ID: 924600121

View in Genome Browser
Species Human (GRCh38)
Location 1:245481378-245481400
Sequence GTTACATTTGAGCACGGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 78}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924600121_924600126 30 Left 924600121 1:245481378-245481400 CCATTCCCGTGCTCAAATGTAAC 0: 1
1: 0
2: 0
3: 4
4: 78
Right 924600126 1:245481431-245481453 CTGTGTTTGAACTGCTCCCCTGG 0: 1
1: 0
2: 2
3: 15
4: 173
924600121_924600125 4 Left 924600121 1:245481378-245481400 CCATTCCCGTGCTCAAATGTAAC 0: 1
1: 0
2: 0
3: 4
4: 78
Right 924600125 1:245481405-245481427 AAAGGACAATATAAAATATCAGG 0: 1
1: 0
2: 2
3: 61
4: 693

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924600121 Original CRISPR GTTACATTTGAGCACGGGAA TGG (reversed) Intronic
903436146 1:23350920-23350942 GATACATTTGAGAACTAGAAGGG - Intergenic
908334091 1:63102433-63102455 GTGACATTTAAGCAAAGGAAGGG + Intergenic
909558409 1:76981647-76981669 ATTGCATTTGAGCTCGAGAATGG + Intronic
909854450 1:80510841-80510863 GTTAAATTTGAGGGAGGGAAGGG - Intergenic
910329951 1:86060624-86060646 GTTAATTTTGATCAAGGGAAGGG - Intronic
915806764 1:158861806-158861828 ATTATAATTGAGCAAGGGAATGG - Intergenic
917616838 1:176754574-176754596 GTTACATTTCAGCAGGGCCATGG - Intronic
919679244 1:200418072-200418094 GTTACATTTGGGCAGAAGAAGGG - Intergenic
922083523 1:222322782-222322804 GTTACATTTGAGGAAGAGGAGGG + Intergenic
924600121 1:245481378-245481400 GTTACATTTGAGCACGGGAATGG - Intronic
1068341338 10:55707842-55707864 CTTACATTTCAGCACAAGAATGG + Intergenic
1071043290 10:81340259-81340281 GTTAAATTTGAACAGAGGAAAGG + Intergenic
1075675086 10:124290636-124290658 GTTGCATTTGAGCGTGGGGAAGG + Intergenic
1085676805 11:78528761-78528783 TTTAGGTTTGAGCATGGGAAGGG + Intronic
1086075032 11:82841495-82841517 ATTACATTTGAGCATGTTAAAGG - Intronic
1100517278 12:95340454-95340476 GTTATATTTGAGCAACCGAAAGG + Intergenic
1108800131 13:54084684-54084706 GTTACAATTGAACATGGAAATGG - Intergenic
1112850776 13:103703832-103703854 GTTACCATTCAGCACGGCAAAGG - Intergenic
1115084840 14:29502059-29502081 GTTACATTTTGCCACTGGAATGG + Intergenic
1130339360 15:82986243-82986265 GTTACATTGGAGAACTGGAGTGG + Exonic
1134086776 16:11362705-11362727 GTTACTTTAGAGCAAGGGAAGGG + Intronic
1144064030 17:11608234-11608256 GTTATACTTGAGCAAGTGAAGGG + Exonic
1146810765 17:35901266-35901288 TTTACTTTTCAGAACGGGAAAGG - Intergenic
1150865220 17:68842064-68842086 GGTACATCTGAGCTAGGGAAGGG + Intergenic
1151634600 17:75337043-75337065 GTAACATTTGAGTACATGAATGG + Intronic
1159521158 18:69526963-69526985 GTTACAGATAAGCAAGGGAAGGG - Intronic
1160050530 18:75429289-75429311 GTTATAGTTGAGCTCTGGAATGG + Intergenic
1167750228 19:51374920-51374942 GTTAGATTTGAGGGTGGGAAGGG - Intergenic
930373802 2:50538841-50538863 GTTCCATTTGAACTCGAGAATGG + Intronic
931719858 2:65059393-65059415 GTTACAAGTGAGGAGGGGAAAGG - Intronic
941712742 2:168731585-168731607 GTATCATTTGACCATGGGAAGGG + Intronic
944126941 2:196304787-196304809 GTCAGATTTGAGCCTGGGAAGGG - Intronic
946718763 2:222581832-222581854 GTTACATTTGCTCACGGCAAGGG + Intronic
1175442659 20:59002304-59002326 ATTGCATTTGTGCATGGGAAGGG - Intronic
1180189602 21:46156171-46156193 GATACATGTGAGCACAGGACAGG + Intergenic
1182786507 22:32912246-32912268 GTGACATTTGAGCTGAGGAAAGG + Intronic
1183846946 22:40549537-40549559 GTTTCCTTTGAGCAAGGGGAAGG + Intronic
958648956 3:96911492-96911514 GTTACATTTGAGCATGCCCATGG + Intronic
958984181 3:100761355-100761377 GTTACATATGTGCACAGGGAAGG - Intronic
959282182 3:104358261-104358283 GTTGCATTTGAACACGTTAATGG + Intergenic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
970334498 4:15021028-15021050 GTTACATTTGAGGAACTGAAAGG + Intronic
970960209 4:21862580-21862602 GTGACATTTAAGTAAGGGAAGGG + Intronic
975989286 4:80240433-80240455 GTTTCATTTGAGAATGAGAATGG - Intergenic
982858105 4:160411201-160411223 GCTCCATTTGAGCATGGGATGGG + Intergenic
993095404 5:83473585-83473607 GCTGCCTTGGAGCACGGGAAAGG - Intronic
994408743 5:99379510-99379532 GTCACATTTGATCACTGGTATGG - Intergenic
996788188 5:127263856-127263878 GTTACATTTGAGAAGGCAAAAGG + Intergenic
997638578 5:135433900-135433922 GTTGCAGTAGAGCACGGGTATGG + Intergenic
997652239 5:135530948-135530970 GTTACATTTAAGCAAAGGACTGG - Intergenic
998724967 5:145001968-145001990 GTTACACTTGAGGAAGGGAAAGG - Intergenic
999547094 5:152641642-152641664 GTTACATAGGAGCAGGGGAAGGG + Intergenic
1000484544 5:161824326-161824348 GTAACAATTGAGCATGGCAAGGG - Intergenic
1002885649 6:1291241-1291263 GTTAGATATGAGGATGGGAATGG - Intergenic
1004253235 6:14039955-14039977 GTCACAACTGAGCACGGAAAAGG - Intergenic
1004400862 6:15287571-15287593 GTTACATTTCAGCAAGAGATTGG + Intronic
1005089999 6:22046441-22046463 TTTACATGTGAGCAAAGGAAAGG + Intergenic
1008759422 6:54835819-54835841 ATTACAATTGAGCACAGGATTGG + Intergenic
1009459882 6:63899740-63899762 CTTACAGTTGAGCAAGGGAGAGG - Intronic
1011890459 6:92152956-92152978 GTTACATATACTCACGGGAATGG - Intergenic
1016524913 6:144990747-144990769 ATTACATTTGAGGAGGGGGAAGG - Intergenic
1017131424 6:151111308-151111330 GTTACCTTTGAGCAATTGAAAGG - Intergenic
1017700295 6:157063028-157063050 GTTACATTTCAGAATGAGAATGG + Intronic
1018722805 6:166586640-166586662 GTTACATTGGAGAACTGGAGTGG - Intronic
1021222292 7:17988356-17988378 CATACATTTCAGCACAGGAAGGG + Intergenic
1026774028 7:73220228-73220250 GTGACATTTGAGCAGAGAAATGG + Intergenic
1027014885 7:74773614-74773636 GTGACATTTGAGCAGAGAAATGG + Intergenic
1027073146 7:75172339-75172361 GTGACATTTGAGCAGAGAAATGG - Intergenic
1027370084 7:77499554-77499576 GTTACCTTTGAGAAAAGGAACGG - Intergenic
1027438504 7:78193022-78193044 GTTACAGGTGAGGAGGGGAAAGG + Intronic
1028282823 7:88953326-88953348 GTGACATTAGAGCAGGGAAATGG - Intronic
1036717864 8:11143666-11143688 GTTACTTTGGAGGAAGGGAAGGG + Intronic
1040407000 8:47115033-47115055 GTTATATTTTAGCACAGGGAAGG + Intergenic
1041492061 8:58443991-58444013 ATAACATTTGAGAACTGGAATGG - Intronic
1042258743 8:66834392-66834414 GTTACCTTTGAGAAGGAGAAGGG + Intronic
1042330773 8:67578360-67578382 GTTACATTTGAGCACTTTGAGGG - Intronic
1058707210 9:107647500-107647522 GATACATCTGAGCAAGGGCATGG + Intergenic
1060710586 9:125859905-125859927 CTTCCATTTGAGCACCGGAGAGG - Intronic
1062597170 9:137304602-137304624 GCTCCATTTGAGGATGGGAAGGG + Intergenic
1187192440 X:17047795-17047817 GTTATATTAGAGCTCGGGCAAGG + Intronic
1190887388 X:54541669-54541691 GTTACATGTGACCAGGGGATGGG + Intronic
1195738772 X:108040932-108040954 GTTCCATGTGAGCCTGGGAAAGG + Intergenic
1195738823 X:108041638-108041660 GTTCCATGTGAGCCTGGGAAAGG + Intergenic