ID: 924599505

View in Genome Browser
Species Human (GRCh38)
Location 1:245476093-245476115
Sequence GATGCATGCTGCCATGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 270}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924599503_924599505 -1 Left 924599503 1:245476071-245476093 CCACAAAAAGGAATAAAGTGCTG 0: 4
1: 16
2: 152
3: 652
4: 2276
Right 924599505 1:245476093-245476115 GATGCATGCTGCCATGTGGATGG 0: 1
1: 0
2: 2
3: 34
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924599505 Original CRISPR GATGCATGCTGCCATGTGGA TGG Intronic
900665724 1:3814289-3814311 CATCCAGGCAGCCATGTGGAGGG - Exonic
901420453 1:9147146-9147168 GAAGCATCCTGCCAAGTGCAAGG + Intergenic
901914820 1:12490533-12490555 GATGCATGTGGCCAAGAGGAGGG + Intronic
901990947 1:13113505-13113527 GATGCATGCCACCATGTGTAGGG + Intergenic
902810491 1:18885394-18885416 GATGTCTGCTGCCATGGGTAGGG + Exonic
903743870 1:25573857-25573879 CATGCATCCTGGCATGTGGTGGG - Intergenic
904794537 1:33049397-33049419 GATGCACGCTGCCAGGTAGGGGG - Intronic
905338312 1:37260475-37260497 GGGCCATGCTGCCATGTGGTGGG + Intergenic
907069150 1:51518825-51518847 GATGCGTGCGGCCCTGTGGGAGG + Intronic
907919216 1:58897025-58897047 GAAGAAAGCTGCCTTGTGGAGGG + Intergenic
910089491 1:83445528-83445550 GATACATGCTGGAATGTTGATGG + Intergenic
910830961 1:91462435-91462457 GATGAATGGTGCCATATCGAGGG + Intergenic
910899189 1:92101346-92101368 GATGGCTGGAGCCATGTGGATGG - Intronic
912067151 1:105757938-105757960 GATGAATGGTGCCATATTGAGGG - Intergenic
917839540 1:178966529-178966551 GCTGCATGGTGCCCTGGGGATGG + Intergenic
918159064 1:181880320-181880342 CATGCAGCCTGCCATGTGAAAGG - Intergenic
918286070 1:183056176-183056198 GCTGCCTGCTGCCATGTGTCAGG + Intronic
918816070 1:189185738-189185760 GGTGCTTTCTGCCATGTTGAAGG + Intergenic
919205855 1:194420943-194420965 GATGCAAGCTGCAGTGGGGAAGG - Intergenic
921005431 1:211088379-211088401 AAAGTATGCTGCCATGTGGCTGG - Intronic
921955566 1:220980129-220980151 GAAGCATGCTGCCATCTGCCTGG - Intergenic
922096319 1:222445940-222445962 GACTCATGCTGCCATGTGCATGG - Intergenic
924599505 1:245476093-245476115 GATGCATGCTGCCATGTGGATGG + Intronic
1065366760 10:24944457-24944479 CATGCCCGCTTCCATGTGGAGGG - Intronic
1067715783 10:48690469-48690491 GAGGGATGCAGTCATGTGGAGGG + Intronic
1072188468 10:93062856-93062878 GATGCGCGCGGCCATGCGGAAGG - Exonic
1073078287 10:100838444-100838466 GATGCAGGTTGACCTGTGGAAGG + Intergenic
1073101472 10:101008880-101008902 GATGCAGGGTGACATGAGGAGGG - Intronic
1074105467 10:110386356-110386378 GATACATGCTGCAACATGGACGG - Intergenic
1075327344 10:121544518-121544540 GATTCATGCTACAATATGGATGG + Intronic
1075422427 10:122311943-122311965 GCTACATGCAGCCACGTGGATGG - Intronic
1075584335 10:123646211-123646233 GACCCCTGCTGCCTTGTGGATGG + Intergenic
1076288043 10:129320585-129320607 GATGCAGGCAGTAATGTGGATGG - Intergenic
1076408999 10:130232648-130232670 GATGCCAGCTGCCCTGGGGAAGG + Intergenic
1076919345 10:133443244-133443266 GAAGCAGGCGGCCATGTGGAGGG - Intergenic
1077433572 11:2527695-2527717 AACACATGCTGCCACGTGGATGG - Intronic
1079166756 11:18051231-18051253 GATACATGCTGCAACATGGATGG + Intergenic
1081601153 11:44495313-44495335 TATGCAGGCTCCTATGTGGATGG - Intergenic
1085405762 11:76260877-76260899 GATACATGCAGCCACTTGGACGG + Intergenic
1085525037 11:77159204-77159226 CAGGCATGGTGCCATGTGCAGGG + Intronic
1085540656 11:77265961-77265983 GAAACATGCTGCTATTTGGATGG - Intronic
1085801300 11:79592438-79592460 GATGCATAGTGTCTTGTGGAGGG + Intergenic
1088836793 11:113584342-113584364 GAGGAATGCTGCCATATCGAGGG - Intergenic
1089067261 11:115671159-115671181 GCTGCATGCTACCATGTGGCCGG + Intergenic
1091024608 11:132131017-132131039 TTTGCATGCTGTCATGTGCAAGG + Intronic
1091605295 12:1946538-1946560 GCTCCATGCTGCCATGTGTCTGG - Intronic
1093866444 12:24232898-24232920 GTAGATTGCTGCCATGTGGAAGG - Intergenic
1098224802 12:68310503-68310525 AATCCAGGCTGCCATCTGGAAGG - Intronic
1098802944 12:74985187-74985209 GAGGAATGCTGACAAGTGGAGGG + Intergenic
1100715099 12:97296993-97297015 GATGCAGGCTGCCCTGGGGTTGG + Intergenic
1101264272 12:103067077-103067099 GAGGAATGGTGCCATGTTGAGGG - Intergenic
1101722520 12:107362443-107362465 GATGTTTCCTGCCACGTGGAGGG - Intronic
1101953202 12:109192192-109192214 GATCCATGCTGACTTGTGTAAGG + Intronic
1103216063 12:119202298-119202320 GAGGAAGGCAGCCATGTGGAAGG + Intronic
1103396668 12:120612409-120612431 GAGGAATGCTGCCATATCGAGGG - Intergenic
1103403621 12:120659784-120659806 AGTGCCTGCTGCCACGTGGATGG + Intronic
1104936796 12:132368937-132368959 AATGCAGGCTGCAAGGTGGATGG - Intergenic
1105623474 13:22090963-22090985 ATTGTATGCTGCCATGTGGGTGG + Intergenic
1105732557 13:23232876-23232898 AATGGATTCTTCCATGTGGATGG + Intronic
1106806954 13:33319233-33319255 GATGCATGTTACAATATGGATGG + Intronic
1108216831 13:48193703-48193725 GATTCATGCTATGATGTGGATGG - Intergenic
1108559369 13:51627719-51627741 GAGGCATGCAGGCAAGTGGAGGG + Intronic
1110789047 13:79567342-79567364 GATGTTTCCTTCCATGTGGAGGG + Intergenic
1111012382 13:82328826-82328848 TCTTCATGCTGCCATTTGGAAGG + Intergenic
1111959425 13:94793776-94793798 GATACACGCTACAATGTGGATGG + Intergenic
1112212995 13:97399846-97399868 AGTGCTGGCTGCCATGTGGAGGG - Intergenic
1112369819 13:98784774-98784796 GAACAATGCTGCCATGTGGGCGG - Intergenic
1114452467 14:22836388-22836410 GGTGCAGGCTGCCATCTGCAGGG - Intergenic
1114528354 14:23380025-23380047 CATGCATGCTCCCATGAGGAAGG - Intergenic
1115328511 14:32168425-32168447 AATGCATGCTGCCATGGGGCTGG + Intergenic
1117197270 14:53353171-53353193 GAGGCTTGCTGCTATGTAGACGG - Intergenic
1117710301 14:58521542-58521564 GATACATGCTGACATTTCGAGGG - Intronic
1119084002 14:71723130-71723152 AATGCCAGCTGCCATGGGGAAGG + Intronic
1119998859 14:79280462-79280484 GATGCTTGCTGCCATGGAAATGG - Intronic
1120358550 14:83464818-83464840 GGTGCATGTTGGCATGTGGGTGG + Intergenic
1120845902 14:89124723-89124745 GATGCATGCTACAACCTGGATGG - Intergenic
1120859818 14:89245012-89245034 GATACATACTGTCAGGTGGATGG + Intronic
1121212899 14:92222318-92222340 GATCCATGCTACAATGTGAATGG + Intergenic
1121366373 14:93315709-93315731 GATAAATGCTACAATGTGGATGG - Intronic
1121824595 14:97000160-97000182 GATGTATGCAGACAAGTGGAGGG + Intergenic
1122754893 14:103970496-103970518 GTTGCCTGATGCCATGTGGGGGG + Intronic
1123216623 14:106814048-106814070 GAAGTATGCAGCCATGTGGAGGG - Intergenic
1124436354 15:29652382-29652404 GAGGCATGCAGACAAGTGGAGGG - Intergenic
1124846936 15:33300478-33300500 GATGCTGGTTGTCATGTGGAAGG - Intergenic
1126156828 15:45573825-45573847 GATGTATGCAGACAAGTGGAGGG + Intergenic
1129860391 15:78856109-78856131 GATACATGCTACCATATGGATGG + Intronic
1131019419 15:89085904-89085926 CATGCATGCAGCCATGTGTATGG + Intergenic
1132952714 16:2573263-2573285 CATGCACGCTGCCATGCAGATGG + Intronic
1132961637 16:2626907-2626929 CATGCACGCTGCCATGCAGATGG - Intergenic
1133070051 16:3240219-3240241 GACACATGCTGCAACGTGGATGG + Intergenic
1133157493 16:3885343-3885365 GGTGCAGCCTCCCATGTGGACGG - Intergenic
1133302502 16:4791244-4791266 AAAGCATGCTGTCATCTGGAAGG + Intronic
1135504465 16:23024208-23024230 GATACATGCAACCATTTGGATGG - Intergenic
1135569821 16:23540489-23540511 GATGGATACTGCCAAGTGGCTGG - Intronic
1136274074 16:29167891-29167913 GCTGCAAGCTGCCATCTGGGAGG - Intergenic
1136872784 16:33823975-33823997 GAGGTATGCAGCCATGTGGTGGG + Intergenic
1137656354 16:50162102-50162124 GATACATGCAGCAATTTGGATGG - Intronic
1138231874 16:55343780-55343802 GATGCAGGCTTCCCTGGGGAGGG - Intergenic
1138529812 16:57628785-57628807 GGTACCTGCTGCCAGGTGGAGGG - Intronic
1138554740 16:57764800-57764822 GATGGATGGGGCCATGTGGGTGG + Intronic
1141902939 16:87004474-87004496 GACCCATGCTGCAACGTGGATGG - Intergenic
1203099388 16_KI270728v1_random:1292079-1292101 GAGGTATGCAGCCATGTGGTGGG - Intergenic
1142534760 17:606468-606490 GTTACGTGCTGCCATGAGGATGG + Intronic
1145868081 17:28253410-28253432 TAGGCCTGCTGCCATGGGGAAGG + Intergenic
1147163413 17:38580443-38580465 GAAGCATGCAGCCATGAGGCAGG - Intronic
1148217559 17:45841491-45841513 GATACCTGCTACCATGTGGATGG - Intergenic
1149286537 17:55171612-55171634 GATACATGGTGCCATGTACATGG + Intergenic
1149526846 17:57363198-57363220 GATAGATGCTACAATGTGGATGG + Intronic
1150381772 17:64726504-64726526 GATCCATGCAACAATGTGGATGG + Intergenic
1150774492 17:68068386-68068408 GATCCATGCAACAATGTGGATGG - Intergenic
1151503978 17:74514066-74514088 GATGCATGATGTCATGTGATGGG + Intergenic
1152124740 17:78439633-78439655 GATACATGCTACAACGTGGATGG - Intronic
1153906311 18:9664757-9664779 GACACATGCTACAATGTGGATGG - Intergenic
1154046402 18:10909561-10909583 GATGCATGCTGACCTATGTAGGG + Intronic
1155337855 18:24783713-24783735 GAGGCAGCCTGCCATGTGGAAGG - Intergenic
1155717497 18:28963458-28963480 GATACATGCAACAATGTGGATGG - Intergenic
1157434159 18:47654467-47654489 ATTGCTTGCTGCCATCTGGAAGG + Intergenic
1157906888 18:51577185-51577207 CATTCATGCTGCCAGGTGAATGG + Intergenic
1158217309 18:55113498-55113520 TATGCATGTTGCAAGGTGGAAGG - Intergenic
1160160434 18:76466405-76466427 CACCCATGCTGCCACGTGGACGG + Intronic
1160530453 18:79559296-79559318 GATGGCATCTGCCATGTGGACGG + Intergenic
1160750125 19:730041-730063 GAAGCAGGCTGCCCTGGGGAGGG - Intronic
1163147894 19:15394257-15394279 GATACATGCTACAATGTGGCTGG + Intronic
1163432501 19:17276650-17276672 GGTGCCTGCAGCCATGAGGATGG + Intronic
1164565472 19:29323121-29323143 GATGCATGCAGCAATGTTGGCGG + Intergenic
1164759949 19:30721166-30721188 GATACATGCTACCAAGTGGCTGG - Intergenic
1165223110 19:34333791-34333813 GAGGCACGTTACCATGTGGATGG - Exonic
1165239998 19:34458636-34458658 GATCCATTTTGCCATCTGGACGG + Intronic
1166050812 19:40257832-40257854 GAGACATGCTGCCATGTGGAGGG + Intronic
1166054605 19:40280809-40280831 GATGCATGCGGCTGTGGGGAGGG - Intronic
1168113904 19:54210106-54210128 CAGGCATGCTGCCAGGAGGAGGG + Intronic
924986432 2:274687-274709 GTTGCCTGCCCCCATGTGGAAGG + Intronic
926098096 2:10095631-10095653 GAAGAATGCTGCCATTTGGAAGG - Intergenic
926337934 2:11878362-11878384 CCTGCATGCTGCCATGATGATGG - Intergenic
927151313 2:20198102-20198124 GATACCTGCTGTCATGTGGCAGG + Intergenic
928425934 2:31177749-31177771 GCTGCACGCTGCCATGAGGGAGG - Exonic
928441843 2:31298649-31298671 GATGCCTGCTACAAGGTGGATGG + Intergenic
929393753 2:41499051-41499073 CACTCATGCTGCCATTTGGAAGG + Intergenic
930717353 2:54605274-54605296 GGTACATGCTTCCATGTGAAAGG - Intronic
930881458 2:56275245-56275267 TATTCATGCTGCCATGTAGCTGG - Intronic
931557336 2:63519416-63519438 AGTACATGCTGCCATGTGGCTGG + Intronic
931809124 2:65837258-65837280 GATACCTTCTGCCATGAGGAGGG + Intergenic
931875660 2:66508987-66509009 GCTGCCTGCTGCCGTGTGGTCGG + Intronic
933091611 2:78126229-78126251 GATGCATGCTGTCCTGTGTCTGG + Intergenic
934063347 2:88317584-88317606 AATGAATGCTGCCACTTGGAGGG - Intergenic
934165331 2:89289016-89289038 CATACATGTGGCCATGTGGAAGG + Intergenic
934201943 2:89893446-89893468 CATACATGTGGCCATGTGGAAGG - Intergenic
934566555 2:95344757-95344779 GATGCAGGCTGGCACGTGGCAGG - Intronic
935391696 2:102559687-102559709 GATGTAGGCTGCCCTGGGGAAGG + Intergenic
935862694 2:107350193-107350215 GATGAATGCTGCCCTGAGGGTGG + Intergenic
936089331 2:109490799-109490821 GATGCAGGGTGCCATGGGGATGG + Exonic
938387349 2:130876281-130876303 CATGAATGCTGCCGAGTGGATGG + Intronic
939196013 2:138973505-138973527 AAGGCATTCTGCTATGTGGAGGG + Intergenic
939721220 2:145654368-145654390 TAAGCATTCTGTCATGTGGAGGG + Intergenic
940783328 2:157956659-157956681 GATACATGCTACGATATGGATGG + Intronic
941404518 2:165071776-165071798 GATGCATGCTACTATGTGCCTGG + Intergenic
941668156 2:168262088-168262110 GAGGAATGGTGCCATGTGGAGGG - Intergenic
944566359 2:200995544-200995566 GAAGCAAGCTGCCATGTTGTAGG + Intronic
944901746 2:204223040-204223062 GAGGCATGCAGACAAGTGGAGGG + Intergenic
944914737 2:204346749-204346771 GATGTATGATGCCATGTCAAAGG - Intergenic
946365657 2:219247488-219247510 CAAGCATGCATCCATGTGGAGGG + Exonic
947061932 2:226176633-226176655 GTTCCATGCTGCCATGTGCTAGG - Intergenic
948004958 2:234600575-234600597 GACACATGCTACAATGTGGATGG + Intergenic
1168926205 20:1581548-1581570 CATGCAGGAAGCCATGTGGAAGG - Intronic
1169567820 20:6874810-6874832 GATGCAGGCTGCTCTGGGGAGGG + Intergenic
1170113866 20:12836093-12836115 GATGCTTGCTGGCATTTGGAAGG - Intergenic
1170868414 20:20181688-20181710 GATGGAAGAAGCCATGTGGATGG + Intronic
1171395781 20:24832255-24832277 GCTCCAGGCTGCCATGGGGAAGG - Intergenic
1174817788 20:53701676-53701698 GACGCATGCCGCAATTTGGATGG - Intergenic
1175331497 20:58167942-58167964 GAAGCATGGTGCTATGGGGAAGG + Intergenic
1175773581 20:61638968-61638990 AATGAATGACGCCATGTGGAGGG + Intronic
1175793624 20:61757712-61757734 GATTCTTGCTGCCATGTGGAGGG + Intronic
1182071963 22:27470073-27470095 GATGCATGCTGGATAGTGGATGG + Intergenic
1183291795 22:37007015-37007037 GCTGGATCCTGCCATGTGAATGG + Intronic
949966074 3:9357429-9357451 GATGCATGCTACAATATGGATGG - Intronic
950825963 3:15821729-15821751 CATGGATGCTGCCATGTAGGGGG - Intronic
951539470 3:23768610-23768632 GATGCATGCTACAGTGAGGATGG + Intergenic
954984535 3:54778083-54778105 TTTGCCTTCTGCCATGTGGAAGG - Intronic
955170197 3:56556737-56556759 GATACATGCTGCAATGTTAAAGG + Intergenic
956031375 3:65041422-65041444 GCTTCATGCAGCCATGTGGGGGG - Intergenic
957468918 3:80632678-80632700 GCAGCATGCTGCCTTGAGGAGGG + Intergenic
958779173 3:98521344-98521366 AATGGAGGCTGCCATGTAGATGG + Exonic
959377331 3:105602732-105602754 GAGGAATGGTGCCATATGGAGGG + Intergenic
961181719 3:124883117-124883139 GCTGCACACTGCCATGTGAAAGG + Intronic
961247650 3:125469720-125469742 GATGCTTGCTGCTAAGCGGAAGG + Intronic
962394374 3:135002111-135002133 GATGTATGCTGTAATATGGATGG + Intronic
963024943 3:140910448-140910470 GATACATGCTACCACATGGATGG + Intergenic
963379110 3:144506325-144506347 GAAGAATGGTGCCATATGGAGGG + Intergenic
964195245 3:154056735-154056757 CATGCATGCTGCAATGTGAGGGG - Intergenic
964678396 3:159309570-159309592 GATTCCTGCTCACATGTGGAAGG + Intronic
965498568 3:169429419-169429441 GATGCAAGCTGCAAAATGGAAGG + Intronic
968057239 3:195701605-195701627 GATGCCTGCTGCCACGTGGCTGG + Intergenic
968141444 3:196261020-196261042 GATACATGCTACCACTTGGATGG + Intronic
969608728 4:8215506-8215528 GAAGCCTGCTGCCCTCTGGATGG - Intronic
970755519 4:19421367-19421389 GATGTCTGCTGCAATGTGGAGGG - Intergenic
970931844 4:21521121-21521143 GTTGGATGCTGCCCTGTGGAAGG - Intronic
971484696 4:27147361-27147383 GACCCATGGTTCCATGTGGATGG + Intergenic
972148429 4:36059294-36059316 ATTGCATGCTACTATGTGGAAGG - Intronic
973870185 4:55158236-55158258 CACACATGCTGCCATGTGGTTGG - Intergenic
974539090 4:63210013-63210035 GAGACATGCTGCAATATGGATGG + Intergenic
976110341 4:81666593-81666615 GATGCATGCAACTATGTGGTTGG + Intronic
977218978 4:94316331-94316353 GATAGACGTTGCCATGTGGAAGG - Intronic
977934802 4:102789320-102789342 GATGCATGCTATAATGTGGATGG - Intergenic
982847915 4:160275259-160275281 GAGGAATGGTGCCATATGGAGGG - Intergenic
983050959 4:163047425-163047447 GATTCAGGCTGCCCTGGGGAAGG + Intergenic
983096844 4:163572715-163572737 GTTTCATGTTTCCATGTGGAGGG + Intronic
983412733 4:167420080-167420102 TAATCATGCTGCCATTTGGAAGG + Intergenic
984173821 4:176391669-176391691 GATCCATGCTGCCAAGAAGAGGG + Intergenic
985096416 4:186416973-186416995 GATGCATGCCACCCTGTGGCAGG - Intergenic
985609335 5:878223-878245 GACCCAGGCTGCCATATGGACGG + Intronic
985665135 5:1178212-1178234 GATGCACGCTGACTCGTGGACGG - Intergenic
987504523 5:18750796-18750818 GAGGAATGCTGCCATATCGAGGG - Intergenic
987860425 5:23479699-23479721 GATTCATGCTGATATATGGAAGG - Intergenic
988922044 5:35952411-35952433 CATGCTTGCAGCCCTGTGGAGGG + Exonic
991408971 5:66328337-66328359 GCTGCATCCTCCCATGTGGAAGG - Intergenic
991588172 5:68220716-68220738 GTTGCATGCTGCCATGCTCAGGG - Intronic
992708468 5:79423465-79423487 AATCCATGGTGCCATCTGGAAGG + Intronic
993323776 5:86508431-86508453 GATTAATGCTGTGATGTGGAAGG - Intergenic
994692500 5:103035241-103035263 GATGCTGGCTGCCATGGGGGAGG - Intergenic
997054374 5:130423293-130423315 GTTACATCCTGCCATGTGCAAGG - Intergenic
997935685 5:138108740-138108762 ATTGCATGCGGCCAAGTGGAGGG - Intergenic
999446416 5:151643731-151643753 GACACATGCTACCATGTGGATGG - Intergenic
1000106840 5:158067919-158067941 GATTCATGCTGCCCTTTTGATGG - Intergenic
1000367774 5:160506848-160506870 GATGCAGGTTGCCATGGTGACGG - Intergenic
1001800204 5:174536947-174536969 AATGGATGCTGCAATGTTGAAGG + Intergenic
1002431047 5:179204033-179204055 TACACATGCTGCAATGTGGATGG + Intronic
1002446995 5:179295918-179295940 GAAGGAGGCTGCCATGAGGAGGG + Intronic
1002463428 5:179388525-179388547 GACGCATGCTGCCACGGGGTGGG + Intergenic
1002939903 6:1706841-1706863 GCTGCATGGTGGCATTTGGAAGG + Intronic
1003226592 6:4211489-4211511 GAGGCATGATGCAAAGTGGAGGG + Intergenic
1004217411 6:13715626-13715648 GAAGCAAGCTGCCATGTTGAAGG - Intergenic
1004907139 6:20246808-20246830 GATGCATGCAGCCACTTGGATGG + Intergenic
1007650015 6:43413493-43413515 GAGGCATGCAGACAAGTGGAGGG - Intergenic
1007827836 6:44614593-44614615 GAAGCAAGCTGCCATGTTGTGGG - Intergenic
1009845181 6:69125545-69125567 GAGGCCTGCTTCCACGTGGAAGG - Intronic
1010573760 6:77508380-77508402 TACTCATGCTGCCATTTGGAAGG - Intergenic
1010950612 6:82032945-82032967 GATTCCAGCTGCCATGTGGAGGG + Intergenic
1013173436 6:107657868-107657890 TAAGCATGCAGTCATGTGGAGGG + Intronic
1013460176 6:110367112-110367134 GATGCAGGGTGGGATGTGGATGG + Intergenic
1016187970 6:141221373-141221395 GATGCAAGATGCCATGTCCAGGG + Intergenic
1016190937 6:141263269-141263291 GATGCATGCTACAACATGGATGG + Intergenic
1017216995 6:151920194-151920216 CATTCATGCTGCTATGTTGATGG - Intronic
1017708001 6:157142057-157142079 GATGCATGCAACGGTGTGGATGG + Intronic
1022039437 7:26566123-26566145 GAAGCAAGCTGCCATGTTGTGGG - Intergenic
1022303205 7:29121040-29121062 GATGGTTGGTGCCATGTGGAAGG - Exonic
1022448376 7:30489936-30489958 GATACATGATACAATGTGGATGG + Intergenic
1023126037 7:36955128-36955150 GATGCCTTCCGCCATGTAGAGGG - Intronic
1023674473 7:42615883-42615905 CATGAAGGCTGCCATTTGGAAGG - Intergenic
1023769332 7:43540713-43540735 GGTCCATGCTGGCAGGTGGAGGG - Intronic
1024212623 7:47218701-47218723 AATGCAAGCTGCCAAGGGGAGGG + Intergenic
1026896044 7:74010642-74010664 CATGCAAACGGCCATGTGGACGG - Intergenic
1027406924 7:77872047-77872069 GAGGAATGGTGCCATATGGAGGG + Intronic
1028850083 7:95528089-95528111 GTTCCAGGCTGCCTTGTGGAGGG - Exonic
1029471000 7:100754123-100754145 GATGCATGCTACAGTATGGATGG - Intronic
1029529760 7:101117501-101117523 GAAGCCTGCTCCCATATGGAGGG + Intergenic
1030233510 7:107233442-107233464 GTTGCAGGGTGCCATCTGGAGGG - Intronic
1031763673 7:125746940-125746962 GATGCATGCTGACTTGGAGAAGG + Intergenic
1034319884 7:150170216-150170238 GTTGCAAGCTGCCCTGTGGAGGG - Intergenic
1034772864 7:153797007-153797029 GTTGCAAGCTGCCCTGTGGAGGG + Intergenic
1034925559 7:155118720-155118742 GGTGCATGCGGTGATGTGGAGGG + Intergenic
1035147344 7:156832586-156832608 GATACATGCTGCATTGTGGATGG - Intronic
1035276520 7:157751194-157751216 GAGACATGCTGACATGTGAAGGG + Intronic
1036461398 8:8956504-8956526 GATGCATGGTACAATGTGGATGG - Intergenic
1036618060 8:10404126-10404148 GATGCATTGTGACATGCGGAGGG - Intronic
1038169062 8:25112229-25112251 GATGCATGTTGCCATTCAGAAGG + Intergenic
1038569886 8:28651969-28651991 GATGCATGCTACAATATGGATGG - Intronic
1039369074 8:36966365-36966387 AATGAGTGCTGCCATGTTGAGGG + Intergenic
1041357214 8:57013811-57013833 GAGGTATGCAGCCAAGTGGAGGG + Intergenic
1042071654 8:64941597-64941619 GATGCAGGGTGCCATGTTCAAGG + Intergenic
1042212166 8:66391769-66391791 TATACATGCTGCAATTTGGAAGG + Intergenic
1042243724 8:66690193-66690215 GTTGCAAGCTGCCTTATGGATGG - Intronic
1042648256 8:71011071-71011093 GACGCATGGTGGCATTTGGAAGG + Intergenic
1043960058 8:86407329-86407351 GCTGCACACTGCCAGGTGGATGG + Intronic
1044359248 8:91262044-91262066 GAGGAATGCTGCTAAGTGGAAGG - Intronic
1045021100 8:98045235-98045257 CATGCCTGCTGGCATTTGGAGGG - Intronic
1045897760 8:107239205-107239227 GAAGCATCCTCCCATGAGGAAGG + Intergenic
1047161777 8:122388523-122388545 GATACATGCTGCCACATAGATGG - Intergenic
1047441662 8:124884295-124884317 GATGCAGGTTGCCAAGGGGAGGG + Intergenic
1049159265 8:141086948-141086970 GACTCATGCTGCCAGGTGGCAGG - Intergenic
1049825380 8:144664301-144664323 CCTGCTGGCTGCCATGTGGAGGG - Intergenic
1051301554 9:15656572-15656594 GATGCATGCAACCACATGGATGG + Intronic
1052014442 9:23448520-23448542 GATACATGCTACAATATGGATGG + Intergenic
1055915089 9:81392529-81392551 GATGGATGGGGCCATGTGCAAGG - Intergenic
1057292642 9:93816740-93816762 GATTCATGCTGCAATGTCAATGG - Intergenic
1057864807 9:98671300-98671322 GATGCATGCTACGACATGGATGG - Intronic
1058346498 9:103969883-103969905 GATGTTTCCTTCCATGTGGAGGG - Intergenic
1058870219 9:109194941-109194963 GATGTATGCTACAATGTGGATGG - Intronic
1060059123 9:120443373-120443395 GAAGCATGCTGACACATGGACGG + Intronic
1061707953 9:132467497-132467519 GACACATGCTACAATGTGGATGG - Intronic
1061710551 9:132484540-132484562 GATCCATGTTACAATGTGGATGG - Intronic
1062002117 9:134221517-134221539 CATGGGTGCTGCCATGTGGCAGG + Intergenic
1186228592 X:7428371-7428393 GATCCGTGCAGCCATGAGGATGG + Intergenic
1186388305 X:9132502-9132524 AATACATGCTGACATCTGGAAGG - Intronic
1189370119 X:40421234-40421256 GGAGCATGAGGCCATGTGGAGGG - Intergenic
1190795766 X:53739811-53739833 GATGCATGCTACAATTTGGATGG - Intergenic
1191727436 X:64296142-64296164 GATACATGCTGCAACATGGATGG + Intronic
1193288051 X:79737184-79737206 GAGGAATGGTGCCATATGGAGGG - Intergenic
1194868485 X:99098510-99098532 GATGAATACTGCCTTGTTGATGG - Intergenic
1195309810 X:103621246-103621268 GATACATGCTACAATATGGATGG + Intronic
1197807779 X:130414036-130414058 GATACATGCTACAATGTGGATGG - Intergenic
1197861228 X:130972905-130972927 GATAAATGCTCCCAGGTGGAAGG + Intergenic
1198100528 X:133418132-133418154 GATACATGTTACCATATGGATGG - Intergenic
1199757658 X:150880385-150880407 GATCCATGCTACAACGTGGATGG + Intronic
1201507437 Y:14718005-14718027 GATGCATGGTACAATATGGACGG + Intronic
1201596779 Y:15679255-15679277 GATCCCTGAAGCCATGTGGATGG + Intergenic
1201784318 Y:17757597-17757619 GATGCAGGATGGCATGGGGAAGG + Intergenic
1201817235 Y:18148390-18148412 GATGCAGGATGGCATGGGGAAGG - Intergenic