ID: 924596213

View in Genome Browser
Species Human (GRCh38)
Location 1:245447181-245447203
Sequence ATGTTAATTCAGATGGGCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924596213_924596217 -5 Left 924596213 1:245447181-245447203 CCGTGGCCCATCTGAATTAACAT 0: 1
1: 0
2: 2
3: 10
4: 169
Right 924596217 1:245447199-245447221 AACATCTTCTGCGGTGCTTTAGG 0: 1
1: 0
2: 0
3: 8
4: 105
924596213_924596219 27 Left 924596213 1:245447181-245447203 CCGTGGCCCATCTGAATTAACAT 0: 1
1: 0
2: 2
3: 10
4: 169
Right 924596219 1:245447231-245447253 ACAAAGTCACTTGAGACTGATGG 0: 1
1: 0
2: 1
3: 12
4: 169
924596213_924596218 -4 Left 924596213 1:245447181-245447203 CCGTGGCCCATCTGAATTAACAT 0: 1
1: 0
2: 2
3: 10
4: 169
Right 924596218 1:245447200-245447222 ACATCTTCTGCGGTGCTTTAGGG 0: 1
1: 0
2: 0
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924596213 Original CRISPR ATGTTAATTCAGATGGGCCA CGG (reversed) Intronic
900736349 1:4301720-4301742 GTGTTCATCCAGAGGGGCCACGG - Intergenic
902067149 1:13698188-13698210 ATGTTAAATCAGAAGTGGCACGG - Intergenic
905508357 1:38498751-38498773 ATTTTAATTAAGGAGGGCCAGGG - Intergenic
906949474 1:50322870-50322892 ATGTTTATCCTGATGGGTCAGGG + Intergenic
907600726 1:55766634-55766656 GTCTTAACTCAGCTGGGCCATGG - Intergenic
910031975 1:82737299-82737321 ATGTTTATGCAGATGTGCTAGGG - Intergenic
911957976 1:104262124-104262146 ATGTTATTTCAGATGGCACGAGG + Intergenic
913016196 1:114738193-114738215 ATGTTAATGCTGCTGGTCCAGGG - Intronic
916974265 1:170058709-170058731 ATGCTAAATCAGATGGGCTGAGG + Intronic
917524784 1:175778504-175778526 TTGTTTTTTGAGATGGGCCAAGG + Intergenic
921214071 1:212922382-212922404 ATGTAAAGTCTGATGGGCCTGGG - Intergenic
922846812 1:228692399-228692421 ATGGCAATACAGTTGGGCCAGGG - Intergenic
924596213 1:245447181-245447203 ATGTTAATTCAGATGGGCCACGG - Intronic
1062958937 10:1558430-1558452 ATGTGGATTTAGATGGGGCATGG - Intronic
1062959001 10:1558666-1558688 ATGTGGATTTAGATGGGGCATGG - Intronic
1063785266 10:9376583-9376605 TTGTTAATTAAGAGGGGCCCTGG - Intergenic
1064329542 10:14380652-14380674 CTATTATTTCAGATGGGCCAAGG + Intronic
1064944881 10:20776222-20776244 TTGTTAATTTAAATGGCCCAAGG + Intergenic
1066331035 10:34423197-34423219 ATGTTAAGTGAAATAGGCCAGGG + Intronic
1067541416 10:47157261-47157283 ATGTGAACTCACATGGCCCAGGG - Intergenic
1067541883 10:47160780-47160802 ATGTTCCTTAACATGGGCCATGG + Intergenic
1072400504 10:95094216-95094238 ATTTTAATTCATTTGGGTCATGG - Intergenic
1073110722 10:101061679-101061701 CTGTAAAATCAGATGGGACAGGG + Intergenic
1074666273 10:115729717-115729739 ATTTTATTTGAGATGGGCAATGG - Intronic
1075104457 10:119529131-119529153 ATGTCACTTCAGATGGGGCCAGG + Intronic
1076630687 10:131850224-131850246 AAGTTAATGCAGATGGACCTCGG + Intergenic
1078277208 11:9860993-9861015 ATGTCAACTCAAATGTGCCAAGG - Intronic
1079737726 11:24017824-24017846 ATGGCAATTTAGATGAGCCATGG + Intergenic
1079998306 11:27319824-27319846 AGGTTAATTCAGAGGAGCCTTGG - Intergenic
1085704897 11:78778238-78778260 ATCTTAATTCTGGTGGACCAGGG + Intronic
1086446500 11:86876563-86876585 ATGTCAATTCTGGTGGTCCATGG - Intronic
1088683033 11:112260699-112260721 ATGTATATTCAGAAGGGGCAGGG - Exonic
1090504752 11:127298835-127298857 ATGATATTTTGGATGGGCCAAGG + Intergenic
1091642989 12:2251609-2251631 ATGTTCATTCCCATGGGCCCGGG - Intronic
1093147817 12:15587892-15587914 ATTCTAATTCACAAGGGCCAAGG - Intronic
1096667919 12:53179221-53179243 ATGTTCATCAAGATGGGACAAGG + Intronic
1096710359 12:53451295-53451317 AAGTAACTTCAAATGGGCCAGGG - Intergenic
1097454350 12:59778158-59778180 GTATTAACTCTGATGGGCCATGG + Intronic
1099768711 12:87024320-87024342 ATGTGAATTCATTTGGTCCAGGG - Intergenic
1100275806 12:93070779-93070801 GTGTTAGTTCAGATAAGCCATGG + Intergenic
1108152464 13:47550682-47550704 ATGTTGATTCAAATGTTCCATGG - Intergenic
1109867290 13:68281895-68281917 ATGTTAATTTGGCTGGGCCATGG + Intergenic
1110287987 13:73772424-73772446 AGCTTAATTCAGATGCACCATGG - Intronic
1113510334 13:110849332-110849354 ATGTTAATTAAATTGGCCCATGG - Intergenic
1114371464 14:22093731-22093753 ATTTGAATTCAGAGGGCCCATGG + Intergenic
1114688373 14:24556815-24556837 ATGTTAACTTAGCTGGGCCGTGG - Intergenic
1116791586 14:49345526-49345548 ATGTTAACTTGGGTGGGCCATGG - Intergenic
1117863164 14:60114437-60114459 ATGTTAATTCAAATGTGCAAAGG - Intronic
1120004303 14:79339536-79339558 ATGCTAATGCAGGTGGTCCAGGG - Intronic
1120956868 14:90090602-90090624 ATGATATTTGAGAGGGGCCAGGG + Intronic
1121915205 14:97832220-97832242 GTTTCAATTCAGATGGTCCAGGG - Intergenic
1127803270 15:62495655-62495677 CTGGTATTTCAGATGGGCCCAGG + Intronic
1129595479 15:76960721-76960743 ATTCTGATTCAGATGGTCCAAGG + Intergenic
1130377219 15:83340116-83340138 ATGTCAATTTGGTTGGGCCATGG + Intergenic
1131640619 15:94288673-94288695 ATGTTAACTCACATGGGAAAAGG + Intronic
1132215609 15:100059517-100059539 ATGATTTTTCAGATGGACCACGG - Intronic
1133227379 16:4348217-4348239 ATATTCATTCAGATGCACCAGGG - Intronic
1134111517 16:11518101-11518123 ATGCTAAGTCAGCGGGGCCAGGG - Intronic
1134611222 16:15610019-15610041 ATGTTAATAGATATGGGGCAGGG - Intronic
1136023989 16:27458363-27458385 ATGCTGATGCAGATGTGCCAGGG + Intergenic
1137760296 16:50934976-50934998 AAGTCAGCTCAGATGGGCCAAGG - Intergenic
1139229818 16:65272881-65272903 ATGCTGATTCAGCTGGTCCAAGG - Intergenic
1146340025 17:32010897-32010919 ATGTTAAGTGAAATAGGCCAAGG - Intronic
1146442838 17:32912285-32912307 AAGTTAAGGCAGCTGGGCCAGGG - Intergenic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1148176239 17:45567880-45567902 ATGTTAAGTGAAATAGGCCAAGG + Intergenic
1148195028 17:45707066-45707088 ATGCTAATTCAGAGGCACCAGGG + Intergenic
1148295135 17:46495080-46495102 ATGTTAAGTGAAATAGGCCAAGG - Intergenic
1149026786 17:52036109-52036131 ATGTTGATGCTGCTGGGCCAGGG + Intronic
1150407470 17:64914859-64914881 ATGTTAAGTGAAATAGGCCAAGG + Intronic
1154493611 18:14939899-14939921 GTGTTAATTCTAATGGCCCATGG + Intergenic
1156858747 18:41813037-41813059 ATGTGATTTCAGAGGGGCCAGGG - Intergenic
1157340495 18:46773527-46773549 ATGTCAATTTGGCTGGGCCATGG + Intergenic
1158315256 18:56205097-56205119 ATGTCAATTTAGGTGGACCATGG - Intergenic
1159555620 18:69941812-69941834 ATGAGATTTCAGAGGGGCCAGGG + Intronic
1162591869 19:11597422-11597444 CTGTCCATTCAGATGGGCCCGGG + Exonic
932090848 2:68805070-68805092 ATGATATTTGAGAGGGGCCAAGG + Intronic
932846436 2:75140259-75140281 AAGTTAATTCAGAAAGGCAAGGG + Intronic
937155939 2:119719028-119719050 ATGTTAATGCTGCTGGGCCGTGG + Intergenic
939953188 2:148500422-148500444 ATGTTATTACAGATGGGACTCGG - Intronic
941291015 2:163675095-163675117 ATGTTAACTCAAATGTGGCATGG - Intronic
943717771 2:191171317-191171339 CTGATACTTCAGATGGGCTAGGG - Intergenic
945477131 2:210296897-210296919 ATGTTAAGTAAAATGAGCCAGGG - Intronic
945700925 2:213170177-213170199 AAGTTTATGCAGAGGGGCCAGGG - Intergenic
948392465 2:237622564-237622586 ATGGGAATTCAGATAGCCCATGG + Intergenic
1169326306 20:4679447-4679469 AGGTGAACTCAGATGGGCCAAGG + Intergenic
1170361594 20:15552536-15552558 AGGTAAACTCAGCTGGGCCAAGG - Intronic
1170409389 20:16072378-16072400 AGGTGAACTCAGATGGGTCATGG + Intergenic
1172187272 20:33038847-33038869 ATGTTTGTTAGGATGGGCCAGGG + Intronic
1172374478 20:34426011-34426033 AAGTTAATTCACATAGTCCAAGG - Intronic
1173059594 20:39648578-39648600 ATGTTGATTCAGTGAGGCCATGG - Intergenic
1173308143 20:41871464-41871486 ATGGGAGTTCTGATGGGCCATGG - Intergenic
1173308589 20:41875303-41875325 AGGTCAACTCAGATGGGCCAAGG - Intergenic
1173334394 20:42101103-42101125 ATGTGAACTCAGATGGGCTGGGG + Intronic
1174046112 20:47735060-47735082 ATGGGAATTCAGAGGGGGCATGG - Intronic
1174207227 20:48849469-48849491 ATGTTAGCTCAGCTGGGGCAGGG + Intergenic
1174437239 20:50518195-50518217 ATTTTTATCCAGATGGGCCCCGG + Intronic
1176907318 21:14517939-14517961 ATGTTAATGCCGCTGGTCCAGGG - Intronic
1177222901 21:18217604-18217626 ATGATATTTGAGAGGGGCCAGGG - Intronic
1177838282 21:26209766-26209788 ATGTATATTCAGGTGGGGCATGG - Intergenic
1178896849 21:36565836-36565858 ATGGAAATTCAGAAGAGCCAAGG + Intronic
1181377682 22:22473060-22473082 ATGTTAGTTGAGGTGGGACAGGG + Intergenic
1181448887 22:23002770-23002792 ATGATAATTCAGCAGCGCCAGGG + Intergenic
1183346324 22:37310271-37310293 ATCTTAACTCAGATGGGAGAGGG + Intronic
951803755 3:26624055-26624077 ATGTAAATACAGATGGGGGAGGG + Intronic
954098174 3:48347706-48347728 AGGAGAACTCAGATGGGCCAAGG + Intergenic
959795362 3:110421474-110421496 GTGTCAACTCAGCTGGGCCATGG - Intergenic
960315030 3:116166030-116166052 ATGCTAATTGTGGTGGGCCAGGG + Intronic
960525979 3:118710127-118710149 ATGTTGTTTCAGAAGTGCCAAGG - Intergenic
960843050 3:121979373-121979395 ATGAGATTTCAGAAGGGCCAGGG + Intergenic
960963935 3:123091597-123091619 ATGTCAATCCTGATGGGTCAGGG - Intronic
963538834 3:146561711-146561733 ATGAGATTTCAGAGGGGCCAGGG - Intergenic
967113113 3:186312769-186312791 ATGTCAAAACAGAAGGGCCAGGG + Intronic
968626924 4:1629928-1629950 TGGTTTATTCAGATGGGCCCTGG + Intronic
972646865 4:40976746-40976768 CTATTTATTCAGATGGGGCAAGG + Intronic
973133954 4:46683025-46683047 ATAATAATTCAGCTGGTCCAGGG - Intergenic
974655499 4:64814208-64814230 TTGTAAATTCAAATAGGCCATGG - Intergenic
975003298 4:69253682-69253704 TTGTTACTTCAAATAGGCCATGG - Intergenic
975991699 4:80265395-80265417 AGGTCAATTCAGATGAACCAAGG - Intergenic
977476839 4:97521773-97521795 ATGATAATTAAGTTGGGACATGG - Intronic
978329900 4:107601077-107601099 AATTTAATACAAATGGGCCAAGG + Intronic
980322826 4:131302028-131302050 ATGTTAAGCCACATGGGCTAAGG - Intergenic
980541838 4:134205769-134205791 ATGTTAATTGAAATAGGCCAGGG + Intergenic
980728119 4:136791349-136791371 AGGTTAGTTTAGATGGGACAGGG + Intergenic
981121331 4:141054421-141054443 ATGTTAATATATATGGGCTAAGG - Intronic
982931692 4:161416248-161416270 TTGTTTATTCTGATGAGCCATGG - Intronic
982965452 4:161901145-161901167 ATGTAAATTCAGAAAGGGCAAGG - Intronic
983646201 4:169993914-169993936 TCGCTAATTCAGATGGGACATGG + Intronic
984450049 4:179888321-179888343 ATGGTAATTGAGAGGGGCAAGGG + Intergenic
985012194 4:185594441-185594463 ATGTTAATTCAAATGTAGCATGG - Intronic
986256855 5:6108066-6108088 CTGTGCATTCAGATGTGCCATGG + Intergenic
988858445 5:35252236-35252258 ATGAGATTTCAGAGGGGCCAGGG - Intergenic
989174177 5:38505004-38505026 GTGTTAATGCACATGGACCATGG + Intronic
992730743 5:79665896-79665918 ATGCTACTTCAGATAGGACAAGG - Intronic
994521507 5:100843695-100843717 ATCTTCATTCAGATGGATCATGG - Intronic
994879131 5:105463138-105463160 ATGTAAATTCAAATGTGCAAAGG + Intergenic
995434050 5:112115580-112115602 AAGCTAATTCACATGGGCCAGGG - Intergenic
995590871 5:113698691-113698713 ATGAGAGTTCAGATGGGCCAGGG - Intergenic
998877664 5:146617097-146617119 ATGTTAAGTGAAATGAGCCAGGG + Intronic
1003803685 6:9701286-9701308 ATGTTAATGCTGTTGGTCCAGGG + Intronic
1006996832 6:38268896-38268918 CTGTTTATTCCGGTGGGCCATGG + Intronic
1008598751 6:53068096-53068118 ATGTTATTTCAGGGCGGCCAGGG - Intronic
1009752888 6:67895281-67895303 ATGTAAATTCAACTGGGGCAAGG + Intergenic
1011886745 6:92106059-92106081 CTGTGAATTCATATGGACCAGGG + Intergenic
1012349341 6:98232061-98232083 ATGATATTTGGGATGGGCCAGGG - Intergenic
1013157195 6:107504413-107504435 GTGTTAATTCAGCTCTGCCAAGG - Intronic
1013835046 6:114324764-114324786 AGGTGCATTCAGATGGACCAGGG + Intronic
1014845018 6:126264515-126264537 GTGTCAATTTAGCTGGGCCATGG + Intergenic
1022692953 7:32675750-32675772 ATCTTAAGTGTGATGGGCCATGG + Intergenic
1022920625 7:35010289-35010311 ATCTTAAGTGTGATGGGCCATGG + Intronic
1027681426 7:81226949-81226971 ATTTTAATGCAGCTGGCCCATGG + Intergenic
1027799432 7:82733480-82733502 ATGTTGATTCAGATGTCCCCAGG + Intergenic
1028655933 7:93207082-93207104 ATCTTGATGCAGATGGCCCAAGG + Intronic
1033723993 7:144093353-144093375 ATTTTAATACAGATAGGCAAAGG - Intergenic
1034931801 7:155168935-155168957 ATGTTATTTCAGATTGGACCTGG - Intergenic
1038107099 8:24448720-24448742 AGGTTAGTTTACATGGGCCATGG + Intronic
1038147388 8:24911783-24911805 ATTTTAATACAGATGGGCCAAGG + Intergenic
1041953935 8:63536710-63536732 ATGAGATTTCAGAGGGGCCAGGG - Intergenic
1041958602 8:63585250-63585272 ATGTGAATTCAGATGCTGCATGG + Intergenic
1044103225 8:88167694-88167716 ATTTTGACTCAGATGAGCCATGG - Exonic
1044134237 8:88564742-88564764 ATGTTAAGTGAGATAAGCCAGGG + Intergenic
1047632455 8:126723064-126723086 ATGTTCATACACATGGGTCATGG - Intergenic
1050255264 9:3786946-3786968 ATGATATTTGAGAAGGGCCAGGG - Intergenic
1051698316 9:19792172-19792194 ATGTTATTTCAGATGGGGCAAGG - Intergenic
1052198112 9:25743234-25743256 CTGGTAATTCTAATGGGCCAGGG - Intergenic
1053114264 9:35488330-35488352 AGGATAATTCGGCTGGGCCAGGG - Intergenic
1054822928 9:69541956-69541978 GTATTAACTCAGATGGTCCAAGG - Intronic
1055846215 9:80566192-80566214 ATGTTAATTAAGATAGCCCATGG + Intergenic
1057878591 9:98776307-98776329 ATGTTCATTTAGATGGGCACAGG + Intronic
1058149755 9:101451440-101451462 ATGATAATACAGCTTGGCCAAGG - Intergenic
1058486108 9:105444965-105444987 ATGTGGATTCAGCTGGTCCAGGG + Intergenic
1059611692 9:115904253-115904275 ATGTCAATTTAAATGAGCCAAGG - Intergenic
1187558460 X:20375773-20375795 ATAGTAATTCAGATGAGCAAAGG + Intergenic
1188863329 X:35284984-35285006 ATGAGATTTCAGAGGGGCCATGG - Intergenic
1188865837 X:35312203-35312225 ATGATAATTCAGCAGTGCCAGGG - Intergenic
1189707388 X:43772646-43772668 ATATTATATCAGATGGGCTATGG - Intronic
1194598981 X:95896646-95896668 ATGTTAATCCAGAGGTCCCAGGG - Intergenic
1194802611 X:98291214-98291236 ATGATAATTCAGCAGTGCCAGGG - Intergenic
1194936784 X:99959666-99959688 TGGATAATTCAGATGTGCCATGG + Intergenic
1195929948 X:110064417-110064439 ATTTTAATTCAGAGGTGCAAGGG - Intronic
1197130040 X:122994828-122994850 CTGGTAAATCAGATGGGTCAGGG - Intergenic
1199638909 X:149841201-149841223 ATGTGATTTGGGATGGGCCAGGG - Intergenic