCTGGAGATGGATGG + Intronic
1134454417 16:14383988-14384010 GAAAACATTCTGGAGGTGGATGG + Intergenic
1134479005 16:14601502-14601524 AAGAGAATTCTGGAGATGGATGG + Intronic
1134759896 16:16705059-16705081 AAAAATATTCTGGAGATGGATGG - Intergenic
1134986176 16:18654146-18654168 AAAAATATTCTGGAGATGGATGG + Intergenic
1135510466 16:23078521-23078543 CAGAGCGTGCTGGAGGGGGAGGG - Intronic
1135563082 16:23491817-23491839 AAGAGAATTCTAGAGCTGGAAGG + Intronic
1136041537 16:27583390-27583412 CAGTGACTTCTGGGGGTGGAGGG - Intronic
1136334516 16:29602663-29602685 CACGGTATTGTGGAGGTGGAAGG + Intergenic
1137267684 16:46882732-46882754 AAGCGTGTTTTGGAGGTGGAGGG + Intergenic
1137469602 16:48742795-48742817 TAGAGAACTCTGGAGGTGGGAGG + Intergenic
1138046137 16:53727633-53727655 AACAGTATTCTGGAAGTGTATGG + Intronic
1138226141 16:55296660-55296682 CAGAGGACTCTAGAGCTGGATGG + Intergenic
1138347370 16:56328356-56328378 CAGAGTTTTCTGGGGCAGGAAGG - Intronic
1138477890 16:57282990-57283012 CAGAGCATTCTAGCGGTGGCGGG + Intronic
1139551225 16:67674152-67674174 CAGAGTGCTCTTGAGGTGGCGGG - Intergenic
1141075359 16:81001520-81001542 AAAAGTATTATGGAGATGGACGG + Intronic
1142035226 16:87858499-87858521 CACGGTATTGTGGAGGTGGAAGG + Intronic
1142406358 16:89892365-89892387 CAGAGGCTGCTGGGGGTGGAGGG + Intronic
1142789587 17:2253617-2253639 CAGAATATTCTGGTGGCGGAGGG - Intronic
1142906837 17:3049179-3049201 CTGGGTTTTCTGGGGGTGGAGGG + Intergenic
1143001841 17:3799504-3799526 AGGAGTATTCTGGAGCTGGGAGG + Intronic
1143371100 17:6440008-6440030 CAGAGGCTTTTGGAGGGGGAGGG - Intergenic
1143590031 17:7879146-7879168 CATAGTATTTTAGAGATGGAAGG - Intronic
1143852507 17:9823284-9823306 AAAAGAGTTCTGGAGGTGGATGG - Intronic
1143973251 17:10811236-10811258 AAAAATGTTCTGGAGGTGGATGG - Intergenic
1144590982 17:16523590-16523612 GAAAATATTCTGAAGGTGGAGGG - Intergenic
1144755435 17:17677693-17677715 AAGAGTCTTCTTGAGATGGAGGG + Intergenic
1145257609 17:21335680-21335702 AAAAGAATTCTGGAGATGGATGG - Intergenic
1145319027 17:21752343-21752365 GAAAGAATTCTGGAGATGGATGG + Intergenic
1146648363 17:34590438-34590460 CAGAGCATTGTGGAGGAAGAGGG + Intronic
1147121251 17:38336423-38336445 CAGAGGCTGCTGGAGCTGGAAGG + Intronic
1147243503 17:39105975-39105997 CAGAGCGTTTGGGAGGTGGACGG - Intronic
1147440672 17:40445470-40445492 CAGAGGATTGAGGAAGTGGAGGG - Intronic
1147980808 17:44272844-44272866 CTGAGCAGTCTGGGGGTGGATGG + Intergenic
1148750731 17:49944468-49944490 CTGAGGAGCCTGGAGGTGGAGGG - Intergenic
1149469114 17:56901747-56901769 CACAGTAATCTGGAGCTGGAGGG + Intronic
1149989199 17:61371422-61371444 CAGAGTGGTCTGGGGGTTGAAGG + Intronic
1151240839 17:72756681-72756703 GAAAGAATTCTGGAGGTGGATGG + Intronic
1151513962 17:74580294-74580316 CTGAGTTTACTGGAGGTGTAGGG - Intronic
1151788381 17:76287863-76287885 CAGAGGATCCTGGAAGGGGAAGG - Exonic
1152286936 17:79418114-79418136 GAGAACATTCTGGAGATGGATGG + Intronic
1152289585 17:79431887-79431909 AAAAGCATTCTGGAGATGGAAGG - Intronic
1152305332 17:79517025-79517047 GAGAACGTTCTGGAGGTGGATGG + Intergenic
1152940790 17:83172157-83172179 CAGACTAGCCTGGAGTTGGATGG + Intergenic
1153006740 18:503883-503905 AAAAGAATTCTGGAGATGGATGG + Intergenic
1155066393 18:22272837-22272859 GAGAGGGTTCTGGAGGTAGAAGG + Intergenic
1156041229 18:32825234-32825256 CAGAGTATCCAGGAAGTGGCTGG - Intergenic
1156947650 18:42854494-42854516 CAGAGCATTCTGGGTATGGAAGG - Intronic
1158066286 18:53413163-53413185 CAGAGGATTCTGGTGGAGGGAGG + Intronic
1158088546 18:53682980-53683002 GAGAGAATTCTGGAGGTGCCTGG + Intergenic
1159904977 18:74081686-74081708 CTGAGTATGGTGGAGTTGGAGGG - Intronic
1160827484 19:1087447-1087469 GAGAAAATTCTGGAGGTGGCCGG - Exonic
1161749488 19:6084454-6084476 GAGAATGTTCTGGAGATGGATGG - Intronic
1162082725 19:8228253-8228275 GAAAGAATTCTGGAGCTGGATGG + Intronic
1162504437 19:11074781-11074803 GAGAATGTTCTGGAGATGGATGG + Intergenic
1162517811 19:11159886-11159908 GAGAATGTTCTGGAGATGGATGG + Intergenic
1163398454 19:17077359-17077381 CAGGATATTCTGGAAGTGAAGGG - Intronic
1164812581 19:31169519-31169541 GAAAGGATTCTGGAGATGGATGG + Intergenic
1165825922 19:38705695-38705717 CAGTGTGTTCTGGTGGTGAAAGG + Intronic
1168466719 19:56608213-56608235 CAAAGAGTTCTGGAGATGGATGG - Intronic
925165659 2:1714138-1714160 AACAGTATCCTGGATGTGGATGG - Intronic
925305382 2:2844751-2844773 CAGAGCCTGCTGTAGGTGGAAGG - Intergenic
925348499 2:3186258-3186280 CAGAGGAGTCTGGGGGTGGGAGG - Intergenic
925777176 2:7347014-7347036 CAGAGTCTGCTGGAGATGGATGG + Intergenic
926431732 2:12793919-12793941 CAGACTATTCTTGAGTAGGATGG + Intergenic
926586201 2:14688313-14688335 CAGAGCACTTTGGAGTTGGAAGG + Intergenic
927707644 2:25306642-25306664 CATTGTCTTCTGGAGGTGCAGGG + Intronic
928895758 2:36261129-36261151 GAGAGTATTCTGAAGGTGACAGG - Intergenic
930170947 2:48251189-48251211 AAAAGTGTTCTGGTGGTGGATGG + Intergenic
930675084 2:54191773-54191795 CAGAGAATAATGGAGGGGGAGGG - Intronic
931260430 2:60613760-60613782 AAGAGTTTTCTGGAGATTGATGG + Intergenic
932403991 2:71501510-71501532 GAGAACATTTTGGAGGTGGACGG - Intronic
933761846 2:85677986-85678008 AAAAGCATTCTGGAGATGGATGG - Intergenic
934176108 2:89581757-89581779 CAGAGTATTGAGGAGGTGGAGGG + Intergenic
934286418 2:91656119-91656141 CAGAGTATTGAGGAGGTGGAGGG + Intergenic
935208557 2:100919216-100919238 CAGAGTTTTGTGGGAGTGGAGGG + Intronic
935294800 2:101639527-101639549 CAGAGTTTTCAGGAATTGGAAGG - Intergenic
935514931 2:104024041-104024063 CAGGGAATGATGGAGGTGGAGGG + Intergenic
936402741 2:112177628-112177650 AAAAGAATTCTGGAGCTGGATGG - Intronic
936838584 2:116740582-116740604 AAAATTATGCTGGAGGTGGAAGG + Intergenic
937057707 2:118953529-118953551 AAAAGTTTTCTGGAGGTGGGGGG + Intronic
938612325 2:132960477-132960499 CAGAATATTCTGGAGGCTAAGGG - Intronic
938756823 2:134388336-134388358 CACAATATTCTGGGGGCGGAGGG - Intronic
940939120 2:159537314-159537336 AAAAGAATTCTGGAGATGGATGG + Intronic
941017673 2:160375087-160375109 TAGAGTATTTTGGAGCTGGAAGG - Intronic
942525730 2:176850584-176850606 CAGAGTGGGCTGGAGGTGGAAGG + Intergenic
942681545 2:178481763-178481785 CATGGAATTCTGGAGTTGGAAGG - Intronic
943589642 2:189782275-189782297 AAGAGAGTTCTGGATGTGGATGG - Intronic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945412362 2:209526358-209526380 CTGAGAATTCTGGAAGTGGAGGG + Intronic
945466083 2:210171526-210171548 CGGAGTGTTCTGGAAGTGGCAGG + Intergenic
946474123 2:219991501-219991523 AAGAGTTTTCAGGAGCTGGAAGG + Intergenic
946765162 2:223033687-223033709 CAGTGTATCCTGGAGCTGGGTGG - Intergenic
947497887 2:230651914-230651936 AAAAGTGTTCTGGAGATGGATGG - Intergenic
947526496 2:230879692-230879714 CAGAGAATTCTGGAAGCGGCAGG + Intergenic
947959010 2:234219007-234219029 CAGAGTATTCACTAGGTGTAAGG - Intergenic
949003986 2:241635045-241635067 AAAATAATTCTGGAGGTGGATGG + Intronic
1169051903 20:2586068-2586090 GAGTGTATTCTGCATGTGGAAGG - Intronic
1169974581 20:11310234-11310256 AACAGAATTCTGGAGATGGATGG - Intergenic
1170242134 20:14178614-14178636 CAGAGTAGTATGGATGAGGAAGG + Intronic
1170640608 20:18149300-18149322 AAAAAAATTCTGGAGGTGGATGG - Intronic
1174208762 20:48860423-48860445 AAAAGAATTCTGGAGCTGGACGG + Intergenic
1175841528 20:62030879-62030901 CATCGTATTGTGGAGGTGGTGGG - Intronic
1175977025 20:62716137-62716159 GAGAAGGTTCTGGAGGTGGATGG - Intronic
1176221358 20:63970541-63970563 CTGAGTGGTCTGGAGGTGGCGGG + Intronic
1176688022 21:9871603-9871625 CACATTTTTCTGGAAGTGGAGGG - Intergenic
1177213778 21:18103584-18103606 CAGTGTATTCAGGCGATGGATGG + Intronic
1177403804 21:20640056-20640078 AAAAACATTCTGGAGGTGGATGG + Intergenic
1180117859 21:45723965-45723987 CAGCTTATGCTGGAGGAGGACGG - Intronic
1180600791 22:17013991-17014013 AAAAGAATTCTGGAGATGGATGG + Intergenic
1180728893 22:17966419-17966441 CAGAGGAGTGAGGAGGTGGAGGG - Intronic
1181579310 22:23818585-23818607 GATAGAATTCTGGAGATGGATGG - Intronic
1182138522 22:27931037-27931059 AAAAGAATTCTGGAGATGGATGG - Intergenic
1183141798 22:35948903-35948925 CAGAAAGTTCTGGAGATGGATGG - Intronic
1183346304 22:37310192-37310214 CCGAGTGCTCTGGAGGAGGATGG - Intronic
1183699565 22:39443350-39443372 AAAAGCATTCTGGAGATGGACGG + Intergenic
949949441 3:9217061-9217083 AAAAGTGTTCTGGAGATGGATGG + Intronic
950361991 3:12456066-12456088 CTGACTATTCTGGAGGAAGAGGG - Intergenic
951113313 3:18831678-18831700 CTGAGTATTCTGAAGTGGGATGG + Intergenic
951296147 3:20937346-20937368 CAGAGTATTTGGGAAGTGGGTGG + Intergenic
951325186 3:21293707-21293729 CACAGTAGTCTTGAGGGGGAAGG - Intergenic
952214906 3:31268628-31268650 CATAAGATTCTGGAGCTGGAAGG + Intergenic
953623745 3:44554015-44554037 CTTAGGATTCTTGAGGTGGAAGG - Intergenic
955070147 3:55566043-55566065 CTGAGTATTCTGGCTCTGGATGG + Intronic
955525001 3:59810712-59810734 CAGTGTACTTTGGAGGGGGAGGG - Intronic
958258009 3:91347458-91347480 CACAGTGTGCTAGAGGTGGAAGG - Intergenic
958259534 3:91364421-91364443 CTTAGGATTCTGGAGGTTGATGG - Intergenic
959498147 3:107074834-107074856 CACAGGATATTGGAGGTGGAAGG - Intergenic
959608195 3:108264814-108264836 CAAAAAATTCTGAAGGTGGATGG + Intergenic
959952149 3:112192193-112192215 AAAAGAATTCTGGAGATGGATGG - Intronic
960058940 3:113298885-113298907 AAAAGTGTTCTGGAGATGGATGG + Intronic
960951931 3:123004938-123004960 CAGAGTATTCTGGACTTTCAGGG - Intronic
961079292 3:124011865-124011887 TAAAAAATTCTGGAGGTGGATGG + Intergenic
961248984 3:125483528-125483550 CAGAGGTTTCTGGAGTTGAAAGG + Intronic
962200788 3:133399812-133399834 CAGATTATTCTGCTGGTGGTGGG - Intergenic
962425620 3:135266786-135266808 TAGTGTATGCTGGAGGAGGAAGG - Intergenic
964474008 3:157082614-157082636 CAGGGTATTCTAGAGGTGTGTGG - Intergenic
965053652 3:163685972-163685994 CATAGTTTTTTGGAGGTAGAGGG + Intergenic
966050900 3:175617261-175617283 CAGGTGATTCTGGAGGTCGAAGG - Intronic
966549768 3:181192322-181192344 CAGCCTGGTCTGGAGGTGGATGG + Intergenic
966759435 3:183403664-183403686 GAGAGAATTCTGGAGGTGCCTGG + Intronic
967151236 3:186652640-186652662 CAGAGTCTTCTGTAGGGGTATGG + Exonic
969229033 4:5816902-5816924 CAGAGTTCTCAGGAGGTTGAAGG - Intronic
969284642 4:6195304-6195326 TAGAGAGTTCTAGAGGTGGATGG + Intronic
971873993 4:32280737-32280759 CAGAGCCTTCTGGGGGTGGGGGG + Intergenic
972242558 4:37208942-37208964 CATGGTAGTGTGGAGGTGGAGGG - Intergenic
972323949 4:37997817-37997839 CAGAGTAGACTGAGGGTGGATGG + Intronic
972334550 4:38095696-38095718 CAGAGTATGTTGGGGGTGAAGGG + Intronic
972936767 4:44146014-44146036 CAGAATTTTCTGGAGGTGGCAGG + Intergenic
973262917 4:48182772-48182794 CAGAGTATTCTGGAAATTAAAGG - Intronic
973312090 4:48720584-48720606 AAAAGAGTTCTGGAGGTGGATGG - Intronic
973822432 4:54674277-54674299 CAGAATGTTCTGGAGTGGGAGGG - Intronic
975279494 4:72543768-72543790 AAAAGAATTCTGGAGATGGATGG + Intronic
975636251 4:76452315-76452337 GAAAATGTTCTGGAGGTGGATGG - Intronic
976108118 4:81641225-81641247 ATGGGGATTCTGGAGGTGGATGG - Intronic
976788028 4:88844839-88844861 AAGAGCATTCTGGAGTTGGCTGG + Intronic
976840813 4:89430551-89430573 GAGGGTATTCTGGAAGTGGGAGG + Intergenic
977840526 4:101697518-101697540 CACAGTATGTTGGAGTTGGAAGG + Intronic
979949861 4:126878572-126878594 GAGAGTATTCTGGAAGTCTAGGG - Intergenic
983206539 4:164916396-164916418 CAGAATATTGTGGAGGCAGATGG - Intergenic
983212086 4:164969150-164969172 CAGAATATTGTGGAGGCAGATGG + Intronic
983429102 4:167625102-167625124 CAAAGGATTCTGGAGTTGGATGG - Intergenic
986145200 5:5071456-5071478 CAGAAAATTCTGGAGAGGGAGGG - Intergenic
986292404 5:6410682-6410704 CAGATAATTCTGGAGGGGGCTGG - Intergenic
987621301 5:20340687-20340709 CAGGTGATTCTGGAGGTTGAAGG + Intronic
988339374 5:29950088-29950110 CAGGGAATTATGGAGGTGGGGGG - Intergenic
989191015 5:38669768-38669790 CAGAGGATTCGGGAGGTGAAGGG + Intergenic
990335760 5:54770858-54770880 GAAAGAGTTCTGGAGGTGGATGG + Intergenic
990504917 5:56434487-56434509 CAGAGCATTGTAGAGGTGGAAGG - Intergenic
991692129 5:69235234-69235256 AAGAGTAGCCTGGAGCTGGACGG + Intronic
992121658 5:73599753-73599775 CATAGTATTCTGGAGGTCAGGGG - Intergenic
992477561 5:77118444-77118466 CAGAGTACTCTGGGTGAGGAGGG + Intergenic
992994053 5:82315244-82315266 GAAAGCATTCTGGAGATGGATGG + Intronic
993092594 5:83444666-83444688 CAGAGTTTTCTGGAGATAGATGG - Intergenic
993167019 5:84369646-84369668 AAGAGAATTATGGAGATGGATGG + Intronic
994046752 5:95318807-95318829 CAAAGAATTCTGGAGTTGGAAGG + Intergenic
995047415 5:107668923-107668945 AAGAGTCTCCTGGAGGTGGGTGG - Intronic
996240981 5:121201036-121201058 GAAAGTTTTCTGGAGGTGTAAGG + Intergenic
996899414 5:128526783-128526805 AAAAGAATTCTGGAGATGGATGG + Intronic
997472059 5:134122642-134122664 CAGAGCCTCCTGGAGGTGCAAGG + Intronic
999461982 5:151765305-151765327 TAGACTACACTGGAGGTGGAGGG - Intronic
999686630 5:154108930-154108952 CAGAGTGTTGTGGGGGTGAAAGG - Intronic
1001934226 5:175693235-175693257 CAGAGCATTCAGAGGGTGGAAGG + Intergenic
1002448170 5:179302712-179302734 CAGAGTATTGTTGAGGGGGGCGG + Intronic
1002852514 6:1009197-1009219 AAGAGAAGTCTGGAGTTGGATGG - Intergenic
1002895772 6:1379295-1379317 CAGGGTATTCTGGAGCAGGAGGG + Intergenic
1003091594 6:3108540-3108562 CAGTGTAAGCTGGAGGTGGTGGG + Intronic
1003584948 6:7380236-7380258 CAGGGTATTTTGGAGTTTGAGGG - Intronic
1005872472 6:29985229-29985251 CAGCGTACCCTGGATGTGGATGG - Intergenic
1006647483 6:35524787-35524809 GAAAGAATTCTGGAGATGGATGG + Intergenic
1007750704 6:44069178-44069200 AAAAGAATTCTGGAGATGGATGG - Intergenic
1007823159 6:44577136-44577158 CAGATTCTTATGGAGGTGAAAGG - Intergenic
1008420536 6:51294141-51294163 CATGGTATTCAGCAGGTGGATGG - Intergenic
1008934112 6:56971062-56971084 AAAAGTATCCTGGAGATGGATGG - Intronic
1008995700 6:57655945-57655967 CTTAGGATTCTGGAGGTTGATGG + Intergenic
1009184226 6:60554714-60554736 CTTAGGATTCTGGAGGTTGATGG + Intergenic
1011637563 6:89388392-89388414 GAGAACATTCTGGAGATGGATGG + Intronic
1013313766 6:108922077-108922099 CAGAGTACTCTGATGGAGGAAGG + Intronic
1014540017 6:122663913-122663935 CAGAGAAATATGGAGGTGGGTGG + Intronic
1015115577 6:129645558-129645580 CACAGAATTCTGGAGGGAGAGGG - Intronic
1016120507 6:140337437-140337459 CAGGTGATTCTGGAGGAGGAAGG - Intergenic
1017539843 6:155389713-155389735 CAGAGGATTCTGGAAGAGAATGG + Intergenic
1018466006 6:164045647-164045669 GATAGTATACTGGAGGTGAAGGG + Intergenic
1018619578 6:165716927-165716949 AAAAGTGTTCTGGAGATGGACGG - Intronic
1018753726 6:166830414-166830436 AGAAGTATTCTGGAGGTGGATGG + Intronic
1018955878 6:168410343-168410365 GAGATTCTTCAGGAGGTGGAGGG + Intergenic
1019695194 7:2441973-2441995 GAGAGAATTTTGGAGATGGATGG - Intergenic
1019810355 7:3160652-3160674 GAAAACATTCTGGAGGTGGATGG + Intronic
1019948431 7:4349365-4349387 AAAAGAATTCTGAAGGTGGATGG - Intergenic
1021329030 7:19311787-19311809 CGGAGTTTTTTAGAGGTGGATGG - Intergenic
1022718934 7:32925291-32925313 CAGATACTTCTGGAGGTGAAGGG + Intergenic
1023556585 7:41429874-41429896 AAGAGTAGGCTGGAGGAGGAGGG - Intergenic
1023835593 7:44065547-44065569 CAGAGGACTCTGGACGGGGACGG + Exonic
1024296171 7:47844002-47844024 CAGAGTATTGTCCAGGTGGAAGG - Intronic
1024855740 7:53776959-53776981 GAAAGTGTTCTGGAGATGGATGG - Intergenic
1025145947 7:56503825-56503847 AAAAATGTTCTGGAGGTGGATGG + Intergenic
1025213603 7:57036316-57036338 CAGAGCTTTATGGAGATGGATGG + Intergenic
1025658350 7:63540507-63540529 CAGAGCTTTATGGAGATGGATGG - Intergenic
1025753482 7:64312945-64312967 CAGAGTTTACTGGAGGTGGCAGG - Intronic
1027337702 7:77171518-77171540 CAGATAAGTCTGGAGGTGGCAGG - Intronic
1027448615 7:78303407-78303429 CAGATGATTCAGGAGGAGGAGGG - Intronic
1027573063 7:79896065-79896087 AGGAGGATTCTGGAGGTTGAGGG + Intergenic
1028660536 7:93267632-93267654 CAGAGTATTATGAAGGTTGTGGG + Intronic
1029014353 7:97299683-97299705 CTGCTTATTCTAGAGGTGGAAGG + Intergenic
1029683897 7:102132119-102132141 CAGAGCTTTGTGGAGATGGATGG + Intronic
1029778032 7:102699286-102699308 CAGATAAGTCTGGAGGTGGCAGG + Intergenic
1030465824 7:109902084-109902106 CAGACTATCTTGGAGCTGGAAGG + Intergenic
1031275605 7:119718220-119718242 AATAGAATTCTGGAGATGGATGG + Intergenic
1031756598 7:125651615-125651637 AAAAGTATTATGGAGGTGTATGG + Intergenic
1032189050 7:129752356-129752378 GAGAGTAGTCTGGGGGTGGGGGG + Intronic
1032556162 7:132837049-132837071 AAGAGTATTGAGTAGGTGGACGG - Intronic
1033653151 7:143356813-143356835 CAGAGTATCCTGAAGCTGGTTGG + Exonic
1034572882 7:151971591-151971613 GAGAGAGTTCTGGAGATGGATGG - Intronic
1034838617 7:154375123-154375145 CAGACAGTTCTGGATGTGGAGGG + Intronic
1035096084 7:156356905-156356927 CAGAGTGTGCTGCAGCTGGATGG + Intergenic
1035914311 8:3602047-3602069 AAAAGAATTCTGGAGATGGATGG + Intronic
1036775737 8:11611913-11611935 CAAAAAATTCTGGAGATGGATGG + Intergenic
1038191502 8:25325218-25325240 CAGAGTATCTCAGAGGTGGAAGG + Intronic
1038433300 8:27516675-27516697 AAGAATGTTCTGGAGATGGATGG - Intronic
1039923927 8:41912105-41912127 GAGAAGGTTCTGGAGGTGGATGG - Intergenic
1040022090 8:42749912-42749934 CAAAGAGTTCTGGAGATGGATGG + Intergenic
1040477097 8:47788382-47788404 CAGAGGGTGCTGGAGTTGGAAGG - Intronic
1040909190 8:52501274-52501296 CAAATGATTCTGGAGATGGAGGG + Intergenic
1041110700 8:54479876-54479898 CAGTGTAGTGGGGAGGTGGAAGG + Intergenic
1042317573 8:67440148-67440170 TAGAGAATTCAGAAGGTGGATGG - Intronic
1042448904 8:68922010-68922032 CAGAGGATTCTGGCTGGGGATGG - Intergenic
1042857506 8:73282909-73282931 CATGCTAGTCTGGAGGTGGAGGG + Intergenic
1045459844 8:102415928-102415950 AAGAGTAATGTGGAGGTTGAAGG + Intergenic
1046861545 8:119098000-119098022 AAAAGAGTTCTGGAGGTGGAGGG - Intronic
1047488888 8:125357923-125357945 TACAGTATTCGGGAGGTGAACGG - Intronic
1047571418 8:126102657-126102679 CACAGCACTCTGGAGCTGGATGG - Intergenic
1048367538 8:133751571-133751593 GACAATATTCTGGAGATGGATGG - Intergenic
1049224546 8:141443656-141443678 GAGAATGTTCTGGAGATGGATGG - Intergenic
1049408160 8:142460803-142460825 GAGAGTGCTCAGGAGGTGGAAGG - Intronic
1050220491 9:3383777-3383799 CAGAGTGTTCTGCATGGGGATGG + Intronic
1051377873 9:16422683-16422705 CACAGTATTCCTAAGGTGGAAGG + Intronic
1051900798 9:22037311-22037333 CAGAGGATTCTGCACTTGGATGG - Intergenic
1053112035 9:35469503-35469525 CACAGTATTCTGGACATGGAAGG - Intergenic
1053186443 9:36020448-36020470 CAGAGAATTCTGGAGGTGTCTGG + Intergenic
1054716181 9:68559813-68559835 CAGAGAGTTCTGGAGCTAGACGG + Intergenic
1054943041 9:70764653-70764675 CATAGAATTCTAGAAGTGGAAGG + Intronic
1055711749 9:79070659-79070681 GAGAGAATTCTGTGGGTGGATGG + Intergenic
1056280640 9:85038303-85038325 CAGAGTTTTCAGTAGGGGGATGG - Intergenic
1056981676 9:91318573-91318595 GAGAGAATTCTGGAGGTGCCTGG - Intronic
1058137624 9:101324640-101324662 CAGAGAATTCTGGATTTGGAGGG + Exonic
1058476577 9:105340433-105340455 AAGAGAGTTCTGGAGATGGATGG + Intronic
1058814737 9:108672649-108672671 CAGAGAACACTGGAGGTGGAGGG - Intergenic
1060034828 9:120245863-120245885 AAAAGCATTCTGGAGATGGATGG + Intergenic
1061039797 9:128133715-128133737 AAAAGAATTCTGGAGATGGAAGG - Intergenic
1061423922 9:130487527-130487549 GAAAATGTTCTGGAGGTGGACGG - Intronic
1203734255 Un_GL000216v2:120713-120735 AAGAATGTTCTGGAGATGGATGG + Intergenic
1186170341 X:6870212-6870234 CAGAGAGTTCTGGAGATGGGAGG + Intergenic
1188225619 X:27593169-27593191 AAAAGAGTTCTGGAGGTGGATGG - Intronic
1189727052 X:43977742-43977764 CTGAGTATCATGGAAGTGGAAGG - Intergenic
1190259658 X:48789971-48789993 CAGACTCTTCTAGAGGGGGAGGG + Intronic
1190375296 X:49783206-49783228 AGGACTATTCTGGTGGTGGAGGG + Intergenic
1192729156 X:73785232-73785254 CAGAGGATCCTGGAGATTGATGG + Intergenic
1192845306 X:74901057-74901079 AAAAGAATTCTGGAGATGGATGG + Intronic
1193132894 X:77936505-77936527 AAGAAAGTTCTGGAGGTGGATGG - Intronic
1194966671 X:100296499-100296521 CAGAGAGCTCTTGAGGTGGAGGG + Exonic
1196405588 X:115359248-115359270 CAGAGAATTATAGAGCTGGAAGG + Intergenic
1196539251 X:116885466-116885488 TAGAGAATACTGGAGCTGGAAGG + Intergenic
1198230331 X:134683096-134683118 CAGAAAATTCTGGAGATGGAGGG - Intronic
1198851080 X:140966058-140966080 GAGAGAATTCTGGAGGTGTCTGG - Intergenic
1201938265 Y:19431304-19431326 CAGATGATTCTGGAAGTTGAAGG - Intergenic