ID: 924592867

View in Genome Browser
Species Human (GRCh38)
Location 1:245420110-245420132
Sequence ACTTTGTAGAGGCATCCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924592864_924592867 4 Left 924592864 1:245420083-245420105 CCAAAGATGCTCTTTTGCAGCAT 0: 1
1: 0
2: 2
3: 17
4: 172
Right 924592867 1:245420110-245420132 ACTTTGTAGAGGCATCCCTCTGG 0: 1
1: 0
2: 0
3: 4
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924592867 Original CRISPR ACTTTGTAGAGGCATCCCTC TGG Intronic
900324398 1:2101056-2101078 ACTTTGTAGAGGGATCCCAAGGG + Intronic
901157459 1:7150098-7150120 CCTTTGAAGAGGCATCACTGAGG - Intronic
906367334 1:45221967-45221989 GCTTTGTAGGGGCACCCCACTGG + Intronic
915425219 1:155820240-155820262 ACTTTGGTGTGGGATCCCTCAGG - Intronic
919290072 1:195618759-195618781 ACTTATTAAAAGCATCCCTCTGG - Intergenic
922193151 1:223337730-223337752 AGTTTACAGAGCCATCCCTCAGG + Intronic
922606021 1:226890454-226890476 ACTTTGGAGAGGGATTCTTCAGG + Intronic
923162064 1:231323287-231323309 ACCTTCTAGGGGCATCCCACTGG + Intergenic
924592867 1:245420110-245420132 ACTTTGTAGAGGCATCCCTCTGG + Intronic
1064180186 10:13107987-13108009 GTTTTGTAGAGGCATCCATGTGG - Intronic
1070435657 10:76390309-76390331 ACTTTTTAGAATGATCCCTCTGG + Intronic
1072097743 10:92198996-92199018 ACTTTTTAGAGGAATTCCTAAGG + Intronic
1072566908 10:96624357-96624379 GCATTGTAGAGCCATCCCTTGGG - Intronic
1072793832 10:98339087-98339109 ACTTTGGAGAAGCACCCCACTGG - Intergenic
1073095708 10:100978523-100978545 GCTGTGTAGAGGCCTCCATCTGG - Exonic
1074271354 10:111956994-111957016 CCATTTTAGAGGCCTCCCTCTGG - Intergenic
1077915583 11:6609600-6609622 ACATTGTAGAGGGATCCATACGG - Exonic
1078154573 11:8788247-8788269 ACTATGCAAAGGGATCCCTCAGG + Intronic
1084825997 11:71732022-71732044 ACTTGGTTGTGGCATCCCTAGGG - Intergenic
1087894507 11:103572665-103572687 GCTTTGGCGAGGCATCCCACAGG - Intergenic
1088820993 11:113457432-113457454 ACTTTGTAGATTCATCCTTGAGG - Intronic
1092415918 12:8290442-8290464 GCTTTGACGAGGCATTCCTCCGG + Intergenic
1100897975 12:99205897-99205919 ACTTAGTTGAGGCATGCCTCAGG + Intronic
1104998173 12:132672203-132672225 ACTTTGAAGAGGTAACCATCAGG - Exonic
1109929182 13:69191212-69191234 ATTTTTTGGAGGCTTCCCTCAGG - Intergenic
1115146614 14:30233980-30234002 ACTTTGGAGAGGCATCTATAAGG + Intergenic
1115636232 14:35292528-35292550 ACTTGGTAGAGCCGACCCTCGGG - Exonic
1122089498 14:99328821-99328843 GGCTTGTAGAGGCATCACTCTGG - Intergenic
1130580701 15:85134827-85134849 ACTTGGTAGAGCCAGGCCTCTGG + Intronic
1130743332 15:86624766-86624788 AGTTTGTAGAGGAGTCCCTGGGG - Intronic
1131922240 15:97340984-97341006 ACTTTGTACAGGCATAATTCAGG + Intergenic
1133012395 16:2921427-2921449 AGCTTATAGAGGCATCCATCCGG + Intronic
1140315526 16:73892810-73892832 AATTTGTAAATGTATCCCTCTGG - Intergenic
1149320583 17:55477000-55477022 ACTTTGTTGTGGCAGCCCTAGGG - Intergenic
1158238668 18:55350884-55350906 ACTGTGAAGAGGCCTCCTTCGGG + Exonic
1165317494 19:35065689-35065711 ACTCTGTAGGGGCAGCCCCCTGG + Intronic
1167796877 19:51715206-51715228 ACGTTGTAATGGGATCCCTCTGG - Intronic
926799021 2:16642551-16642573 ACATTTTAGTGGCATCACTCTGG - Intronic
927644844 2:24871160-24871182 GCACTGTGGAGGCATCCCTCTGG - Intronic
931790928 2:65663579-65663601 ACTTTTTAAATGGATCCCTCTGG + Intergenic
931831340 2:66054630-66054652 ACGTTTTAGAGAGATCCCTCTGG - Intergenic
941439385 2:165514437-165514459 ACTTTGTAGAGGAATCATCCGGG - Intronic
947792947 2:232878138-232878160 ACTTTGTAGCGTCTTCCCACAGG - Intronic
1175146600 20:56901217-56901239 ACTTTTTAAAAGAATCCCTCTGG + Intergenic
1183706318 22:39476852-39476874 ACTTTGTGTAGGCGTCCCTGTGG + Intronic
1184918201 22:47587706-47587728 AGTTTATAGAGGGATCCCTCGGG - Intergenic
1185016124 22:48343749-48343771 GCTTTATAGAGGCAGCTCTCAGG - Intergenic
957268215 3:77995121-77995143 ACCTTTTAGAGCAATCCCTCTGG + Intergenic
963273347 3:143306941-143306963 AGTTTGTATATGCATCCTTCAGG + Intronic
967216277 3:187213174-187213196 ACTTTGTAGAGGTCTCCTTTGGG + Intergenic
973852358 4:54973814-54973836 TCCCTGTAGAGGCATCCCTGAGG + Intergenic
976364051 4:84213576-84213598 ACTTTATAGAAGGATCCCTTTGG - Intergenic
977925110 4:102691846-102691868 ACTTAGCTGAGGCATCCTTCTGG - Intronic
980585243 4:134805438-134805460 ACTTTGTAGGGCCAACCCACTGG - Intergenic
981080132 4:140631524-140631546 AATTTCTAGAGGGATCTCTCTGG + Intronic
981653901 4:147090335-147090357 GCTTTTTAGAGGTATCACTCAGG - Intergenic
982058001 4:151572485-151572507 ACTTGGTAGAGGTCTCCCTGTGG + Intronic
982183762 4:152775575-152775597 AGCTTCTAGAGGCTTCCCTCAGG + Intronic
983112541 4:163771181-163771203 ATTTTGTGGTGTCATCCCTCAGG + Intronic
983309846 4:166045577-166045599 ACATTGTAAAAGCATCACTCTGG - Intronic
990902273 5:60765280-60765302 ACTTAGTAGCAGCATTCCTCTGG + Intronic
990966644 5:61455545-61455567 ACTTAATAGATGCATCCTTCTGG - Intronic
994639509 5:102389354-102389376 ACTATGTAGAGGTTTCCCTCAGG - Intronic
995582106 5:113613178-113613200 ACTTTCTGGGGGCATTCCTCTGG - Intergenic
998373652 5:141677651-141677673 ACTTTATAAAGGGATCCCCCTGG - Intronic
1001735746 5:173998160-173998182 ACTTTTTAGCTGCATCCTTCTGG - Exonic
1001747688 5:174104318-174104340 ACCTTATAGACGAATCCCTCTGG - Exonic
1002655562 5:180744054-180744076 TCCTGGGAGAGGCATCCCTCTGG - Intergenic
1003624841 6:7731300-7731322 ACCTTGGAGAGGTATCCTTCAGG + Intronic
1008171930 6:48218434-48218456 ACTTTTAAAAGACATCCCTCAGG - Intergenic
1011155494 6:84325660-84325682 ACTTTGAAAAGGCATCCTTATGG - Intergenic
1013830992 6:114272687-114272709 AATTTGTAGAGGAATCCCAGGGG - Intronic
1014893575 6:126872159-126872181 ACTTTTGAGAGGTATCACTCTGG + Intergenic
1017828521 6:158102091-158102113 TCATTGTATAGGCGTCCCTCAGG - Intergenic
1018660737 6:166084748-166084770 AATATGTACAGTCATCCCTCAGG - Intergenic
1021438811 7:20653737-20653759 AGTCTGTATGGGCATCCCTCAGG + Intronic
1021653407 7:22853124-22853146 GCTTTGTTAAGGCATCCCTAGGG - Intergenic
1023921582 7:44634189-44634211 ACTTTGTGCAGGAATCGCTCCGG - Intronic
1026823307 7:73564441-73564463 GGTTTTTAGAGGCAGCCCTCAGG + Intergenic
1039797875 8:40930855-40930877 ACATTTTAGAAGCATCACTCTGG - Intergenic
1042305262 8:67324507-67324529 GCTTTATAGAGGAATCACTCTGG - Intronic
1042683662 8:71414085-71414107 ACTATGTAGGGCCTTCCCTCTGG - Intronic
1044086288 8:87945850-87945872 ACATTTTAGAGGCTTCCCCCTGG + Intergenic
1044916099 8:97113995-97114017 TCTTTCCAGAGCCATCCCTCTGG + Intronic
1047991627 8:130292421-130292443 GCTTTGTAAAGCCTTCCCTCTGG - Intronic
1054457272 9:65440152-65440174 ACTTTTTAGAGGTATTCTTCTGG - Intergenic
1062106295 9:134756787-134756809 AGTTTGTCCAGGCATTCCTCTGG - Exonic
1188084679 X:25888788-25888810 ACTTTGTTATGGCAGCCCTCGGG + Intergenic
1189158562 X:38785956-38785978 ACTTTGTTATGGCATCCCTAGGG + Intergenic
1190849365 X:54223683-54223705 CCTTAGTGGAGACATCCCTCTGG - Intronic
1197870886 X:131061362-131061384 ACTTGGGAGAGGCATCACTGAGG + Intronic
1201373118 Y:13286689-13286711 ACTTGGTAGAGCCGACCCTCGGG - Intronic
1201437663 Y:13976952-13976974 TCATTGTAGTGGCATCTCTCTGG - Intergenic
1201558309 Y:15288159-15288181 ACTATGAGGTGGCATCCCTCTGG - Intergenic