ID: 924597624

View in Genome Browser
Species Human (GRCh38)
Location 1:245461246-245461268
Sequence AAGCAGAAGCAGAATCAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 357
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 322}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924597624_924597627 28 Left 924597624 1:245461246-245461268 CCAGACTGATTCTGCTTCTGCTT 0: 1
1: 0
2: 4
3: 30
4: 322
Right 924597627 1:245461297-245461319 TTTTTATCTTTTTTTTTTTCAGG 0: 1
1: 23
2: 898
3: 24032
4: 31150
924597624_924597628 29 Left 924597624 1:245461246-245461268 CCAGACTGATTCTGCTTCTGCTT 0: 1
1: 0
2: 4
3: 30
4: 322
Right 924597628 1:245461298-245461320 TTTTATCTTTTTTTTTTTCAGGG 0: 2
1: 8
2: 235
3: 5628
4: 43078

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924597624 Original CRISPR AAGCAGAAGCAGAATCAGTC TGG (reversed) Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
900780420 1:4614252-4614274 GAGCAGCAGCAGAGTCAGACTGG + Intergenic
901764977 1:11494158-11494180 AAGCAAAATCAGAATCAGAGAGG - Intronic
901822735 1:11840514-11840536 AAGCAGAGGTAGAATCAGGCGGG + Exonic
901911376 1:12461186-12461208 AAGCAGCAGCAAAATCCTTCTGG - Intronic
902259694 1:15215302-15215324 AAGCAGCAGCAGCATCACCCCGG - Exonic
903500100 1:23795968-23795990 TGGCAGAAGCAGAATCCTTCAGG - Exonic
903989175 1:27253320-27253342 AAGAAGAAGCAGAAACAGAGAGG - Intronic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
906848221 1:49218044-49218066 GAGCAGAAACAGAATCAGTAGGG - Intronic
907512752 1:54973892-54973914 AAGGAGAGGCTGAATCAGTGTGG - Intergenic
908988457 1:70055257-70055279 AAGCAGAAGCCGGATCATGCTGG + Intronic
909177740 1:72381485-72381507 AAGCAGAAGCTGGAACAGTTTGG - Intergenic
910152886 1:84174125-84174147 AAGCAGATGCCGAATCAGGGAGG - Intronic
910288536 1:85579163-85579185 AAGCACAATGAGAATCTGTCAGG - Intergenic
910929081 1:92424552-92424574 AAGGAGAAGAGGAAGCAGTCAGG + Intergenic
911179851 1:94850624-94850646 AAGCAGAGGCAGAGCCAGCCTGG - Intronic
912583242 1:110738457-110738479 AACCAGAAGCAGAAGCTGTGAGG + Intergenic
913397492 1:118388391-118388413 AAGCAGAAGCAGAATGACTCTGG + Intergenic
913474331 1:119222649-119222671 AAGCAGCAGCAGATTCAGGGTGG + Intergenic
914740111 1:150457407-150457429 AAGGAGACTCAGAACCAGTCGGG - Exonic
914753905 1:150552545-150552567 AAGCAGCAGCAGATACAGCCAGG - Exonic
916026662 1:160838938-160838960 AAGAGGAAGGAGAAGCAGTCAGG - Exonic
916836830 1:168554520-168554542 AAGCAGAGGAAGATTCAGTCTGG + Intergenic
917208240 1:172601162-172601184 CAGCAGGAGCAGAAGCAGACAGG + Intronic
917641757 1:176989853-176989875 GAGCACAAGCAGAAACAGTTGGG - Intronic
918656734 1:187036081-187036103 AAGGAGAGGCAGAATTAGTTTGG - Intergenic
918790978 1:188828344-188828366 AAGCAATAGCACAATCAGCCAGG - Intergenic
919259061 1:195166167-195166189 ATGCATAAGCAGAATTAGGCAGG - Intergenic
919812150 1:201415475-201415497 CAGCAGCAGCAGAATCAGAGTGG - Intronic
920081894 1:203380898-203380920 AAGCTGAAGCATATACAGTCAGG - Intergenic
920934959 1:210423640-210423662 AAGCATTAGGAGAATCCGTCAGG - Intronic
921179136 1:212617764-212617786 AAGCCGAAACAGATTCTGTCTGG - Intronic
921290636 1:213653699-213653721 AACCATAAGCAAAATCAGACAGG - Intergenic
923330910 1:232923834-232923856 AAGCAGAGTGAGAATGAGTCAGG - Intergenic
924597624 1:245461246-245461268 AAGCAGAAGCAGAATCAGTCTGG - Intronic
1063182912 10:3622115-3622137 AAGCAGAAGCAAATACAGGCAGG + Intergenic
1063287009 10:4700606-4700628 AACCAGAAGCATAAGCAGTATGG + Intergenic
1063917197 10:10895459-10895481 AAGCAGAAGCAGAAAAAATATGG + Intergenic
1065184577 10:23159397-23159419 CAGCATAAGAAGAAACAGTCGGG - Intergenic
1066470059 10:35689328-35689350 AAACAAAAGCAAAATTAGTCAGG + Intergenic
1066693587 10:38057948-38057970 GAGCAGAACCAGAATCAAGCTGG + Exonic
1068395816 10:56459869-56459891 AAGCAGAACCAGAAACAATGTGG + Intergenic
1071374846 10:84991911-84991933 AAGCAAAAGCAAAAGCACTCTGG - Intergenic
1071416805 10:85449190-85449212 CAGCAGGAGCACAATTAGTCAGG - Intergenic
1072099582 10:92216497-92216519 AAGCAGAAGCAGATTCGGCGCGG + Intronic
1073103553 10:101019523-101019545 AGGCAGAAGCAGAAGCAGAAGGG - Intronic
1074457462 10:113607804-113607826 AAGAAGAAGTAGAATCAATGAGG + Intronic
1076293220 10:129363659-129363681 AAACAGAAGCAGAACCAGTCAGG - Intergenic
1077774834 11:5259017-5259039 AAGCATCAGCAGAGGCAGTCAGG - Intronic
1077809144 11:5619998-5620020 AAGCAGAAGTTGCATGAGTCAGG - Exonic
1079372337 11:19862321-19862343 AAGCAGGAGGAGAAGCAGTCTGG + Intronic
1079471302 11:20780749-20780771 AAGCTGAAGGAGAAGGAGTCAGG + Intronic
1079974397 11:27074359-27074381 AAGCAGAAGTTGGAACAGTCTGG + Intronic
1079980942 11:27150869-27150891 AGGCAGAAGCTGAAACAGTTTGG - Intergenic
1080302358 11:30798654-30798676 TAGCAGTAGCAGAATCAGTTGGG + Intergenic
1080379778 11:31756324-31756346 AGGCAGAGGCAGAATCTGTAGGG - Intronic
1081300144 11:41441333-41441355 AAGCAGAATCATTAGCAGTCAGG + Intronic
1081589416 11:44410783-44410805 AGGCAGAAGCAGAATAAGAGAGG + Intergenic
1083443223 11:62690456-62690478 AAGCAGGAGCAGGAGCAGGCAGG + Exonic
1083471204 11:62885267-62885289 CAGTAGAACCAGAATCAGACAGG - Exonic
1083951589 11:65959519-65959541 AACAAGCAGCAGAACCAGTCTGG + Intronic
1085586181 11:77708808-77708830 TAGCTGAAGCAGAATGAGTGGGG - Intronic
1085735565 11:79036128-79036150 AAGCAGAATCTGAGTCAGTGGGG + Intronic
1087515569 11:99154963-99154985 AGACAGTAGCAGAATCAGGCTGG + Intronic
1087938433 11:104063369-104063391 AAGCAGAAGAGGAATTAATCTGG + Intronic
1088138186 11:106582852-106582874 AAGCAGTAGCTGTATCACTCAGG + Intergenic
1088698276 11:112388988-112389010 AAGCAAAAGAAGAAGCAGCCTGG - Intergenic
1089031655 11:115336615-115336637 AATCAGAACCAAAATAAGTCAGG + Intronic
1089536307 11:119162478-119162500 AATCAGAAGCAGAATGAGCCTGG - Exonic
1090163293 11:124518068-124518090 AAGCAGAAGCAGAGGGTGTCTGG - Intergenic
1090598671 11:128346943-128346965 AAGTAGAATATGAATCAGTCCGG - Intergenic
1090692482 11:129198810-129198832 AAGCAGAGGCTGAAACAGTTTGG + Intronic
1090894435 11:130958011-130958033 AACCAGAAGTACAATGAGTCAGG - Intergenic
1093832610 12:23782394-23782416 ATGCAGAAGCAGAATGACTGTGG + Intronic
1094686927 12:32726711-32726733 AAGCAGCAGCAGAAACACTAGGG - Intronic
1095879224 12:47114602-47114624 AAGCAGTAGCAGAAGTAGTGGGG - Intronic
1097391840 12:59024725-59024747 AAAGAGAAGCAGAGTCAGTGAGG - Intergenic
1097785581 12:63755296-63755318 AAGTAGAACCAGAAACATTCTGG - Intergenic
1098316259 12:69196487-69196509 AATCAGCACAAGAATCAGTCTGG + Intergenic
1098523527 12:71460683-71460705 AAGTGGAGGCAGAATCAGACTGG + Intronic
1098608451 12:72423807-72423829 AAGCAGAAGAGGAATCAGAGAGG + Intronic
1099086376 12:78251645-78251667 AAGCAGAAACAGAAGTAGCCTGG + Intergenic
1099408811 12:82297977-82297999 AACCAGAAGCAGTATTAGTTAGG - Intronic
1105590672 13:21790379-21790401 AACAAGAAACAGAATCAGGCTGG + Intergenic
1106436201 13:29724942-29724964 AAGCATAATCAGAATCAGATTGG + Intergenic
1106455293 13:29921465-29921487 CAGGAGAGGCAGAATTAGTCAGG - Intergenic
1110558851 13:76888424-76888446 GAGCAGAAGTAGAAGCAGTTAGG - Intergenic
1111284200 13:86066813-86066835 AAGTAGAAGCAGAGTAAATCTGG + Intergenic
1111527714 13:89493234-89493256 AAGCAGAGGCTGAAACAGTTTGG - Intergenic
1112029971 13:95447963-95447985 AAGCAGAGGCAGAAAGAGCCTGG - Intronic
1112125333 13:96460228-96460250 AAGCAAACCCAGAATCAGACAGG + Intronic
1113301211 13:109021473-109021495 CAGCAGAAGCAGCAGCAGTGTGG + Intronic
1114650619 14:24282219-24282241 AAGCAGAAGCAGCATGATGCAGG + Intergenic
1114663087 14:24361591-24361613 AAAGAAAAGGAGAATCAGTCAGG - Intergenic
1116498163 14:45587653-45587675 AAGCATAAGAAGACTCATTCAGG - Intergenic
1117488852 14:56226084-56226106 AAGAAGAAGAAGAAGAAGTCAGG + Intronic
1119464403 14:74843683-74843705 CAGCAGAAGCAGAATAAAACAGG + Intronic
1119650226 14:76377833-76377855 AACTAGAAGCAGGAACAGTCTGG - Intronic
1120782776 14:88500883-88500905 AAGCAGAAGAAGAAACACCCAGG + Intronic
1122078638 14:99251894-99251916 AAGCAGAGTCAGACTCAGTCAGG - Intronic
1124127976 15:26955726-26955748 AACAAGATGCAGAATCAGCCAGG + Intergenic
1125311119 15:38379082-38379104 AAGAAGAAGAAGAAGAAGTCAGG - Intergenic
1126455005 15:48851500-48851522 AAGCAGAAGCAGTAACCCTCAGG - Intronic
1126589574 15:50325403-50325425 CAGCAGAAACAGAACCAGACAGG - Intronic
1126686127 15:51250470-51250492 AACCAGAAGCACCATCAGACAGG - Intronic
1126878861 15:53072947-53072969 AAGCAGAGGCAGAAACAGCATGG + Intergenic
1127114559 15:55712028-55712050 AAGCAGAAGCCAAATGATTCTGG + Intronic
1128805245 15:70526137-70526159 AGGCAGAAGCAGAATGAGTTGGG - Intergenic
1131139347 15:89964439-89964461 CAGCAGCAGCAGGATCAGTCAGG - Intergenic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1132001316 15:98182719-98182741 AAACAAAAGCAGAAACATTCAGG + Intergenic
1133288418 16:4702102-4702124 CAGCAGCAGCAGCAGCAGTCGGG - Exonic
1133329176 16:4960847-4960869 ACGCAGAAGCAAAGTCACTCAGG - Intronic
1133532927 16:6672674-6672696 AAGCAGAAGCGGAATCATGGTGG - Intronic
1134020747 16:10919749-10919771 AAGCAAAAATAGAATCTGTCTGG + Intronic
1134441362 16:14301573-14301595 AAGTAGGAGCAGCATCAGGCAGG - Intergenic
1135197042 16:20403208-20403230 AAGCAGAGGCAGGATCAGTAAGG - Intronic
1135856425 16:26015333-26015355 ATGCAGAAGCAGAATCTGGTGGG + Intronic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1138860455 16:60749851-60749873 ACCCAGAAGCAGACTCAGCCAGG - Intergenic
1138929240 16:61632487-61632509 AAGAAGAAGAAGAATCATTATGG + Intergenic
1139095692 16:63702485-63702507 AAGAAAAAGAGGAATCAGTCAGG + Intergenic
1139937239 16:70580115-70580137 AAGCAGCAGCAGAATCGGGGTGG - Intronic
1140839920 16:78829052-78829074 AAGCAGAACCATCATAAGTCAGG + Intronic
1143591844 17:7889729-7889751 AAGCAGAAGGAGAACAAGCCAGG + Exonic
1143613401 17:8034249-8034271 AAGCAGGAGCCAAATCATTCAGG + Intergenic
1143947520 17:10606124-10606146 AAGCAGAAAAAAAATTAGTCAGG + Intergenic
1144158442 17:12532791-12532813 AAGCAGAAGTAAATTCAGTCAGG - Intergenic
1145720072 17:27062957-27062979 AAATAGAAGCAGAATAAGACTGG + Intergenic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1148476900 17:47934720-47934742 AAGCAGCATCAGAATCAGAGTGG + Intergenic
1148682091 17:49480085-49480107 AGGCAGAGGCAGACACAGTCTGG + Intergenic
1149480820 17:57001766-57001788 ATGCAGAGGCAAAATCAGTCAGG + Intronic
1150484123 17:65532421-65532443 AAGCAGCAGCAGCAGCAGCCAGG + Intronic
1151157409 17:72135556-72135578 AAGCAGAACTAGAAGGAGTCTGG + Intergenic
1153318835 18:3751857-3751879 AAGAAGAAGAAGAAGAAGTCCGG - Intronic
1153596880 18:6735200-6735222 ACGCAGAAGCAGAAACTTTCTGG - Intronic
1157363276 18:47038991-47039013 AAGCAGAAACAGGCTCTGTCTGG + Intronic
1161308607 19:3581106-3581128 AAGAAGAAGAAGAAGCAGTGTGG - Intergenic
1164809181 19:31142632-31142654 AAGAAGAAAAAGAACCAGTCGGG + Intergenic
1164934675 19:32201559-32201581 AAGCAAAAGGAGAATCAGCAGGG + Intergenic
1165991987 19:39821111-39821133 GAGTAGAAGCAGAATCTGCCAGG + Intergenic
1166168266 19:41007920-41007942 CAGAAGAACCAGAAGCAGTCTGG - Intronic
1166869241 19:45861276-45861298 AAGCAGAAGAAGAATGAAACAGG - Intronic
1167643023 19:50692530-50692552 AAGCAGAAGCAGGAACAGGGTGG - Intronic
927821584 2:26270858-26270880 AAGCTACAGAAGAATCAGTCAGG - Intronic
928746417 2:34421118-34421140 AAGCAGAAGAAGAAAGAGACAGG - Intergenic
929263200 2:39889740-39889762 GATCAGAATCAGAATCAATCAGG - Intergenic
929678042 2:43957726-43957748 CAGCAGAATCAGAGTCAGCCTGG + Intronic
931243273 2:60471384-60471406 AAGAAGCAGCAGAATCAGCTGGG - Intronic
931418834 2:62106798-62106820 AAGCAGAAGCAGAGACTGTGTGG + Intronic
931522910 2:63119002-63119024 AAGCTGAAGAAGAATGAGGCTGG - Intergenic
931797761 2:65728076-65728098 CACCAGAAGCGGAAGCAGTCAGG - Intergenic
933085008 2:78045244-78045266 AAGCAGAAGCTGGAACAGTTTGG + Intergenic
933183668 2:79254977-79254999 TAGCTGAAGCAGAATCACCCTGG + Intronic
933274491 2:80268856-80268878 AAACACACCCAGAATCAGTCAGG + Intronic
933304255 2:80577592-80577614 GAGCAGAAGCAAGATCAGTTAGG + Intronic
935037166 2:99389154-99389176 AATCAAAAGCATAATCTGTCTGG - Intronic
935935699 2:108180685-108180707 GAGCAGCACCTGAATCAGTCTGG - Intergenic
936370186 2:111897340-111897362 CAGCAAAAGCAAAATCAGTGTGG - Intergenic
936958679 2:118049891-118049913 AAGCAGAAAGAGAATGAGTATGG - Intergenic
937020206 2:118643546-118643568 GAGCAGAAGCAGAAGCTGTCAGG + Intergenic
937379852 2:121366925-121366947 GAGCAGAAGCAGAGCTAGTCTGG - Intronic
937385183 2:121424002-121424024 AAGCATCTGCAGAAGCAGTCAGG - Intronic
938600008 2:132828127-132828149 AGGCACCAGCAGATTCAGTCTGG - Intronic
938966703 2:136394979-136395001 AAGCAGAATCAGCATCAGCTGGG - Intergenic
939092766 2:137798656-137798678 AGGCAGAGGCTGAATCAGTTTGG + Intergenic
939373701 2:141336140-141336162 AAACAGGAGCAGAAATAGTCTGG + Intronic
939741903 2:145918298-145918320 AAGCAGAAGAAAAAAAAGTCAGG - Intergenic
942471563 2:176266382-176266404 AAGCAAAAGAACCATCAGTCAGG + Intergenic
942766644 2:179465173-179465195 AAGCTAAAGGAGAACCAGTCAGG - Intronic
944984396 2:205158787-205158809 CAGCAGAACCTGAATCATTCAGG - Intronic
945141361 2:206690300-206690322 AGGCTGAAGCAGAACAAGTCAGG + Intronic
945621953 2:212150687-212150709 AAGCACAAGAAGAATGAGTCTGG - Intronic
946169852 2:217888421-217888443 AAGCAGAGGCAGTGTCAGACAGG + Intronic
946342435 2:219079458-219079480 AAGCAGGTGCTGAACCAGTCAGG + Intronic
947231194 2:227888389-227888411 AAGCAGAAGCAGGATCAGGCGGG + Intronic
949037632 2:241824519-241824541 AAGAAGAAGAAGAAGTAGTCAGG - Intergenic
1170051496 20:12150538-12150560 GAGAAGAAGGAGAATCAGTAGGG + Intergenic
1170438202 20:16351624-16351646 AAGCTGAAGCAGTGCCAGTCTGG - Intronic
1170565852 20:17604354-17604376 AGGCATATGCAGAATCACTCAGG - Intronic
1171095249 20:22326684-22326706 ATGCATAAGTAGAATCAGCCTGG - Intergenic
1171151833 20:22834508-22834530 AAGGATAAGCAGAATCAGGATGG - Intergenic
1172204702 20:33154769-33154791 AAGCAGAAGCAGAGCCTGCCTGG - Intergenic
1172604670 20:36206595-36206617 AAGCAGCAGCAGAAACCCTCAGG - Intronic
1172913502 20:38427435-38427457 ATGCAGGAGCAGAAACAGACAGG + Intergenic
1173060023 20:39651817-39651839 AGCCAGAAGCAGAGTCAGCCAGG + Intergenic
1175637488 20:60598069-60598091 AAGCAGAAGCAGAATCTTACAGG + Intergenic
1176521153 21:7825560-7825582 AGGCAGAAGCAGAAACGGCCAGG - Exonic
1178655173 21:34455572-34455594 AGGCAGAAGCAGAAACGGCCAGG - Intergenic
1180847732 22:18993417-18993439 AAGCAGGAGAAGAATGAGGCTGG - Intergenic
1181524427 22:23471979-23472001 AAGCAAATGCAGAAGCAGTGTGG - Intergenic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1181889036 22:26045382-26045404 TGACAGAAGCAGAATTAGTCAGG + Intergenic
1182715094 22:32351935-32351957 AAGCAGAAGAAAAACCAGGCTGG + Intergenic
1183339465 22:37271909-37271931 GAGCTGCAGCAGCATCAGTCAGG - Intergenic
1183910290 22:41074192-41074214 AAGCAGAAGTATGACCAGTCCGG - Intergenic
1184732710 22:46379645-46379667 AAGCAGGAGAAGAATGAGGCTGG + Intronic
951060654 3:18202915-18202937 AAAAAGAAGAAGAATCAGACTGG - Intronic
951601242 3:24378112-24378134 AGGCAGAAACTGAATCAGGCAGG + Intronic
952026399 3:29087844-29087866 CAGTACAAGCAGAATCAATCTGG + Intergenic
953969536 3:47336332-47336354 AAGGAAAATCAGAATCAGACAGG - Intronic
954756608 3:52843803-52843825 AAAGAGAAGCAGACTCAGTGAGG + Intronic
955824955 3:62936019-62936041 AAGCAGAAGCAGAAACTCTCAGG - Intergenic
956028114 3:65005697-65005719 AGACAGATGCAGAATGAGTCAGG - Intergenic
958120145 3:89276042-89276064 AAGCAGAGGTAGAAACACTCAGG + Intronic
958657204 3:97018031-97018053 AAGCAGAAGAAGGATTAGTGAGG - Intronic
959077036 3:101760180-101760202 AAAAAGAAGCAGCATCAGACAGG - Intronic
960409979 3:117311056-117311078 AAGCAGATGCAGAAACAGAGAGG - Intergenic
960411977 3:117338218-117338240 AAGCAAAATGAGAATCACTCTGG - Intergenic
961581970 3:127890781-127890803 AATCAGAATCAGAATGAGTCAGG - Intergenic
962459692 3:135598324-135598346 TAGCAGAACTAGAACCAGTCGGG - Intergenic
962750714 3:138433143-138433165 AAGCTGAGGCAGAATGTGTCTGG - Intergenic
962830525 3:139135275-139135297 AAGCAGGAGTAGAGTCAGTTTGG + Intronic
964817236 3:160730197-160730219 AAACAGAAGCACAAGCAGTGAGG + Intergenic
965100359 3:164290129-164290151 TAGCAGAAGCAGAAGTAGTTAGG - Intergenic
967826962 3:193884746-193884768 AAGCAGCAGCAGAGTCAGCTGGG + Intergenic
967960654 3:194920575-194920597 AAGCAGACAGAAAATCAGTCAGG - Intergenic
969459804 4:7322916-7322938 CAGCAGAAACTGAAACAGTCTGG - Intronic
970816278 4:20159960-20159982 AAACAGAACCAGAACCAGTAGGG - Intergenic
971618401 4:28823716-28823738 AGGCACAAGCAGAATCTGTCTGG - Intergenic
973026501 4:45280012-45280034 AAGGATAAGCACAATCAGTGTGG - Intergenic
973330936 4:48909767-48909789 AGGCAGGAGCTGAATCACTCAGG - Intergenic
976088181 4:81427732-81427754 AAGCAGCAGCAGCAGCAGGCAGG + Exonic
977285303 4:95098649-95098671 AAGCAGCAGCAGAATGAACCTGG - Intronic
977351688 4:95896600-95896622 AAGATGAAGCTGAATCAGACAGG + Intergenic
977858379 4:101924523-101924545 AAACAGAAGCAGAAAGGGTCAGG + Intronic
977984841 4:103370898-103370920 AAGCTGAAGCAGAATCCATGAGG - Intergenic
978262131 4:106772922-106772944 ATGCAGAAGCTGAAACAGTGTGG + Intergenic
981052834 4:140328052-140328074 AAGCAGAAGCACGAGGAGTCTGG - Intronic
982173676 4:152685050-152685072 AAGCAAAAGAAGAATCATTGAGG - Intergenic
982520628 4:156412315-156412337 AAGCAAAAGCCTAATCAGTAAGG - Intergenic
982635822 4:157895478-157895500 AAGCAGAGCCAGAATCAGAGGGG + Intergenic
983029811 4:162785595-162785617 AAGAAGAAGAAGAAGTAGTCAGG + Intergenic
983269147 4:165540385-165540407 CAGCAGAAGCAGAAGCATTTTGG + Intergenic
983903817 4:173164806-173164828 ATGCAGAAGGCTAATCAGTCTGG + Intergenic
985992204 5:3572646-3572668 AAGATGAGGGAGAATCAGTCAGG + Intergenic
986195318 5:5532792-5532814 AAGCTGGAGCAGAGTCAGTCAGG - Intergenic
988211859 5:28214352-28214374 GAGCTGAAGCTGAATCTGTCTGG - Intergenic
988677703 5:33450386-33450408 TAGTAGAAGCAGAACCAGTTAGG + Intronic
989358528 5:40572498-40572520 AAGCAGAAACAGCAGCAGACCGG + Intergenic
989710177 5:44388612-44388634 AAGCAGCAGCAGCAGCAGCCGGG + Exonic
991077653 5:62559455-62559477 AAGCAGCAGCAGAATCTGAGAGG - Intronic
991645791 5:68799338-68799360 AAGCAGGAGCAAAGTCATTCTGG + Intergenic
992625227 5:78630800-78630822 ACGCAAAAGCAGAATAAGGCGGG + Intronic
992689858 5:79231663-79231685 GGGCAGAGGCAGAATCAGGCAGG - Intronic
994145624 5:96391877-96391899 AATCAGAAGCAGAAACTGGCAGG - Exonic
994285626 5:97962196-97962218 AAGCTGAAGCAGAGTAAGGCAGG - Intergenic
994913292 5:105941849-105941871 AAGAAGTAGCAGATTCAGTTTGG + Intergenic
996821600 5:127635417-127635439 AAGCAGAAGCATATTCTGTGAGG - Intergenic
997001064 5:129762594-129762616 CAGCAGCAGCACAATCAGTCAGG + Intronic
997595738 5:135106185-135106207 AAGGAGAAACAGAATCAGTCGGG + Intronic
997736595 5:136216824-136216846 AAGCAGAAGCAGACACAGCCGGG + Intronic
998219204 5:140262389-140262411 AGCCAGAACCAGAATCAGTCAGG - Intronic
998227595 5:140338933-140338955 AAATAGCAGCAGAACCAGTCTGG - Intronic
998329744 5:141314268-141314290 AAACAGAAGCAGCATCATTCTGG - Intergenic
998483997 5:142485970-142485992 AAGTAGAATGAGAAGCAGTCAGG - Intergenic
998537900 5:142951489-142951511 TAGCAGAAGGAGGATCAGTCTGG + Intronic
999363620 5:151006824-151006846 CAGCAGCAGCACAATCAGTGGGG - Intergenic
999442829 5:151615617-151615639 GTGCTGAAGCAGAATGAGTCAGG + Intergenic
1000166740 5:158657163-158657185 AGGCAGAAGTAGAAGCAGTAGGG - Intergenic
1002284521 5:178153533-178153555 AAGCAGAAGCAGATTCGGCGCGG - Exonic
1002718258 5:181242358-181242380 AAACAGAAGAAAAATCAGTGAGG + Intronic
1003340714 6:5217868-5217890 AAGGAGAAGCAGACTGAGCCAGG + Intronic
1007226780 6:40320798-40320820 AGGAAGAAGCAGCATGAGTCTGG + Intergenic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1008613629 6:53206256-53206278 AGGCAAAGCCAGAATCAGTCAGG + Intergenic
1008661678 6:53674582-53674604 AAGAAGAAGTAAAATCACTCAGG - Intergenic
1010665515 6:78625421-78625443 AAGGAGAAATAGAATCACTCTGG + Intergenic
1010815785 6:80356882-80356904 AGGCAGAGGCAGAAGGAGTCGGG - Intergenic
1011169738 6:84492206-84492228 AAGCAGAAGCAGAAAAATTTAGG + Intergenic
1011490875 6:87890607-87890629 AAGCAAATGTAGAATCACTCTGG + Intergenic
1012036725 6:94150898-94150920 AATCAGAAGAACAATCATTCTGG + Intergenic
1012054953 6:94394507-94394529 GAGAAGAAGCAGAAGAAGTCAGG + Intergenic
1013814094 6:114076854-114076876 AAGCAGAAAGTGTATCAGTCAGG + Intronic
1014618614 6:123636898-123636920 AAGAAGCAGCAGAAACAGCCAGG - Exonic
1015794355 6:136996284-136996306 AAGCCAAAGAAGAATCAGTATGG - Intergenic
1016986710 6:149900814-149900836 CAGCAAAAGGAGAAGCAGTCTGG - Intergenic
1018579145 6:165292694-165292716 AAGGAGAAGCAGAGTCAGCCTGG + Intronic
1018758871 6:166872934-166872956 ACGCAGGAGCAGCAGCAGTCAGG + Intronic
1020534378 7:9376224-9376246 AAGCAAAATGAGAATCAGTTAGG + Intergenic
1020786308 7:12577552-12577574 AAGCAGAAACAAAAACAGGCCGG + Intronic
1021335213 7:19392347-19392369 AAGCTGAAAAAAAATCAGTCAGG + Intergenic
1021636397 7:22698399-22698421 AACCAGAAACAGAGTCAGGCTGG - Intergenic
1022100215 7:27164977-27164999 AACCACAAGCATAGTCAGTCAGG + Exonic
1022885677 7:34640927-34640949 AAGTAGAAAGAGAATCATTCAGG + Intergenic
1023444448 7:40217199-40217221 AAGAAGAAGAAGAATAATTCTGG - Intronic
1025823097 7:64989776-64989798 AAGAAGAAGAAGAATAAGCCAGG + Intronic
1025898832 7:65727505-65727527 ACACAGAAGCAGACTCAGGCGGG + Intergenic
1027201663 7:76067847-76067869 AAGCAAAAGCAGAAGCTGCCAGG + Intergenic
1027858148 7:83539301-83539323 AAGCAGAAGCTGACTGACTCGGG - Intronic
1028132554 7:87193299-87193321 AAGCAGGAGCAGCAGCTGTCAGG - Exonic
1029207368 7:98878000-98878022 AAGCAGCTGCAGAATCAATGGGG + Intronic
1030161411 7:106512175-106512197 GAGCAGAAGCTGAGACAGTCTGG - Intergenic
1030551738 7:110969807-110969829 AAGCAGAAATAGAATCTTTCAGG + Intronic
1030824974 7:114143864-114143886 AAGTAGAACCAGCATAAGTCAGG - Intronic
1030901141 7:115125396-115125418 AAGAAGAAATAGAATCAGTAGGG - Intergenic
1031564997 7:123285218-123285240 GAGAAGCACCAGAATCAGTCAGG + Intergenic
1035910494 8:3560464-3560486 CAGCATGAGAAGAATCAGTCTGG - Intronic
1039244222 8:35590741-35590763 AAGCTGAAGCAGAAACATTGAGG + Intronic
1039246738 8:35616934-35616956 ATGCAGAAGTAAAAGCAGTCTGG + Intronic
1039416310 8:37397269-37397291 AGGCAGTAGCTGTATCAGTCAGG + Intergenic
1039757687 8:40540806-40540828 AAACAGAATCAGAATCAGAGAGG - Intronic
1039929513 8:41971756-41971778 AAGCAGAAGCAAGTTTAGTCTGG + Intronic
1040083858 8:43318509-43318531 CAGCAGCAGCACCATCAGTCAGG - Intergenic
1040542865 8:48375475-48375497 AAGTAAAGGCAGAATCAGTGTGG - Intergenic
1040842590 8:51800498-51800520 AAGCACAGGCAGACTCAGTGTGG + Intronic
1041971182 8:63744509-63744531 AAGCAAAAGCAGAATCTTCCAGG - Intergenic
1043419546 8:80084523-80084545 AAGGAGAAACAGAAACAGACAGG + Intronic
1046163851 8:110402863-110402885 AAGCAAAAGCATAGTCATTCTGG - Intergenic
1048765329 8:137837545-137837567 AAGCAGCAGCAGCAGCAGTTTGG + Intergenic
1048823000 8:138396855-138396877 AAGCAGAAGCAGGTGCTGTCTGG - Intronic
1050360792 9:4829200-4829222 AGGGAAAATCAGAATCAGTCTGG + Intronic
1051555880 9:18382015-18382037 CAGGAGAAGCAGAAGCAATCAGG - Intergenic
1051705326 9:19872999-19873021 AAGAAGAAGAAGAATGATTCAGG + Intergenic
1053116521 9:35509051-35509073 AATCAGAATCAGAATGAGGCTGG + Intronic
1054853986 9:69878440-69878462 ATGCTGAAACAGAATCAGGCAGG - Intronic
1055598319 9:77888659-77888681 AAGAATAAACAGACTCAGTCTGG - Intronic
1056842205 9:90007423-90007445 AAGCAGAAGGAAAATCAGGCAGG - Intergenic
1057132660 9:92664873-92664895 ATGCAGAAGGAGGCTCAGTCAGG + Intronic
1059759067 9:117321216-117321238 ATGCAGTAGAAGAATCAGGCAGG + Intronic
1060446305 9:123691417-123691439 AAACAGAAGCACATTCTGTCTGG + Intronic
1061029443 9:128071008-128071030 AAGCAGAAACAGAAACCCTCTGG - Intronic
1061977680 9:134078860-134078882 GAGCAGAAGCAGAAGCGGTTTGG - Intergenic
1203782876 EBV:110657-110679 AAGCAGTCCCATAATCAGTCAGG + Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186670474 X:11762479-11762501 AAGCACAAGCAGCAGCATTCTGG - Intronic
1186745023 X:12558683-12558705 AAGCAAAAGCAGTATCTTTCAGG + Intronic
1186956110 X:14683903-14683925 AAAAAAAAGCAGAATCAGTAGGG + Intronic
1188291531 X:28394975-28394997 AAGGAGAAGCAAAGTCAGTGAGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188841702 X:35025030-35025052 GAGCAGAAGGAGAAGCAGCCAGG + Intergenic
1188988440 X:36788996-36789018 GAGCAGAAGGAGAAGCAGCCAGG - Intergenic
1189105791 X:38233903-38233925 AAGCAGCAACAGAATCAGTAAGG - Intronic
1189512534 X:41677409-41677431 AAGCAGGAGGAAAATCAGTTTGG + Intronic
1189627690 X:42916893-42916915 AACAAGCAGCAGAATCAGGCTGG + Intergenic
1190718797 X:53129383-53129405 AAGAAGAAGAAAAATCAGGCTGG - Intergenic
1192015809 X:67329420-67329442 CAGCAAAAGCAGAACCAGTATGG - Intergenic
1192151441 X:68715154-68715176 AAGCAGAAGGAAAAAAAGTCAGG - Intronic
1193099714 X:77595321-77595343 AAGCAAATGTAGAATCACTCTGG - Intronic
1194737214 X:97526803-97526825 AAGCAGAAGCAGAGTGGGTGTGG - Intronic
1195028903 X:100907354-100907376 AAGAAAAAGAAAAATCAGTCAGG - Intergenic
1195329463 X:103785553-103785575 AAGAAGAAGGGGAAACAGTCAGG - Intronic
1196524873 X:116720135-116720157 AAGCAGAAGTTGAAACAGTTTGG + Intergenic
1198169275 X:134089916-134089938 AAGGTGAAGCAGAAGCAGGCAGG + Intergenic
1199284530 X:146041589-146041611 ATGCAGAAGCAGAGGCTGTCAGG + Intergenic
1199874364 X:151919470-151919492 AAGCAGAACCTGATTCAGTGTGG - Intronic
1200692607 Y:6321951-6321973 AACCAGAAGCAGATCCAGTTAGG - Intergenic
1200712829 Y:6504522-6504544 AACCAGAAGCAGATCCAGTTAGG + Intergenic
1200928632 Y:8676977-8676999 AAGCAGAAAAAGAATCATACAGG + Intergenic
1200981958 Y:9270688-9270710 TGGCAGAGGCAGAGTCAGTCTGG + Intergenic
1201021085 Y:9657518-9657540 AACCAGAAGCAGATCCAGTTAGG - Intergenic
1201042665 Y:9852775-9852797 AACCAGAAGCAGATCCAGTTAGG + Intergenic
1201146848 Y:11069493-11069515 GAGCAGGGGCAGAATCAGTGTGG - Intergenic
1202128455 Y:21589042-21589064 TGGCAGAGGCAGAGTCAGTCTGG - Intergenic