ID: 924598702

View in Genome Browser
Species Human (GRCh38)
Location 1:245469181-245469203
Sequence GAGTGCAGTAGGAAGACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924598702_924598709 15 Left 924598702 1:245469181-245469203 CCTGGAGTCTTCCTACTGCACTC 0: 1
1: 0
2: 1
3: 14
4: 174
Right 924598709 1:245469219-245469241 CAGAGAAACAGCGTCACTTGGGG 0: 1
1: 0
2: 2
3: 5
4: 163
924598702_924598708 14 Left 924598702 1:245469181-245469203 CCTGGAGTCTTCCTACTGCACTC 0: 1
1: 0
2: 1
3: 14
4: 174
Right 924598708 1:245469218-245469240 CCAGAGAAACAGCGTCACTTGGG 0: 1
1: 1
2: 1
3: 12
4: 157
924598702_924598706 13 Left 924598702 1:245469181-245469203 CCTGGAGTCTTCCTACTGCACTC 0: 1
1: 0
2: 1
3: 14
4: 174
Right 924598706 1:245469217-245469239 TCCAGAGAAACAGCGTCACTTGG 0: 1
1: 0
2: 11
3: 156
4: 829

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924598702 Original CRISPR GAGTGCAGTAGGAAGACTCC AGG (reversed) Intronic
903865199 1:26392749-26392771 GAGGGCAGGAGGAAGCCTCTTGG + Intergenic
904630909 1:31841508-31841530 GAGTGAAGCAGGAAAACTCAAGG + Intergenic
904674402 1:32189927-32189949 GCGTGGAGTAGCCAGACTCCAGG - Intronic
905625881 1:39490713-39490735 GACTGCACTGGGAAGGCTCCTGG - Intergenic
907114634 1:51958191-51958213 GGGTCCAGTAGGAAGATCCCAGG + Intronic
911104181 1:94117256-94117278 CAGTGCAGAAGGAAGAATCATGG - Intronic
911385845 1:97174452-97174474 GTGTGGAGTTGGAAGACTTCCGG - Intronic
912933352 1:113983040-113983062 GAGAGGAGGAGGAAGGCTCCAGG + Intergenic
913452094 1:118999439-118999461 GAGTGCAGGAGGAAAAGTCAAGG - Intergenic
916026990 1:160841553-160841575 GAGGGCAGTATGAACAGTCCTGG + Intronic
919056735 1:192580567-192580589 GGTTGTAGTAGGAAGACTTCTGG - Intergenic
919357926 1:196549868-196549890 GAGTTCAGTAGGAAATCTCATGG + Intronic
921320524 1:213934189-213934211 GGGTGCAGTGGGAAGAGTCGGGG - Intergenic
924598702 1:245469181-245469203 GAGTGCAGTAGGAAGACTCCAGG - Intronic
1063222864 10:3987153-3987175 GAGTGAAGGGGTAAGACTCCAGG - Intergenic
1063792090 10:9462913-9462935 GAGTGCAGTAGGCAGAATAATGG + Intergenic
1065576501 10:27125689-27125711 GAGTGCAGTGGGAACAATCTCGG + Intronic
1068506575 10:57908079-57908101 GAGTGCAGTAGCACGAATCTTGG + Intergenic
1070360756 10:75686291-75686313 GAATGCAGGAAGAAGACTCTGGG - Intronic
1070563903 10:77589398-77589420 TTGTGCAGTTGGAAGACTCTGGG - Intronic
1071083240 10:81838064-81838086 GTGTGCAGAAGAAAGACTCCTGG + Intergenic
1071268525 10:83985606-83985628 TAGTGCAGTAGTTAGAATCCCGG - Intergenic
1071648977 10:87377794-87377816 AAGTTCAGCAGGAAGACCCCGGG - Intergenic
1073797195 10:107001309-107001331 GAGTGCAATGGGAGGACTCTTGG + Intronic
1075633166 10:124013472-124013494 AAGTGCAGGGGGCAGACTCCAGG - Intronic
1075979279 10:126722878-126722900 GAGGGCAGCAGAAAGTCTCCAGG - Intergenic
1077213002 11:1382184-1382206 GGGTGCAGCAGGAAGCCCCCGGG + Intergenic
1077319868 11:1936365-1936387 GGGGGCAGGAGGAAGGCTCCAGG - Intronic
1079015732 11:16867093-16867115 GGGTGAAGTGGGAAGACACCTGG + Intronic
1079943555 11:26712976-26712998 GAGTCCACTAGGAAGACTTTTGG - Intronic
1080312512 11:30911595-30911617 GAGTGCTGGAAGAAGACTGCAGG + Intronic
1081589047 11:44408185-44408207 GAGATCTGTAGAAAGACTCCAGG - Intergenic
1086155000 11:83655962-83655984 CAGTGCAGTAGGAATTCTGCAGG + Intronic
1088423186 11:109670933-109670955 GAGTGCAGTAGTGAGATTTCAGG - Intergenic
1089336068 11:117724896-117724918 AAGTGCAGCAGGAGGACCCCAGG + Intronic
1089387559 11:118078269-118078291 GACTGGAGAAGGAAGACCCCTGG - Intronic
1089737144 11:120557279-120557301 GCGTGCAGCAGAAAGACTGCAGG - Intronic
1090084566 11:123640083-123640105 GAGAGCAGTCCGAAGGCTCCAGG + Intronic
1090996186 11:131867997-131868019 TAGTGAAGAAGCAAGACTCCAGG - Intronic
1091763116 12:3100690-3100712 CAGTGCAGAAGGATGACACCAGG - Intronic
1091812813 12:3414254-3414276 GAGTGCAGCAGGAAGAATCCAGG - Intronic
1091972219 12:4797035-4797057 CAGTGCAGTAGCCAGAGTCCAGG - Intronic
1094302986 12:28986789-28986811 TAGTGCAGTAGGGACACTCATGG + Intergenic
1094481126 12:30882216-30882238 GGGTGCAGTAGGAAGAAACTGGG + Intergenic
1094746048 12:33345654-33345676 GAGCGCAGTGGAAATACTCCGGG - Intergenic
1096513688 12:52145270-52145292 GACTGCAGCAGGAGGACTTCAGG + Intergenic
1097100639 12:56586366-56586388 GAGTGCAGTAGCGGGACTACAGG - Intronic
1098485557 12:71017443-71017465 CAGTACAGTTGGAAGCCTCCAGG - Intergenic
1101456497 12:104837202-104837224 CAGTCTAATAGGAAGACTCCTGG - Intronic
1102251117 12:111388178-111388200 GAGTGAAGGAGGAAGCCTCCTGG - Intergenic
1103841374 12:123867980-123868002 GAGAGCAGTACAAAGCCTCCAGG - Exonic
1105989045 13:25600091-25600113 GAGTACAGTAAGAAAACTCTAGG + Intronic
1108415344 13:50192685-50192707 GAATGGGGAAGGAAGACTCCTGG + Intronic
1110223951 13:73100055-73100077 GAGTGCTGTAGGAAGTTTCAAGG + Intergenic
1112610806 13:100952931-100952953 GAGGGCAGCAGGAAGACTGCTGG - Intergenic
1114150230 14:20030621-20030643 GAAAGTAGTAGGAAGACTCTTGG - Intergenic
1115235965 14:31208508-31208530 GAGTACAGTAGGACGTCTCCGGG - Intergenic
1117755649 14:58971573-58971595 GAGTCCAGGAGAAATACTCCAGG - Intergenic
1119874073 14:78042187-78042209 GAGTGGGGAAGGAAGACTACTGG + Intergenic
1121780336 14:96618033-96618055 GACTGCAGCAGGAGGGCTCCAGG + Intergenic
1121978714 14:98432791-98432813 GAGTGGAGTAGGAATAAGCCTGG + Intergenic
1122400609 14:101465207-101465229 CTCTGCAGTAGGAAGACTCCTGG + Intergenic
1123851954 15:24366697-24366719 GAGTGCAGCATGCAGACTCACGG - Intergenic
1123856879 15:24421626-24421648 GAGTGCAGCATGCAGACTCATGG - Intergenic
1123861439 15:24471523-24471545 GAGTGCAGCATGCAGACTCATGG - Intergenic
1124106462 15:26742263-26742285 CAGTGCAGTAAAAGGACTCCCGG - Intronic
1125394877 15:39235938-39235960 GAGAGCATTAGGAAGTGTCCTGG - Intergenic
1127707055 15:61557667-61557689 GGATACAGTAGTAAGACTCCTGG - Intergenic
1129334133 15:74842523-74842545 GTGTGCAGTAGGTAGACCCGGGG - Intronic
1132688119 16:1170744-1170766 GTGTGCAGGAGGAAGAGGCCAGG + Intronic
1133055729 16:3144611-3144633 GAGAGCAGCAGGAAGACTTTGGG - Exonic
1133072607 16:3256471-3256493 GTGTGCAGAAGGAGCACTCCAGG - Exonic
1133976972 16:10606416-10606438 GAATGCAGTAGGAAGCCTGCAGG - Intergenic
1134054657 16:11162181-11162203 GAGGGCAACAGGAAGACTCTGGG + Intronic
1135098226 16:19582439-19582461 GTGTCCAGTGTGAAGACTCCCGG - Intronic
1138678764 16:58670438-58670460 AAGTGTACTAGGAAGACCCCTGG - Intronic
1141603369 16:85139386-85139408 GGGAGCAGTAGGAATTCTCCTGG + Intergenic
1146634450 17:34493721-34493743 TAGTGCTGCAGGAAGATTCCAGG - Intergenic
1148503919 17:48112605-48112627 GAGTGCAGAATGAGGGCTCCTGG + Exonic
1148754884 17:49968383-49968405 GAGTCCAGTTGGATGGCTCCTGG - Intergenic
1148808922 17:50278387-50278409 GAGCTCAGTAGGAGGACTCTGGG - Intronic
1148844080 17:50518493-50518515 GAGGGCAGTAAGAAGGCTCTGGG - Intronic
1150449817 17:65257455-65257477 GAAGGCTGTAGGAAGAGTCCTGG + Intergenic
1152700711 17:81817576-81817598 GAGTGCAGGGGGAGGACCCCGGG - Intergenic
1153712922 18:7818472-7818494 GAGTCCAGTAGGAGGACACCAGG - Intronic
1153898694 18:9594618-9594640 CAATGCAGTAGGAAGAGTGCTGG + Intronic
1154960083 18:21299225-21299247 GAGTGCAGTAGGCACAATCTAGG - Intronic
1157822169 18:50780287-50780309 GAGTGCAGTGGCAGGAGTCCAGG + Intergenic
1157863571 18:51162158-51162180 CAGTGCACTGGGATGACTCCAGG - Intergenic
1158437856 18:57446541-57446563 TAGTGCAGTTAGAAGACTCCCGG - Intronic
1159861983 18:73660299-73660321 GTGTTCAGTAGGAAGACCCATGG - Intergenic
1159913707 18:74170142-74170164 GAGTGCCTTAGGAAGAGTCTTGG - Intergenic
1162790649 19:13061043-13061065 GGGTGCGTTAGGAATACTCCGGG + Intronic
1164020526 19:21300158-21300180 GAGTGCAGTGGCACGACGCCTGG - Intronic
1165040972 19:33067111-33067133 GAGTGCAGTGGGCAGTCTCAAGG - Intergenic
1167885049 19:52493339-52493361 GACTGCAGAGGGAAGACTACGGG - Intronic
1168707208 19:58476977-58476999 GAGAGCAGGAGGAAGCCTCAGGG - Intronic
925379207 2:3413059-3413081 TAGTGCAGAAGGACAACTCCGGG + Intronic
925580328 2:5403990-5404012 GAGGTCAGTAGGAAGAAACCAGG + Intergenic
927483186 2:23470305-23470327 GAGTGCAGAAAGAAGTGTCCAGG + Intronic
927996935 2:27493490-27493512 GAAGGCAGAAGGCAGACTCCAGG + Intronic
927998888 2:27506247-27506269 GAGTGCAGCAGGAAAGCACCAGG - Intronic
929604422 2:43225634-43225656 GAGTGCCGTCGGAGGAATCCCGG + Exonic
930317340 2:49813692-49813714 GAATGCAGTGGGAAGATTCCAGG - Intergenic
932655945 2:73611239-73611261 GAGTGCAGGCTGAAGAATCCAGG + Intergenic
934713700 2:96531227-96531249 GAGGCCATTAGGAAGTCTCCGGG + Intergenic
937499872 2:122466678-122466700 GAGTGAAGGAGGCAGAGTCCCGG + Intergenic
937678439 2:124617855-124617877 GTGTGCAGTGGGAAGGCTACTGG + Intronic
940537892 2:154969471-154969493 TAGAGCAGTAGAAAGTCTCCTGG - Intergenic
941130084 2:161637247-161637269 GAGTGCAGTAGCATGATTCTTGG + Intronic
944770689 2:202911613-202911635 GAGGGCAGAAGGCAGAGTCCAGG - Exonic
1172292790 20:33788369-33788391 GAGTGCAGTGGCAAGATTTCAGG - Intronic
1173993967 20:47323753-47323775 GAGTGCAGTTGGAGGAGTCCTGG - Intronic
1175742070 20:61426462-61426484 GAGGGCTGTAGGTAGACTCTGGG + Intronic
1176871692 21:14087685-14087707 GCCTGCATTAGGAAGCCTCCAGG - Intergenic
1177693835 21:24546008-24546030 GAGTCCAGTGGGAAGTCTCCAGG - Intergenic
1179067165 21:38036336-38036358 GAGTGTATTAGGAAGAGTCTTGG - Intronic
1182411355 22:30189652-30189674 GAATGAAGGAGGAAGACTCAGGG - Intergenic
961317816 3:126052483-126052505 GAGAGCAGGAGGAAGGCTGCTGG - Intronic
962338834 3:134563720-134563742 GAGTGCAGTAAGAAGCCTTGGGG - Exonic
963779904 3:149476506-149476528 GAGTGCAGTGGAAAGAATGCTGG + Intronic
967962855 3:194939634-194939656 GGATGGAGTAGAAAGACTCCAGG + Intergenic
971256027 4:25014180-25014202 GAGTGCAGTAGGGAGGCTAATGG - Intronic
973330425 4:48906429-48906451 GACTCCAGTAGGCTGACTCCCGG - Intronic
973781166 4:54289379-54289401 GTGTGCAGTTAGAAGACTCAGGG + Intronic
974699389 4:65419677-65419699 GGGAGTAGTAGGAAGACTCATGG + Intronic
975286550 4:72628215-72628237 GAGTGCAATAGGAAGACAACAGG - Intergenic
979570303 4:122215571-122215593 GTTTGCAGTAGGCAGAGTCCAGG - Intronic
981644191 4:146979943-146979965 GAGAGTATTAGGAACACTCCGGG - Intergenic
982224636 4:153154257-153154279 GACTGCAGTAGTTAGACTTCAGG - Intronic
982648220 4:158050978-158051000 GACTGCAGAAGGAAGACTAAAGG + Intergenic
982680220 4:158419400-158419422 GAGTGGGGTGGGAAGCCTCCTGG - Intronic
983228584 4:165107816-165107838 GAGTGCAGTAGGAATGATGCTGG - Intronic
983287354 4:165756216-165756238 GAGAGCAGTTAGTAGACTCCTGG - Intergenic
985923497 5:2997778-2997800 GAATTCAGAAGGAAGATTCCCGG + Intergenic
986016334 5:3760809-3760831 GAATCCAGAGGGAAGACTCCAGG + Intergenic
986268105 5:6207869-6207891 GGGTGGAATAGGAAGATTCCAGG - Intergenic
988596211 5:32593742-32593764 GAGTGCAGTAGCACGAATCTCGG + Intronic
992533038 5:77670798-77670820 GAGAGTTGTAAGAAGACTCCTGG - Intergenic
992890608 5:81200772-81200794 GGGTGAATTAAGAAGACTCCAGG + Intronic
993767546 5:91879702-91879724 GAGTGCAGTGGTGTGACTCCTGG + Intergenic
996756108 5:126936924-126936946 TGGTTCAGTAGGAAGACTCCTGG + Intronic
998540840 5:142980019-142980041 GAGTGCACTAGGGAGCCTTCTGG - Intronic
999068047 5:148713137-148713159 GAGTGAAGTAGGCTGAATCCTGG + Intergenic
999483776 5:151972626-151972648 GCCTGCAGTTGGAAGATTCCAGG - Intergenic
999657454 5:153824777-153824799 GAGTGGAGTGGGAAGATTTCTGG - Intergenic
1003750934 6:9055035-9055057 GAGGACAGTAGGAAAACTGCTGG + Intergenic
1004134205 6:12950835-12950857 AACTGCAGTAGGAAGAGGCCTGG - Intronic
1004311200 6:14546781-14546803 GAGTGAAGTAGGAGAACCCCAGG - Intergenic
1006113452 6:31762779-31762801 TGTTGCTGTAGGAAGACTCCCGG + Exonic
1007758675 6:44118484-44118506 GAGTGCGGTTGGAACACTCTTGG - Intronic
1008035209 6:46737938-46737960 GATTGCAGTAGGAAGTCTGGAGG + Intergenic
1012644881 6:101666219-101666241 GAGTGCATAGGGAAGAGTCCAGG + Intronic
1014329618 6:120045820-120045842 GAGTGCAGAAGAAAGAATCGTGG + Intergenic
1014537087 6:122627190-122627212 GAGTGCAGTAGGCACAATCTCGG - Intronic
1017291591 6:152744408-152744430 GAGTACACTAGGAAGGGTCCAGG + Intergenic
1018838555 6:167502948-167502970 GAGAGCAGTAGGAACAGTACAGG + Intergenic
1021593285 7:22288198-22288220 GAGGGCAGTAGGGAGACTAGAGG - Intronic
1022399880 7:30026987-30027009 GAGAGACGTAGGAAGAGTCCCGG + Intergenic
1023132319 7:37015187-37015209 CAGTCCTGTAGGAAGAGTCCGGG + Intronic
1023908922 7:44540465-44540487 GTGGGGAGTAGGAAGCCTCCTGG + Intronic
1029380229 7:100209507-100209529 GAGTGCAGTAGGAAAACCATTGG + Intronic
1032262196 7:130346817-130346839 GAGTCCAGGAGGAAGCCCCCGGG + Intronic
1032428222 7:131838810-131838832 AAGTGCAGTGAGAGGACTCCAGG - Intergenic
1032901297 7:136311707-136311729 TAGTGGAGTGCGAAGACTCCTGG + Intergenic
1033573629 7:142658437-142658459 GAGGGCAGAAGGAAAAATCCTGG - Intergenic
1033902837 7:146163694-146163716 GAGTGCAGTGGCAAGATTTCAGG - Intronic
1034377478 7:150658846-150658868 GAGAGTAGTAGGAGGAATCCAGG - Intergenic
1035107826 7:156456951-156456973 GAGTGGAGTCAGAAGCCTCCAGG - Intergenic
1035492608 7:159293514-159293536 GTTTGCAGTTGGAAGCCTCCAGG + Intergenic
1036141888 8:6216497-6216519 GATTTCAGGATGAAGACTCCAGG - Intergenic
1038263229 8:26016249-26016271 GTGTGCAGTTGGTAGACTCTGGG - Intronic
1039377190 8:37046382-37046404 GAGGGAAGTAGAAAGACTTCTGG + Intergenic
1040312069 8:46241951-46241973 GAGAGAAGTAGCAAGATTCCAGG + Intergenic
1041609913 8:59833516-59833538 GAGGGCAGTTGGAAGGCTACTGG + Intergenic
1046606573 8:116378104-116378126 CAGTGTAGTGGGAAGAATCCTGG - Intergenic
1052886229 9:33650816-33650838 GAGGGCAGAAGGAAAAATCCTGG - Intergenic
1053357438 9:37458338-37458360 GAATGCAGGAGGAAAACTTCAGG - Intronic
1056226486 9:84500649-84500671 GAGTGCAGTTGCATGACTCCTGG + Intergenic
1059425030 9:114215645-114215667 GAGTGCAGCAGGAAGGATGCAGG + Intronic
1059767077 9:117393798-117393820 GGGTGCAGTGGGGAGACTCTAGG + Intronic
1060488752 9:124066226-124066248 GAGTGCAGTGGCACGACTCTCGG - Intergenic
1061248505 9:129413634-129413656 GGGTGCAGGAGGAGGACGCCCGG + Intergenic
1192178380 X:68899919-68899941 GAGTGCAGTGGGAACAATCATGG + Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1193578446 X:83232380-83232402 GAGTGAAGTGAGAAGCCTCCTGG + Intergenic
1197783621 X:130179534-130179556 GAGGTCAGTAGGAAGACAGCAGG - Intronic
1199541139 X:148959150-148959172 GAGTCCAGCAGGAGGCCTCCTGG + Intronic
1199979325 X:152912249-152912271 GACTCCAGTCAGAAGACTCCGGG - Intergenic