ID: 924594575

View in Genome Browser
Species Human (GRCh38)
Location 1:245434382-245434404
Sequence CTTGCAGCCCAGCTGGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 263}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924594575 Original CRISPR CTTGCAGCCCAGCTGGACCC TGG (reversed) Intronic
900226646 1:1536218-1536240 CTTGGAGCAGAGCTGGACACAGG + Intronic
900255953 1:1698305-1698327 CTTCCAGCCCTGCTGGCCCCGGG + Intronic
900264621 1:1750915-1750937 CTTCCAGCCCTGCTGGCCCCGGG + Intergenic
900436632 1:2634139-2634161 CCTCCAGCCAGGCTGGACCCTGG - Intergenic
900480521 1:2895952-2895974 CTTGCTTCCCAGCTGGCCCAGGG + Intergenic
900482424 1:2905597-2905619 CTGGCAGGTCAGCTGGGCCCTGG - Intergenic
900542923 1:3212967-3212989 CTGGCAGCAGAGCTGGACACAGG + Intronic
900562012 1:3311866-3311888 TTTGCAGCCCCTCTGGACCCAGG - Intronic
900766966 1:4512268-4512290 CCTGTTGCCCAGGTGGACCCAGG + Intergenic
900882697 1:5393354-5393376 CTCGAAGACCAGCTGGACTCAGG - Intergenic
900960315 1:5914950-5914972 CTGGCAGCACAGCTAGGCCCAGG - Intronic
901217602 1:7563390-7563412 CCTGCAGCACAGCAGGACCTGGG + Intronic
901769506 1:11523095-11523117 CTTGCAGCCCCGCTGGGTTCTGG - Intronic
903409000 1:23124308-23124330 CTTGAAGCAAAGCTGGACCTAGG + Intronic
905307840 1:37031828-37031850 CTTGAACCCCAGCTGGAGCCAGG - Intronic
905324485 1:37141066-37141088 CTTCCAGGCCAGTTGGAGCCAGG + Intergenic
905806014 1:40878040-40878062 CTTCCAGCCCAGCAAGAGCCAGG - Intergenic
906212436 1:44019664-44019686 GCAGCAGCCCAGCTGGGCCCTGG + Intronic
907305028 1:53508566-53508588 CCCGCAGCCCAGGTGGAACCAGG - Intronic
911861878 1:102961901-102961923 CTTTCAGTCCAGGTGCACCCTGG + Exonic
912315900 1:108667513-108667535 CTTGCAGGCCAGCTGGAGTTCGG + Intergenic
914830260 1:151165866-151165888 CTTGCCGCTCAACTGGATCCAGG - Exonic
915318656 1:155043940-155043962 GGGGCAGCCCAGCTGGACACTGG - Intronic
915826651 1:159085223-159085245 CTTGCAGCCCAGATGGACACAGG - Intronic
916212838 1:162372735-162372757 ATCCCAGCCCAGCTGGAGCCTGG + Intronic
916611599 1:166397103-166397125 CTTGCAGCCCAGTAGGCCCCTGG + Intergenic
917959022 1:180127949-180127971 CTTCCAGCTCAGCTGTGCCCAGG + Intergenic
917974981 1:180232709-180232731 CTTGCAGCACATCTGGCCTCTGG + Intronic
918824244 1:189301184-189301206 TTTACAGCACAGCTGCACCCAGG + Intergenic
919879721 1:201893619-201893641 CCTGCAGCCCAGCTGGGTTCTGG + Intergenic
920340047 1:205269906-205269928 CCTGCAGCCCAGCCGGACGTGGG + Intronic
920458151 1:206116696-206116718 CTTGCGGCCCAGCTGGCCCAGGG + Exonic
920517836 1:206599690-206599712 ACTGTAGCCCAGCTGGCCCCAGG - Intronic
920997922 1:211013081-211013103 CTTGCTGTCCAGCTGGAAGCAGG - Intronic
922243667 1:223774167-223774189 CAGGCAGGCCAGGTGGACCCTGG - Intronic
922575837 1:226660100-226660122 CTGGCAGCCTGGCTGGCCCCAGG + Intronic
922730289 1:227945860-227945882 CCAGCAGCCCAGATGGAACCTGG + Intronic
922778251 1:228227546-228227568 CTAGCAGCCCTCATGGACCCAGG - Intronic
922808236 1:228401572-228401594 TTTGTAGTCCAGCTGGCCCCAGG - Intronic
923299825 1:232630418-232630440 CGGGCAGCCTACCTGGACCCCGG + Intergenic
924594575 1:245434382-245434404 CTTGCAGCCCAGCTGGACCCTGG - Intronic
1062975359 10:1678731-1678753 CTTACTGCCCAGCTGCACCTCGG - Intronic
1063425787 10:5949109-5949131 CGTGCAGCACAGCTGGAGACAGG + Intronic
1063537651 10:6900813-6900835 TTAGCAGCTCAGCTGGTCCCTGG + Intergenic
1063998024 10:11639706-11639728 ATTCCAGGGCAGCTGGACCCTGG - Intergenic
1064141282 10:12792645-12792667 AATGCAGCCCAGCTGAACGCTGG - Intronic
1064442808 10:15369882-15369904 CCTGCAGCCCTGCAGAACCCCGG - Intronic
1064790369 10:18951540-18951562 CAGGCAGCCCTGCTGGCCCCAGG - Intergenic
1064869857 10:19925195-19925217 ATTGCAGCTCAGCTGGAACCAGG + Intronic
1067346981 10:45444052-45444074 CCTGCTGCCCAGCTGCCCCCTGG - Intronic
1067547395 10:47203672-47203694 GTTACAGCCCAGATGTACCCTGG - Intergenic
1070724208 10:78777439-78777461 CCTGCCCCCCAGCTGGACCCTGG + Intergenic
1073232798 10:101986708-101986730 CCTGCTGCCCAGCTGGAAGCAGG + Intronic
1075604095 10:123791929-123791951 CTTGCTGCGCAGCTGAACCCAGG + Intronic
1075687384 10:124373746-124373768 CTTCAAGCCCAGCTGGACCCAGG - Intergenic
1076441859 10:130485716-130485738 CTTGCCTCCCAGCTGGGGCCAGG + Intergenic
1076749123 10:132533435-132533457 CTTGCAGACTAGGTGGGCCCAGG + Intergenic
1077373478 11:2194510-2194532 CCTGCCGCCCAGCTGGATCTGGG + Intergenic
1077889007 11:6405390-6405412 GCTGCAGCCTAGCTGGGCCCTGG - Intronic
1078715413 11:13834672-13834694 CTTTCAGACCACCAGGACCCTGG + Intergenic
1082010513 11:47447084-47447106 CCTAAAGCCAAGCTGGACCCTGG - Intronic
1082023243 11:47552620-47552642 CTGGCTGCCGTGCTGGACCCAGG - Intronic
1082738450 11:56883503-56883525 CTTGGAGACCATCTGGTCCCTGG + Intergenic
1083341002 11:61958309-61958331 CCTCCAGCCCAGCAGGGCCCTGG - Intronic
1083709852 11:64541239-64541261 GTCCCAGCCCAGCAGGACCCGGG - Intergenic
1083814113 11:65122390-65122412 CCCGCAGCCCCGCTGGACACCGG - Exonic
1084706830 11:70820594-70820616 GTTGGAGCGCAGCAGGACCCGGG + Intronic
1084955630 11:72689780-72689802 CCTGCAGCCCAGTTGGTTCCAGG - Intronic
1085454810 11:76659830-76659852 CTGGCAGCCCAGCTGCACCAGGG - Exonic
1086334415 11:85785322-85785344 CAAGCAACACAGCTGGACCCAGG + Intronic
1087486419 11:98763733-98763755 CTTGCAGGCCAGCTGGAGTTCGG - Intergenic
1089188981 11:116640797-116640819 CTTTCAGCCCATATGGGCCCTGG - Intergenic
1089331855 11:117694863-117694885 CTTGCCACCCACCTGCACCCTGG - Intronic
1097087150 12:56477140-56477162 GTTGCTGCCCAGCTGCTCCCAGG + Exonic
1097128953 12:56796101-56796123 CAGGCAGCCCTGCTGGCCCCGGG - Intergenic
1097181261 12:57173321-57173343 CTTGCAGCCAAACTTGACACTGG - Exonic
1098146416 12:67502314-67502336 CTGTGAGCTCAGCTGGACCCTGG + Intergenic
1101363495 12:104049926-104049948 CTTGCAGCTCTTCTGGACCGAGG - Exonic
1103445688 12:120993874-120993896 CTCGCAGCCCCCCTGCACCCTGG + Intronic
1103535791 12:121633096-121633118 CATGGAGCCCAGCAGGAGCCAGG + Intronic
1104105812 12:125657899-125657921 ACTGCAGCACATCTGGACCCTGG - Exonic
1104648248 12:130512191-130512213 TTTGCAGCCCAGCTCGTGCCAGG + Intronic
1104739270 12:131160971-131160993 CTTGCAGCAGACCTGGACTCAGG + Intergenic
1104895757 12:132162925-132162947 CTCCCAGCCCAGCTGGCTCCCGG + Intergenic
1105279422 13:18954537-18954559 CTTCCAGCCCAGCCCCACCCAGG + Intergenic
1105475983 13:20728564-20728586 CTCGCAGCCCACCTAGAACCTGG + Intergenic
1111747675 13:92290987-92291009 CTGCCAGCCCCGCTGGCCCCAGG + Intronic
1114598005 14:23930762-23930784 CTTTCTTCCCTGCTGGACCCAGG - Intergenic
1119575279 14:75715314-75715336 CTTGCAGCCCAGGGGTAGCCAGG - Intronic
1119970988 14:78970444-78970466 CTTGCAGCACACCTCAACCCAGG + Intronic
1121219589 14:92275564-92275586 CTCACAGCCCAGCTGAAACCAGG - Intergenic
1122660985 14:103294443-103294465 GTTCTGGCCCAGCTGGACCCGGG - Intergenic
1123112227 14:105878329-105878351 CTTGCAGCCGACCTGGGCCTTGG + Intergenic
1124999117 15:34753251-34753273 CCTGCAGCCCGGCTGTAACCAGG - Exonic
1125207302 15:37168351-37168373 CATGCAGCCAAGCTGAACCAAGG + Intergenic
1128508996 15:68302159-68302181 CCTGCTGCCCAGCTGCAGCCAGG + Exonic
1128720484 15:69944017-69944039 CCTGCAGCCCAGCTGTCTCCAGG - Intergenic
1129153334 15:73702779-73702801 CTCGAAGCCCAGCATGACCCTGG + Exonic
1129153646 15:73704183-73704205 CTCGAAGCCCAGCATGACCCTGG + Exonic
1129255775 15:74333209-74333231 TTTCCATCCCAGGTGGACCCCGG + Intronic
1131461181 15:92618461-92618483 CTAGGAACCCACCTGGACCCAGG - Exonic
1132091562 15:98951593-98951615 GTTGCAGCCCAGCTGTCCGCCGG + Intronic
1132689616 16:1176682-1176704 CTTGGTGCCCAGCCGGCCCCCGG - Intronic
1132841424 16:1980066-1980088 CCTGCAGCCCTTCTGTACCCAGG - Exonic
1132861475 16:2073792-2073814 CTGGCAGGCCATCTGGCCCCGGG + Intronic
1132982013 16:2743101-2743123 CTTGCCAGCCAGCTGGACGCTGG + Intergenic
1133742359 16:8661095-8661117 CTTGCGTCCCTGCTGGCCCCTGG + Intergenic
1134289809 16:12894942-12894964 CTTGCAGGCCAGCTGTGTCCAGG - Intergenic
1137620102 16:49870497-49870519 CTGTCAGGACAGCTGGACCCTGG - Intergenic
1137629158 16:49930083-49930105 CCTTCAGCACAGCTGGACCAAGG - Intergenic
1137768591 16:50996657-50996679 CCTGCAGCCCACCTGGGCACTGG - Intergenic
1137947034 16:52743427-52743449 CTTGCAACACAGCTTGACCCAGG + Intergenic
1138363257 16:56451157-56451179 CTCGCAGACCGGCTGGCCCCGGG - Exonic
1138512224 16:57515330-57515352 CCTGCAGTCCAGGTGGGCCCCGG - Exonic
1139391600 16:66609210-66609232 ACAGCAGCCCCGCTGGACCCGGG + Intronic
1141252069 16:82368198-82368220 CTCACAGCCCAGCTGGAGCTGGG - Intergenic
1141331522 16:83115857-83115879 CTTTCTGCCCTCCTGGACCCTGG - Intronic
1141962950 16:87421521-87421543 CTTGCAGCCCAGCCTGATCCTGG - Intronic
1143400593 17:6639985-6640007 CTTGCAGCCTCGATGGAGCCTGG + Intronic
1143736050 17:8912743-8912765 CTAGCCGCGCAGCTGAACCCAGG - Intronic
1145782357 17:27571479-27571501 CTTCCAGCCCCGCTGGGCTCTGG + Intronic
1145885783 17:28381627-28381649 CTTGTGGCCTCGCTGGACCCTGG + Exonic
1146693573 17:34892885-34892907 CCCGCACCCCAGCTGTACCCCGG + Intergenic
1147423096 17:40332217-40332239 CCTGGCGCCCAGCTGGGCCCTGG - Intronic
1148128727 17:45249943-45249965 CTTGGAGCCCTGCTGGTGCCTGG + Intergenic
1148808728 17:50277522-50277544 CTTGGAGCCCAACTGACCCCTGG - Intronic
1149654138 17:58301570-58301592 CTTTCGGCCCCGCTGGCCCCAGG + Intronic
1152687689 17:81702694-81702716 GTTTCAGCCCCGCTGGCCCCCGG - Intronic
1152783417 17:82236363-82236385 GTTGCTGCCCAGCAGGATCCTGG - Intronic
1154123363 18:11669612-11669634 CTCACAGCCCTGCTGGACCAAGG - Intergenic
1154305955 18:13231073-13231095 CCTGCAGCCCCGCAGCACCCTGG - Intronic
1154309404 18:13255568-13255590 CTCCCATCCCACCTGGACCCTGG - Intronic
1155872308 18:31043050-31043072 CTGGCAGCCCAGATCGTCCCAGG + Intergenic
1160443777 18:78912132-78912154 CTTGGTGCCCAGCTGGTCCTTGG + Intergenic
1160511350 18:79455353-79455375 CTGGCAGGCCAGCTGGGGCCTGG + Intronic
1161043050 19:2120350-2120372 CCTGCGGCCCACCTGGAACCTGG + Intronic
1161132750 19:2601247-2601269 CAGGCATCCCAGCTGTACCCCGG - Intronic
1161454124 19:4361771-4361793 CTTGCAGCTCGGCTGGTCCAGGG + Exonic
1162024871 19:7888278-7888300 TTTGCAGTCTGGCTGGACCCTGG - Intergenic
1162723111 19:12674129-12674151 TCTGCAGCCCAGCCTGACCCCGG - Intronic
1162798097 19:13096811-13096833 GCTGCAGGCCAGCTGGGCCCGGG + Intronic
1164564847 19:29318485-29318507 CTTGAATCCCATCTGCACCCTGG + Intergenic
1164806263 19:31119406-31119428 CTTGAAGCCCAGCTGCATTCTGG - Intergenic
1165228156 19:34368579-34368601 CGTGCAGCACGGCTCGACCCTGG - Exonic
1165448425 19:35869158-35869180 CTTGCAGCCTCCCAGGACCCAGG + Intronic
1165461121 19:35944961-35944983 CTCGCAGTCCAGCTGGACCACGG - Exonic
1166303020 19:41922717-41922739 CCCCCAGCCCGGCTGGACCCCGG - Intronic
1166719853 19:44990638-44990660 AGTGTGGCCCAGCTGGACCCTGG + Intronic
1168294712 19:55373050-55373072 CTTGCTCCCCAGCTGGCCCCAGG - Intergenic
925041549 2:735141-735163 CTCTCTGCCCAGCTGGGCCCAGG + Intergenic
925259878 2:2520076-2520098 CTTGCAACCCAGCACGACTCAGG + Intergenic
928940702 2:36724576-36724598 TTTGCAGACCAGCTGTCCCCTGG + Intronic
929586861 2:43121784-43121806 CTTCCATCCCATCTGGAACCAGG - Intergenic
931867304 2:66426419-66426441 CTTTCTCCCCAGCTGGACTCGGG - Intergenic
932837322 2:75049705-75049727 CTTGAAGCCCAGACGGAACCTGG + Exonic
932873736 2:75429427-75429449 CTTGCAGCACTGGTGGTCCCAGG - Intergenic
933748716 2:85589393-85589415 CCTGGAGCCAAGATGGACCCAGG - Intronic
935934371 2:108165974-108165996 CATGCAGCACAGCTGGGCTCTGG + Intergenic
938097469 2:128473122-128473144 CTTCCATCCCCGCAGGACCCAGG + Intergenic
946434132 2:219640817-219640839 GATGCAGCCCAGCTGGATGCAGG - Exonic
948247537 2:236499146-236499168 CATGCAGCCAACCTGGACTCAGG - Intronic
948516015 2:238504488-238504510 CGGGCAGCCCAGCTGGCCCGAGG - Intergenic
948567970 2:238898447-238898469 CTTGCTACCCAGTTGGTCCCTGG - Intronic
948606262 2:239137530-239137552 CTTGAAGGCCCCCTGGACCCAGG - Intronic
948807753 2:240460305-240460327 CCTCCTGCCCAGCTGGACCCGGG + Intronic
948825362 2:240571196-240571218 CTTGCTGCCCAGCAGGGCCAGGG + Intronic
1168849609 20:967464-967486 CATGCAGCCCAGTTTGACCTTGG - Intronic
1169300763 20:4440285-4440307 CTTGCATCTCAGCTGCATCCTGG - Intergenic
1170981786 20:21221014-21221036 CCAGCAGCCCAGCTGGGCTCAGG - Intronic
1171144789 20:22772143-22772165 CTTGTGGAGCAGCTGGACCCTGG - Intergenic
1173250879 20:41363682-41363704 CCTTCAGGGCAGCTGGACCCAGG - Exonic
1173852706 20:46228784-46228806 CATGCAGCCCTGCTGGCCCAGGG - Intronic
1174384605 20:50179674-50179696 CCTGAAGTCCAGCTGGAGCCTGG + Intergenic
1175401738 20:58703901-58703923 TCTGCAGACCAGGTGGACCCCGG - Intronic
1175737995 20:61400443-61400465 CTTGCAGCCTAGATGATCCCCGG + Intronic
1176069996 20:63221283-63221305 CCTGCAGACCAGCAGGACCGGGG - Intergenic
1176121673 20:63456888-63456910 CTGGGAGCCCAGCAGGGCCCCGG + Intronic
1177748371 21:25250161-25250183 ATTGCAAGCCAGCGGGACCCTGG + Intergenic
1177929068 21:27257511-27257533 CTTGCAGGTCAGCTGGAAGCTGG - Intergenic
1179100446 21:38351467-38351489 CTTGCTGCCCAGCATGTCCCAGG + Intergenic
1179417350 21:41209078-41209100 GTTGCAGCCCATGTGCACCCTGG + Intronic
1179709574 21:43205531-43205553 CCAGCAGCCCAGCTGGAGCCTGG - Intergenic
1180784323 22:18538502-18538524 CTGGCGGCCCAGCTGGTCCCGGG + Intergenic
1181054379 22:20253144-20253166 CTTCCAGCCCAGATGCAGCCAGG - Intronic
1181109348 22:20592130-20592152 CTAGCCTCCCAGCTGGTCCCCGG - Intergenic
1181127898 22:20712555-20712577 CTGGCGGCCCAGCTGGTCCCGGG + Exonic
1181241226 22:21477859-21477881 CTGGCGGCCCAGCTGGTCCCGGG + Intergenic
1181499129 22:23305837-23305859 CTTGCAACCCAGGGGGACCCTGG + Intronic
1182452511 22:30429745-30429767 CTTGCAGCCCAGGTGCAGTCAGG + Intergenic
1182843904 22:33415138-33415160 CCTGCAGCCCAGCTGCACAAAGG + Intronic
1183180705 22:36257912-36257934 CTTCCAGCTTAACTGGACCCCGG + Intronic
1183706391 22:39477259-39477281 CTTGCAGGCCCTCTGGACCCAGG + Intronic
1184259889 22:43308711-43308733 CCTGGAGCCCAGCTGCACCCTGG - Intronic
1184512969 22:44943798-44943820 CATCCAGCCCAGCGGCACCCTGG + Intronic
1184752055 22:46492143-46492165 CCTGCAGACCTGCTGGAGCCTGG - Intronic
1184947366 22:47813162-47813184 CTCGCAGACCACCTGCACCCAGG - Intergenic
1185214348 22:49589919-49589941 CTGGCAGTCCAGCGGGACACAGG + Intronic
949876078 3:8626855-8626877 CTTCAGGCCCAGCTGGATCCGGG - Intronic
953449717 3:42996049-42996071 TTTGCAGCCCTGCTAGCCCCAGG - Intronic
954135208 3:48579250-48579272 CATCCAGCCCAGGGGGACCCCGG + Exonic
954458931 3:50615288-50615310 ATTTATGCCCAGCTGGACCCAGG - Intronic
954578851 3:51692127-51692149 TTGGCAGCCCTGCAGGACCCTGG + Intronic
955227598 3:57073856-57073878 CTGGCAGGACACCTGGACCCTGG - Exonic
956343016 3:68247552-68247574 CTTACAGCCCTGCAGCACCCGGG - Intronic
957056172 3:75444675-75444697 CTGCCAGCCCCGCTGGACCCAGG - Intergenic
957615475 3:82520688-82520710 CTTGCAGTCCAGCTGGCCTCAGG - Intergenic
960989813 3:123303184-123303206 CAAGCAGCCCAGCAGGTCCCTGG + Exonic
961382032 3:126501343-126501365 CCTGCACCCCAGCTGCACACAGG + Intronic
961619870 3:128215691-128215713 CTTTAAGCACAGCTGGATCCAGG + Intronic
962847858 3:139287026-139287048 GGTCCAGCCCAGCTGGACTCAGG + Intronic
963530534 3:146469305-146469327 CAGGCGGCCCAGCTGTACCCTGG - Intronic
963988877 3:151630115-151630137 CTGGCAGCCCAAGTGGGCCCTGG + Intergenic
964041788 3:152269356-152269378 TTGGCAGCCCAGCGGGACCCAGG + Intronic
965007715 3:163046117-163046139 CTCACAGCCCACCTGCACCCAGG - Intergenic
965561260 3:170064217-170064239 CTTTCAACCCAGCAGGACGCGGG - Intronic
967920050 3:194607832-194607854 CTGCCAGCCCAGCTGGACAGTGG + Intronic
968517238 4:1020582-1020604 CTTCCAGCCCAGAGGCACCCAGG + Intronic
969385635 4:6845103-6845125 CTTCCAGCCCAGCATGACCATGG + Intronic
971231901 4:24806860-24806882 AGTGCAGCCCAGAAGGACCCAGG - Exonic
972971803 4:44585457-44585479 CTTGCAGGCCAGCTGGGCGCAGG + Intergenic
975599765 4:76086996-76087018 CTGTCAGCCCAGCTGCAGCCGGG - Intronic
977112671 4:92978820-92978842 GTTGCAGCCCAACTGGTCTCGGG - Intronic
978126997 4:105146744-105146766 CTTGCATGCGAGCGGGACCCGGG - Exonic
978719414 4:111889807-111889829 AATGCAGCCCAGCTGGAACCTGG + Intergenic
980562962 4:134501909-134501931 CCTGCAGCCCACCTGGCCCGAGG + Intergenic
981727362 4:147861930-147861952 CTGGCAGCCCAGCGGCTCCCAGG + Intronic
982738789 4:159036296-159036318 CTTGTAGCCCAGCTGGAGGAAGG + Intronic
985575394 5:671325-671347 CTTGGGGCCCAGAGGGACCCCGG + Intronic
985653275 5:1116887-1116909 TTTTGAGCCCATCTGGACCCTGG - Intergenic
985681334 5:1257357-1257379 CAAGCACGCCAGCTGGACCCTGG + Intronic
985723671 5:1504337-1504359 CCTTCAGCCCACCTGGTCCCGGG + Intronic
986318623 5:6609411-6609433 CTTGCAGCCAAGGTGAACCCGGG + Intronic
986851152 5:11815992-11816014 TCTGCAGCCCAGCTGGCCACGGG - Intronic
988898291 5:35702146-35702168 CTTCCAGACCAGCAGGATCCTGG + Intronic
990810050 5:59713672-59713694 CTTGCAGCACAGCTGTGACCAGG - Intronic
997975176 5:138437751-138437773 CTTTCAGCCCAGATGGGCACAGG + Intergenic
998389758 5:141779898-141779920 CTGACAGCCCAGCTGGGCCTGGG - Intergenic
1002080631 5:176735200-176735222 CTTCAGGCCCAGCTGGATCCAGG - Intergenic
1002593387 5:180306330-180306352 ATGGCAGCCCAGCTGGGCCACGG + Intronic
1006642370 6:35496034-35496056 TTTCCAGCCCAGCTGGGCCCTGG - Intronic
1007078713 6:39084068-39084090 CTTGCAGTCCTGCTTGTCCCTGG - Intronic
1007262754 6:40575297-40575319 CTTGCAGCCCAGGAGCACCTCGG - Intronic
1007574484 6:42916200-42916222 CCTGCAGCCCATCAGTACCCAGG - Intronic
1013275250 6:108578898-108578920 CTTGCACCACAGGTGGAACCAGG + Intronic
1019433543 7:1010615-1010637 CCTGCAGCCCAGGGGGAGCCAGG - Intronic
1019578203 7:1747684-1747706 CCTGGAGCCCTGCTGGACTCAGG + Exonic
1020035880 7:4962839-4962861 CCTGGAGCCCAGCTGGGCTCTGG + Intergenic
1020127827 7:5542797-5542819 TGTGCAGCCCAGGTGGCCCCAGG - Intronic
1023993885 7:45146828-45146850 CCTCCACCCCAGCTGGCCCCAGG - Intergenic
1023999061 7:45179042-45179064 CCTCCACCCCAGCTGGACACTGG + Intronic
1026286600 7:68969003-68969025 CTTGCAGCCATGCTCTACCCAGG - Intergenic
1026605138 7:71809312-71809334 CTTGGAGCTGAGCTGGTCCCAGG - Intronic
1027359927 7:77397666-77397688 ATTGGAGCCCAGCTAGATCCAGG + Intronic
1028173433 7:87627688-87627710 GGAGCAGCCCAGCTGGACCGAGG + Intronic
1028338793 7:89692536-89692558 CTGGCAGGGCAGCTGGAGCCTGG + Intergenic
1031964785 7:128019862-128019884 CTGGCAGCCCAGGTTGACTCAGG - Intronic
1032019427 7:128398813-128398835 CTTTCAGCCCAGCAGGTTCCTGG + Intronic
1032197596 7:129798526-129798548 CACCCAGCCCAGCTGGCCCCAGG - Intergenic
1032397820 7:131603252-131603274 CTTGCAGCTCAAGTGGAGCCAGG + Intergenic
1034466911 7:151235204-151235226 CCTGCATCCCTGCTGGAGCCCGG - Exonic
1035022645 7:155808494-155808516 GTCGCGGCCCGGCTGGACCCGGG - Intronic
1035273696 7:157734812-157734834 CTGGCTGCCCTGCTGGTCCCGGG - Intronic
1035678123 8:1469122-1469144 CTCACATCCCAGCTGGACACGGG - Intergenic
1036378255 8:8218993-8219015 CTGCCAGCCCCGCTGGACCCAGG + Intergenic
1037742157 8:21616446-21616468 CTTCGAGTCCAGCTGGACCATGG - Intergenic
1038178397 8:25202579-25202601 CATCCAGCCCAGCAAGACCCTGG - Intronic
1040582290 8:48707767-48707789 AGTGCACCCCAGCTAGACCCCGG - Intergenic
1042039612 8:64578081-64578103 CTGCCAGCTCAGCTAGACCCAGG - Intergenic
1042042440 8:64607010-64607032 CTGACAGACCAGCTGGGCCCTGG + Intronic
1042561124 8:70072417-70072439 CTTGCAGCCCCGCCGCGCCCTGG - Intergenic
1044906233 8:97006736-97006758 CTGGCAACCCAGGAGGACCCAGG + Intronic
1047786851 8:128161785-128161807 CCTGCAGCTCAGCTGGACACAGG - Intergenic
1048866197 8:138763572-138763594 CTTGCAGCCCACCTGGAAGAAGG - Intronic
1049179948 8:141217130-141217152 CCAGCAGCCCATCTTGACCCCGG + Exonic
1049705426 8:144040006-144040028 CTTGCAGCCCAGCGCCACACCGG + Exonic
1049844033 8:144791480-144791502 CTTGCAGCCCAGCTCAACATTGG - Exonic
1051658809 9:19407821-19407843 CTGACTGCCCAGCAGGACCCTGG - Intergenic
1052454521 9:28678254-28678276 CTTTCAGCACAGATGGAGCCTGG - Intergenic
1052626980 9:30988155-30988177 CTTGCAGTCCATCTGGACCGTGG - Intergenic
1053547928 9:39042618-39042640 CGGGCAGCCCTGCTGGCCCCGGG - Intergenic
1057125665 9:92614143-92614165 CTTGCAGCCCTGAAGGACCTAGG + Exonic
1057131324 9:92656337-92656359 CTTGGAGACTAGCTGGACGCGGG + Intronic
1058425569 9:104873008-104873030 CTTACAGCCCAGCTGGGCCCAGG + Intronic
1059642116 9:116227511-116227533 CCTGCAGCCCATCAGGACACTGG + Exonic
1060812662 9:126618878-126618900 CTTGCACCCCAGCGGGTCTCGGG - Intronic
1061328013 9:129875678-129875700 TTTCCTGCCCAGCTGGGCCCTGG - Intronic
1061889850 9:133612950-133612972 CTTGCAGCACAGCTGGCACCCGG + Intergenic
1061958130 9:133974187-133974209 CTTGCGGCCCAGGAGGACACAGG - Intronic
1062044384 9:134418312-134418334 CCTGAGGGCCAGCTGGACCCAGG - Intronic
1062464015 9:136673335-136673357 CCTGGAGCCCAGCTGCACCCTGG + Exonic
1062536454 9:137023203-137023225 CCTGTAGCCCAGCTGGGGCCAGG - Intronic
1187823610 X:23313555-23313577 CTTGTATCCCAGCTGGGGCCTGG - Intergenic
1187961685 X:24571986-24572008 TATGCAGCCCATCTGGCCCCAGG - Intronic
1190407412 X:50101649-50101671 CTTTCAGCTCAGCTGGGCTCTGG - Intergenic
1192784224 X:74321832-74321854 CTTGCAGCCCAGCTAGGCAGGGG - Intergenic
1195799136 X:108687504-108687526 CTTGCAATCCATCTGGACCAGGG - Exonic
1198223576 X:134625186-134625208 CCTGGAGCCCAGCTGCAACCTGG - Intronic
1198236274 X:134738514-134738536 TTTCCAGCCCCCCTGGACCCAGG + Intronic
1198299948 X:135325492-135325514 CTTGCAGGCCAGCTGAGCTCCGG + Intronic
1199340337 X:146670076-146670098 CTTGGAGTGCTGCTGGACCCTGG + Intergenic
1199718772 X:150526885-150526907 CTTGCAGCCCAGCCAGCGCCAGG - Intergenic