ID: 924601743

View in Genome Browser
Species Human (GRCh38)
Location 1:245496266-245496288
Sequence GAATCTGGATGAGGGGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 831
Summary {0: 1, 1: 0, 2: 19, 3: 176, 4: 635}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924601743 Original CRISPR GAATCTGGATGAGGGGCATA TGG Intronic
900753039 1:4411755-4411777 GAATTCGACTGAGGGGCATAAGG + Intergenic
900882752 1:5393755-5393777 GAACCTGGATGAGGGGGAGGTGG - Intergenic
901164677 1:7209883-7209905 GAATCTGCGTGAAGGGCATATGG - Intronic
901245137 1:7724370-7724392 GAAACTGAGTGAGGGGCATATGG + Intronic
901278004 1:8007994-8008016 GAATCTGGGTAATGGGCATAGGG + Intronic
901869890 1:12132150-12132172 GAAACTGGGTGTGGGGCATGTGG - Intronic
902120719 1:14163152-14163174 GAATTTATCTGAGGGGCATAAGG + Intergenic
902611530 1:17600493-17600515 GAAGCTGGATGAGGGGTATGTGG - Intronic
903724783 1:25431792-25431814 GAATCTGGAGCAGGGCCACAGGG - Intronic
903794356 1:25917630-25917652 GAAGCTGGCTGAAGGGCATACGG - Intergenic
904220221 1:28961219-28961241 GACTCTGAATGAGGGCCAAAAGG + Intronic
904589971 1:31607724-31607746 GAATCTGGGTGAGGAGAAAAAGG + Intergenic
905111792 1:35600429-35600451 GAAACTGAATAAGGGGTATAAGG + Intronic
905947130 1:41912768-41912790 AAATCTTGATGAGGGGAATTGGG - Intronic
906831378 1:49035302-49035324 GAATTTGATTGAGGGGCATAAGG + Intronic
907079423 1:51607768-51607790 GAATTTGGCCAAGGGGCATATGG + Intronic
907985431 1:59525062-59525084 GCATCTGGATGAGGGGAACACGG - Intronic
908077435 1:60535815-60535837 CAATCTGGAATAGGGGCATGTGG + Intergenic
909084369 1:71154299-71154321 GAATTTGACTGAGGAGCATAAGG - Intergenic
909100499 1:71342593-71342615 GAATTTGACTGAGGGGCATAAGG + Intergenic
909201426 1:72694197-72694219 GAACTTGGCTAAGGGGCATAAGG + Intergenic
909657044 1:78044144-78044166 GAAGCTGGATGAGGGCCAAGTGG + Intronic
909800894 1:79806188-79806210 GTGTCTGGAAGAGGGGAATATGG + Intergenic
910365398 1:86459878-86459900 GAATTTGACCGAGGGGCATAAGG + Intergenic
911159284 1:94668268-94668290 GAATTCGTCTGAGGGGCATAAGG - Intergenic
911852467 1:102836669-102836691 GAAACTGAATGAAGGGTATATGG + Intergenic
912237337 1:107866255-107866277 GAATTCGACTGAGGGGCATAAGG - Intronic
912357825 1:109069980-109070002 GAAGCTGGATATAGGGCATATGG - Intronic
912867700 1:113272913-113272935 GAAACTGGGTGAAAGGCATAGGG - Intergenic
914318820 1:146539898-146539920 GAATTTGACTGAGGGGCATAAGG + Intergenic
914495538 1:148193459-148193481 GAATTTGACTGAGGGGCATAAGG - Intergenic
915500829 1:156316057-156316079 GAATCTGGATGCGGGACCTGCGG - Intronic
916024758 1:160823896-160823918 GAAACAGGACTAGGGGCATACGG + Intronic
916213586 1:162377620-162377642 AAATCTGGATACAGGGCATAAGG - Intronic
916484146 1:165243137-165243159 GAAGCTGAATGAAGGGTATATGG + Intronic
916706513 1:167356631-167356653 GAATTCGACTGAGGGGCATAAGG + Intronic
917354157 1:174108284-174108306 GAATCTAGGTGAAGGGGATATGG - Intergenic
917658837 1:177157220-177157242 GAAACTGGGTATGGGGCATATGG + Intronic
917923946 1:179773475-179773497 GAAACTGGGTGAGGAGTATATGG + Intronic
918401430 1:184166172-184166194 GAATCAGTAAGAGAGGCATATGG + Intergenic
918680972 1:187352676-187352698 GAAACTGGATGAGGGGTATATGG + Intergenic
919168668 1:193927301-193927323 GCAACTGGATGAGGGGAACATGG + Intergenic
920266632 1:204728798-204728820 GAATCTAGATTGTGGGCATATGG - Intergenic
920402575 1:205685638-205685660 GAAACTGGTTGAAGGGCATATGG + Intergenic
921675332 1:217969447-217969469 GTATCTGGATGAGGAGAATGTGG - Intergenic
921940970 1:220839421-220839443 GAATCTAGCTGAGTGGCATTAGG - Intergenic
922855242 1:228769460-228769482 GAAACTGGGGGAGGGGCATGTGG + Intergenic
923456938 1:234172933-234172955 GAAGCTGGAAGAGGGACACATGG - Intronic
923934371 1:238745434-238745456 GTGTCTGGATGAGGGGGATTCGG - Intergenic
924298275 1:242611168-242611190 GAATTTGACTGAGGGGCAGAAGG + Intergenic
924431492 1:244001034-244001056 GAATCTGGGTGAGGGATACATGG + Intergenic
924601743 1:245496266-245496288 GAATCTGGATGAGGGGCATATGG + Intronic
1062947608 10:1473256-1473278 GAATTCGCCTGAGGGGCATAAGG - Intronic
1062986506 10:1773913-1773935 GAATTTGGCCAAGGGGCATAAGG - Intergenic
1063786579 10:9391917-9391939 GAATTTGACTGAGGGGCATAAGG + Intergenic
1063901675 10:10739500-10739522 GAAGCTGGATGATGGGAATATGG - Intergenic
1064800418 10:19064341-19064363 GAATGTGGATGTGTGGCATATGG + Intronic
1065132065 10:22632317-22632339 GCATCTGGGTGAAGGCCATATGG + Intronic
1065160731 10:22918646-22918668 GGAACTGGGTGAGGCGCATATGG - Intergenic
1065209608 10:23390133-23390155 GAATTTGACTAAGGGGCATAAGG + Intergenic
1065640349 10:27776064-27776086 GAATGCGACTGAGGGGCATAAGG + Intergenic
1065830450 10:29609646-29609668 GCGTCTGGATGAGGGGAATGTGG - Intronic
1066289263 10:33998941-33998963 GAATTCGACTGAGGGGCATAGGG + Intergenic
1067893936 10:50159860-50159882 GAATTTGACGGAGGGGCATAAGG - Intergenic
1067954909 10:50780404-50780426 GAATTTGACTGAGGGGCATAAGG + Intronic
1068191989 10:53664622-53664644 GAATTTGACTGAGGGGCATAGGG + Intergenic
1068226858 10:54117323-54117345 GCATCTGGATGAGGGGAATATGG + Intronic
1068438520 10:57020933-57020955 GAATTTGACTGAGGGGCATAAGG - Intergenic
1068497103 10:57796394-57796416 GAATTTGACTGAGGGGCATAAGG - Intergenic
1069107136 10:64397093-64397115 GAATTTGACTCAGGGGCATAAGG + Intergenic
1069174318 10:65271335-65271357 GAATTCGACTGAGGGGCATAAGG + Intergenic
1069330288 10:67283766-67283788 GAATTTGACCGAGGGGCATAAGG - Intronic
1069817535 10:71208000-71208022 GAGACTGGGTGAGGGGCATATGG + Intergenic
1071294438 10:84209011-84209033 CAATCTGCAGGAGGGGCAGAGGG - Intronic
1071596568 10:86932049-86932071 GAATCTGGGTGAAGGGTAAATGG - Exonic
1071789227 10:88936812-88936834 GAAACTGGATGAGAGACCTATGG - Intronic
1072903313 10:99428953-99428975 GAAGCTGGATGATGGGTACATGG - Intronic
1073178102 10:101568869-101568891 GAAAGTGGATGAGGGGCCCAGGG + Intergenic
1074002690 10:109388355-109388377 GAATTTGACTGAGGGGCATAAGG - Intergenic
1074218497 10:111411545-111411567 AAATCTGGGTGATGGGTATACGG - Intergenic
1074529526 10:114287751-114287773 GAAACTGGGTGTGGGGTATAGGG - Intronic
1074979483 10:118608308-118608330 GCATCTGGATGAGGGGAACACGG + Intergenic
1075125380 10:119694966-119694988 GTGTCTGGATGAGGGTAATATGG + Intergenic
1075618986 10:123911898-123911920 GAATTCGACTGAGGGGCATAAGG + Intronic
1077271251 11:1682883-1682905 AAAACTGGTTGAGGGGCATGTGG + Intergenic
1077753731 11:5003042-5003064 GAAATTGACTGAGGGGCATAAGG + Intergenic
1077839181 11:5955434-5955456 GAATTCAGCTGAGGGGCATAAGG + Intergenic
1077968763 11:7165435-7165457 GAATGTGGATGATGGTTATATGG + Intergenic
1078129685 11:8602982-8603004 GAATCTGGGTGAAGGACATATGG - Intergenic
1078281265 11:9903517-9903539 GAATTGGACTGAGGGGCATAAGG + Intronic
1078499088 11:11851522-11851544 GAAGCTGGATGAAGGGTATACGG - Intronic
1078525861 11:12100797-12100819 GGAACTGGAAGAGGGGCAGAGGG - Intronic
1079070967 11:17346699-17346721 GAAGCTAGATGAAGGGCATATGG - Intronic
1080274673 11:30490397-30490419 GAATCTGGAAGAAAGGCATCAGG - Intronic
1080293744 11:30701144-30701166 GAAGCTGGATGTGGGCTATACGG + Intergenic
1080320302 11:31000876-31000898 GAATCTGGGTGAAGGGTATATGG - Intronic
1080375147 11:31700270-31700292 GAATCTGGGTGATAGGGATATGG + Intronic
1080485835 11:32705380-32705402 GTGTCTGGATGAGGGGAATGTGG - Intronic
1080714760 11:34789718-34789740 GGAACTGGATGAGGGGTAAATGG - Intergenic
1081159021 11:39731300-39731322 GAATTTGACTGAGGGGCATAAGG + Intergenic
1081295719 11:41386378-41386400 GAAGCTGTGTGAAGGGCATATGG - Intronic
1081305015 11:41501437-41501459 GAATTTGGCTGAGGGGCAGAAGG + Intergenic
1081340446 11:41921127-41921149 GAAACTGGATATGGGGTATATGG - Intergenic
1081629043 11:44675441-44675463 GAAGCTGAGTGAAGGGCATATGG + Intergenic
1082942725 11:58725601-58725623 GAATTTGACTGAGGGGCAGAAGG + Intronic
1085078277 11:73611398-73611420 GAAGCTGGATGAAGGGTACATGG - Intergenic
1085118410 11:73950652-73950674 GAATGTGGATGTGAGGTATATGG + Exonic
1085485948 11:76862667-76862689 GAATCTGGAATTAGGGCATATGG + Intronic
1086533156 11:87810893-87810915 GAATTCAGCTGAGGGGCATAAGG + Intergenic
1086551944 11:88062928-88062950 GAACCTGGATGATGGGATTAGGG + Intergenic
1086978295 11:93163177-93163199 GAAACTGGGTGAGGGGTATATGG - Intronic
1087056354 11:93940344-93940366 AAAACTGGGTGAGGGGTATATGG - Intergenic
1087081618 11:94176550-94176572 GAAACTGAGTGAGGGGCTTATGG + Intronic
1087288823 11:96297702-96297724 GAATCTAGTTGATGGGTATATGG - Intronic
1087308470 11:96511982-96512004 AAATCTGTATGAATGGCATATGG - Intergenic
1087674631 11:101145947-101145969 AAATCTGGATGAAGGATATATGG - Intergenic
1087797507 11:102470075-102470097 GAATTTGACTGAGGGGCATAAGG - Intronic
1087806267 11:102558729-102558751 GCATCTGGATGAGAGGAACATGG - Intergenic
1087886683 11:103490707-103490729 ACATCTGGATGAGGGGAACATGG + Intergenic
1088044722 11:105434530-105434552 AAAGCTGGATGAAGGGCATAAGG + Intergenic
1088505612 11:110523976-110523998 GAATCTAGATAAAGGGCATATGG - Intergenic
1089127585 11:116187852-116187874 GGAGCTGGATGAGGGGCTCATGG - Intergenic
1090116455 11:123979189-123979211 GCATCTGGACGAGGGGAATATGG + Intergenic
1091873941 12:3918293-3918315 GAAGCTGGATGAGGGAGATTTGG - Intergenic
1092131043 12:6113640-6113662 GAATCTGAGTGAGGAGTATATGG + Intronic
1092618864 12:10240583-10240605 GAAGCTGGGTGATGGGCACATGG - Intergenic
1092934635 12:13349268-13349290 GAATCTAGATGAGGAGATTAGGG - Intergenic
1093743044 12:22709872-22709894 GAATCTGGATGACTGACCTATGG - Intergenic
1093978379 12:25448979-25449001 GAAACTGGCTGTGGGGTATATGG - Intronic
1094039298 12:26106068-26106090 GAATCTAGATGAAGTGTATATGG - Intergenic
1094395878 12:30005334-30005356 GAATCTGGGTAAGGGGTATATGG + Intergenic
1095314748 12:40746424-40746446 GAATTTGACTGAGGGGCATAAGG + Intronic
1095415323 12:41970625-41970647 GTATATGGATGAGGGTCTTAGGG + Intergenic
1095921643 12:47537753-47537775 GAAGCTGGGTGATGGGCCTATGG + Intergenic
1096355427 12:50937361-50937383 GCATCTGGACGAGGGGAATGTGG + Intergenic
1097134147 12:56837341-56837363 GAATTTGACTGAGGGGCATAAGG + Intergenic
1097451469 12:59741898-59741920 TAATTTGACTGAGGGGCATAAGG + Intronic
1097856751 12:64471725-64471747 GCATCTGGAAGAAGAGCATAAGG - Intronic
1098095929 12:66956024-66956046 GAAGCTGCTTGAAGGGCATATGG - Intergenic
1098996931 12:77131203-77131225 GAAACTGGATAAAAGGCATATGG - Intergenic
1099102368 12:78458833-78458855 GAATTTGACTGTGGGGCATAAGG + Intergenic
1100135956 12:91553572-91553594 GAATTCGGCTGAGGGGCATAAGG - Intergenic
1100443241 12:94637264-94637286 GAAGCTGGGTGAGGGGTACATGG + Intronic
1100654925 12:96633345-96633367 GAAACTGGATGAAGGGTATATGG - Intronic
1101111382 12:101489894-101489916 GAAGCTGGAGGAGGGGGAGATGG + Intergenic
1101252964 12:102953262-102953284 GATTCTGAATCAGGGGCAAAGGG - Intronic
1101280827 12:103253737-103253759 GAATTTGACTGAGGGGCATAAGG - Intronic
1101296745 12:103431862-103431884 GAATTTAACTGAGGGGCATAAGG + Intronic
1101451161 12:104780414-104780436 GCATCTGGATGAGGGGAATGTGG + Intergenic
1101485860 12:105158875-105158897 GAATCTAGTTGAAGGGTATACGG + Intronic
1102343528 12:112142872-112142894 GAATATAGATGAGGAGTATATGG + Intronic
1102411824 12:112726573-112726595 GAATCTGGGTGATGGGTATTTGG - Intronic
1103554759 12:121759322-121759344 GAATTTGACTGAGGGGCATAAGG + Intronic
1103840848 12:123862972-123862994 GAATCTGACTGAAAGGCATATGG + Intronic
1103954686 12:124569356-124569378 GAAGCTGGAGGAGGGACATTTGG + Intergenic
1104022746 12:125004581-125004603 GAAACAGGGTGAGGGGTATATGG - Intronic
1104248766 12:127069443-127069465 GAAACTGGATGCAGGGAATATGG - Intergenic
1104284409 12:127411758-127411780 GAATTTGCCCGAGGGGCATATGG + Intergenic
1104361819 12:128140312-128140334 GAATCTGAGTGATGGGCATGTGG + Intergenic
1104408405 12:128537894-128537916 GAAGCTGGATGATGGGTACATGG + Intronic
1104531384 12:129574270-129574292 GAATCTAGGTGATGGGTATATGG + Intronic
1105696432 13:22893624-22893646 GAATTCAGCTGAGGGGCATAAGG - Intergenic
1106136572 13:26977980-26978002 GAATCTGGGTGATGGGTGTAAGG + Intergenic
1106166373 13:27250460-27250482 GAAACTGGATGCTGGGTATATGG + Intergenic
1107894980 13:44952639-44952661 GAAGCTGGATGAAGGATATATGG - Intronic
1108353076 13:49604957-49604979 GAACTTGACTGAGGGGCATAAGG - Intergenic
1108483047 13:50894756-50894778 GAATTTGGCTCAGGGGCATAAGG - Intergenic
1108718386 13:53105016-53105038 GAATTCAGCTGAGGGGCATAAGG + Intergenic
1108816848 13:54303069-54303091 TAATCTGAATTAGGGGGATAGGG + Intergenic
1109157314 13:58926963-58926985 GAATCTGGAGCAGCGGCAGATGG - Intergenic
1109176830 13:59167467-59167489 GAATTTGACGGAGGGGCATAAGG + Intergenic
1109312176 13:60708705-60708727 GAAGCTGGTTGAAGGGTATATGG + Intergenic
1109359939 13:61282635-61282657 GAATTTGACTGAGGGGTATAAGG + Intergenic
1109437831 13:62329683-62329705 GAAGCTGGGTGAAGTGCATATGG + Intergenic
1109482576 13:62974824-62974846 GAATCATGATGAGAGGCAAAAGG + Intergenic
1110145225 13:72182459-72182481 GAAATTGGGTGAGGGGTATACGG + Intergenic
1110803301 13:79725724-79725746 GAATCAGGATGGGGGGCAGGAGG - Intergenic
1110937360 13:81307645-81307667 GAATTTGACTGAGGGGCATGAGG - Intergenic
1111005349 13:82240350-82240372 GCATCTGGATGAAGGGTACATGG - Intergenic
1111151157 13:84254856-84254878 GAATTTGACTGAGCGGCATAAGG - Intergenic
1111256116 13:85670860-85670882 GAAACTGGATGTGGAGTATATGG - Intergenic
1111434127 13:88184235-88184257 GATTTTGACTGAGGGGCATAAGG - Intergenic
1111690235 13:91555121-91555143 GGAACTGGGTGAAGGGCATATGG - Intronic
1111798872 13:92958266-92958288 CAATTTGACTGAGGGGCATAAGG - Intergenic
1111917015 13:94371762-94371784 GAATCTGTATGGGGGTTATATGG - Intronic
1111965098 13:94852947-94852969 GAAGCTGGATGAGGGGTAGATGG - Intergenic
1112057310 13:95701936-95701958 GAATCTAGATGATGGGTATAGGG - Intronic
1112550196 13:100412367-100412389 GAATCTGGGTGAAGGGTGTAAGG + Intronic
1113774381 13:112934480-112934502 GACTCTGGATGTGGGGCCCAGGG - Intronic
1114162650 14:20186602-20186624 GGATCTGGATAAAGGGAATATGG - Intergenic
1114267259 14:21080332-21080354 AAAGCAGGATGAGGGTCATAGGG - Intronic
1114727603 14:24955329-24955351 GAATGTGGATGAGTGGCCTGTGG - Intronic
1115258009 14:31422916-31422938 GAATCTGGATTATGTGTATATGG - Intronic
1115887956 14:37994633-37994655 GAATTTGACTGAGGGGCATAAGG - Intronic
1116173321 14:41430639-41430661 GAATTCGACTGAGGGGCATAAGG - Intergenic
1116276413 14:42839277-42839299 GAATTTGACTGAGGGGCATAAGG - Intergenic
1116341260 14:43726164-43726186 GAATTTGACTGAGGGGCATAAGG - Intergenic
1116566175 14:46446942-46446964 GAATTCGACTGAGGGGCATAAGG - Intergenic
1117011234 14:51472748-51472770 AAATCTGGGTGAGGGGAACAGGG - Intergenic
1117099713 14:52333874-52333896 GAATTCGGCTGAGGGGCATAAGG + Intergenic
1117136873 14:52743621-52743643 GAATCTGGGTGAAGGGTAAATGG + Intronic
1117648901 14:57882029-57882051 AGGTCTGGATGAAGGGCATATGG - Intronic
1118099715 14:62583300-62583322 GAATCTAGATGTTGGGTATATGG - Intergenic
1118155379 14:63235585-63235607 GAATGTAGATGGGGGTCATAAGG + Intronic
1118611029 14:67540169-67540191 GAAGCTGGCTGATGGGTATATGG - Intronic
1118650896 14:67893239-67893261 GAAGCTGGGTGAAGGGCATTTGG + Intronic
1119188946 14:72665830-72665852 GAATCTGGGTGAAGGACATATGG + Intronic
1119298443 14:73552160-73552182 GAATTTGACTGAGGGGCATAAGG - Intronic
1119302740 14:73584347-73584369 GAATTTGACTGAGGGGCATAAGG - Intergenic
1119511097 14:75211893-75211915 GAAACTGGATAAAGGGTATATGG + Intergenic
1119520748 14:75283191-75283213 TAAACTGAATGAAGGGCATATGG - Intergenic
1119596974 14:75944120-75944142 GAATTTGACTGAGGGGCATAAGG - Intronic
1120090830 14:80331718-80331740 GAATAGAGATGAGGGGTATAAGG - Intronic
1120970000 14:90199276-90199298 GAATTTGACTGAGGGGCATAAGG - Intergenic
1121004278 14:90478452-90478474 GAATTTGACTGAGGGGCATAAGG + Intergenic
1121195957 14:92072311-92072333 GAATCTGGGTGAAGGATATAAGG + Intronic
1122024183 14:98863106-98863128 GAATCTGGAAGAGGCACAGATGG + Intergenic
1122385994 14:101348665-101348687 ACATCTGGATGAGGGGAACAGGG + Intergenic
1123778304 15:23601951-23601973 GAATTCGACTGAGGGGCATAAGG + Intronic
1124027477 15:25980003-25980025 GAAGCTGGAACATGGGCATATGG + Intergenic
1124550084 15:30672244-30672266 GAAACTGGAGGAAGGGCATATGG + Intronic
1124918866 15:34004742-34004764 GAAGCTGGATGATGGGTACATGG + Intronic
1126272735 15:46841252-46841274 AAAGCTGGATGAAGGGCATATGG + Intergenic
1126597011 15:50393049-50393071 GAATTTGACTGAGGGGCATAAGG - Intergenic
1127204091 15:56694885-56694907 GAAACTGGGTAAGGGGTATATGG + Intronic
1127216420 15:56827808-56827830 GAATCTGGTTGGTGGGCATAAGG + Intronic
1127575122 15:60284463-60284485 GAATTTGTCTGAGGAGCATAAGG + Intergenic
1127616640 15:60692662-60692684 GAATCTGGGTGTTGGGTATAGGG + Intronic
1127986687 15:64078070-64078092 GAATCTGGGTGAAGGATATATGG + Intronic
1128093958 15:64939069-64939091 GAAACTGGATGTGGGGTATGTGG + Intronic
1128117126 15:65116132-65116154 GAAGCTGGATGATGGGTACATGG + Intergenic
1128623870 15:69179345-69179367 GAAATTGGATGAAGGGTATATGG - Intronic
1128733799 15:70039047-70039069 GAAGCTGGTTGATGGGCACATGG + Intergenic
1128849835 15:70943306-70943328 GAATTTGACTGAGGGGCATAAGG + Intronic
1129284141 15:74510137-74510159 GAATCTGAATAAAGGGTATATGG - Intergenic
1129304009 15:74645478-74645500 GAATCTAAATGAAGGGTATATGG + Intronic
1129669235 15:77597976-77597998 GAATCTGTATGTGGGGCGGAGGG + Intergenic
1129709222 15:77811864-77811886 AAATCTAGATGAAGGGTATACGG + Intronic
1129914513 15:79257012-79257034 GAACCTGGAGTGGGGGCATAGGG + Intergenic
1130346475 15:83051800-83051822 AAATCTGGATAAAGGGTATATGG - Intronic
1130430554 15:83842787-83842809 GCATGTGGATGAGGGGAGTAAGG + Intronic
1130685711 15:86035624-86035646 GAAACTGGGTAAGGGGTATATGG - Intergenic
1130873169 15:87988504-87988526 GAAACTGGATGAGAGATATAAGG + Intronic
1131103358 15:89712244-89712266 GAAGCTGGGTGAAGGGCATAAGG - Intronic
1131210735 15:90493600-90493622 GAATCTAGGTGAAGGGCACATGG - Intronic
1131619480 15:94052505-94052527 TATTCTGGATGATGGGCCTATGG + Intergenic
1131622706 15:94084111-94084133 GAATCAGGAAGAGGGAAATAGGG - Intergenic
1131647586 15:94361942-94361964 GAGCCTGGAGGAGGGGCCTACGG - Intronic
1132436510 15:101809067-101809089 GAAACTTGGTAAGGGGCATATGG - Intronic
1133712623 16:8415879-8415901 TATTCTGAATGTGGGGCATATGG - Intergenic
1135269335 16:21055495-21055517 GAATCTGGATGAAAGATATATGG + Intronic
1135570989 16:23549284-23549306 GCATCTAGATGAGGGGAACATGG - Intronic
1135736009 16:24932210-24932232 GAAACTGAGTAAGGGGCATATGG + Intronic
1136504265 16:30692785-30692807 GCGTCTGGATGTGGGGCATGAGG + Intergenic
1137386925 16:48050397-48050419 GAATTTGTCTGAGGGGCATAAGG - Intergenic
1138164432 16:54787854-54787876 GAAACTGGATGTGGAGAATATGG - Intergenic
1138748282 16:59389175-59389197 GAATTCGACTGAGGGGCATAAGG + Intergenic
1138893420 16:61173709-61173731 GAAACTAGATAAGGTGCATATGG + Intergenic
1139232457 16:65297114-65297136 GAATCAGAATGAGGGGGACAGGG - Intergenic
1140128057 16:72134216-72134238 GAATTTGACTGAGGGGCAGAAGG - Intronic
1140525163 16:75616869-75616891 GAATCAGGATTAGGAGCGTAAGG - Intronic
1140790100 16:78383318-78383340 GAAGCTGGATGATGGGTATAGGG + Intronic
1143268161 17:5656234-5656256 GAAACTGGGTGTGGGGTATACGG - Intergenic
1143930362 17:10416741-10416763 GCATCTGTATGATGGGCACATGG - Intronic
1144165037 17:12602401-12602423 GAAACGGGGTGAAGGGCATATGG + Intergenic
1144300589 17:13919892-13919914 GAATTTGACTGAGGGGCATAAGG - Intergenic
1145815252 17:27790526-27790548 GAATCTGGGTGAAGGGCCCATGG - Intronic
1146102834 17:30002246-30002268 GAAACTGGATGAAGGGCATATGG - Intronic
1146933433 17:36794181-36794203 GAAACTGGATGAAGGGTATATGG + Intergenic
1147272529 17:39285784-39285806 GAATTTGAATGAGGGGAAGATGG + Intronic
1147650928 17:42061702-42061724 GAACATGGATGAGGGGAGTAGGG - Intronic
1148488646 17:48008543-48008565 GAATCTGGGTAAAGGGCACATGG - Intergenic
1148704986 17:49622205-49622227 AAATGTGGATGAGGAACATAAGG - Intronic
1148956818 17:51361047-51361069 GAATTTGACTGAGGGGCATAAGG + Intergenic
1149002037 17:51767418-51767440 GAAGCTGGGTGAGGGATATATGG - Intronic
1149619311 17:58030507-58030529 GAAACTGGGTGTGGGGTATATGG + Intergenic
1149679831 17:58498271-58498293 GAATTTGGATGAAGAGCACATGG - Intronic
1149797940 17:59538691-59538713 GAAGCTGGATGAAGGGTACATGG - Intergenic
1150516735 17:65820023-65820045 GAAGCTGGGTGAAGGACATATGG + Intronic
1150827891 17:68492727-68492749 GAATTTGACTGAGGGGCATAAGG + Intergenic
1150907067 17:69349118-69349140 GAATCTGATGGAGGGGCATAAGG - Intergenic
1151205910 17:72506612-72506634 GAATCTACATGATGGGTATATGG + Intergenic
1151846718 17:76661320-76661342 GAATCCGGGTGAAGGGCAGATGG + Intergenic
1154044821 18:10894834-10894856 GAATCTGACTGAGGGGCACAAGG - Intronic
1154134433 18:11763179-11763201 GAATCTGGGTGAAGGACACATGG - Intronic
1154250919 18:12744210-12744232 CACTCAGGAGGAGGGGCATAGGG - Intergenic
1155398008 18:25406754-25406776 GAAATTGGATGTGGGGGATATGG - Intergenic
1155500216 18:26480231-26480253 GAAGCTGGTTGATGGTCATATGG - Intronic
1155629023 18:27869596-27869618 GAATCTGAATGAGGGGTCTATGG + Intergenic
1155825419 18:30436384-30436406 GAATATAGATGAAGGGTATAAGG - Intergenic
1156291233 18:35750225-35750247 GAATTTGACTGACGGGCATAAGG + Intergenic
1156329037 18:36101911-36101933 GCATCTAGATGAGGGGAACATGG + Intergenic
1156435257 18:37120024-37120046 GAAACTGGATGAAGGGTATATGG + Intronic
1156564392 18:38168203-38168225 GAAGCTGGGTGAAGGGTATATGG + Intergenic
1156807060 18:41197385-41197407 CAATTTGGATGAGGGGCCTGGGG + Intergenic
1157434151 18:47654432-47654454 GCATCTGGATGAGGGGAAGCAGG - Intergenic
1158146547 18:54320889-54320911 GAAACTGGATAAAGGGAATATGG - Intronic
1159324957 18:66902758-66902780 AAATTTGACTGAGGGGCATAAGG - Intergenic
1159552575 18:69910739-69910761 GAGACTGGATAAGGGGTATATGG + Intronic
1159602603 18:70442933-70442955 GAAACTGGCCGAGGGGCATGAGG - Intergenic
1159637469 18:70822599-70822621 GACTCTGGGAGAGGGGCTTAAGG + Intergenic
1159654423 18:71014792-71014814 GCATTTGACTGAGGGGCATAAGG - Intergenic
1159745671 18:72231972-72231994 GAATTCGACTGAGGGGCATATGG + Intergenic
1159812795 18:73036471-73036493 GAAATTGGATGCGGGACATATGG + Intergenic
1159892724 18:73967915-73967937 GAATTTAGCCGAGGGGCATAAGG + Intergenic
1159903529 18:74069804-74069826 GAGTCTGAATGACGGGCATATGG - Intergenic
1159912413 18:74158909-74158931 GAAAATGGTTGAGGGCCATAGGG + Exonic
1160212160 18:76890159-76890181 GAATATGGATGAAGGGTATATGG - Intronic
1161506462 19:4646562-4646584 GAAACTGGAAGAGGGGAAAATGG - Intronic
1162040633 19:7968856-7968878 GAAACTGGATGAGGGGGATGGGG + Intronic
1164465612 19:28485107-28485129 GAATTTGACTAAGGGGCATAAGG + Intergenic
1166068675 19:40375269-40375291 GAAACAGGATGAGGGGCTTGGGG + Intronic
1166418503 19:42614173-42614195 GAATTTGACTAAGGGGCATAAGG - Intronic
1166650048 19:44566363-44566385 GAAACTGGATGAAAGGCACATGG + Intergenic
1166650362 19:44569463-44569485 GAATCTGAATAAAGGGCATACGG + Intergenic
1167222974 19:48215157-48215179 GAATTTGACTGAGGGGCATAAGG - Intronic
1167681493 19:50925085-50925107 GAATCTGGATGAAGGGTACATGG - Intergenic
1168138594 19:54369068-54369090 GGACCTGGATGAAGGGCATATGG - Intronic
1168309755 19:55454539-55454561 GAAACTGGAGGAGGGGCACCCGG + Intronic
1168517890 19:57023662-57023684 GAATTTGACTGTGGGGCATAAGG - Intergenic
925552794 2:5094230-5094252 AAATTTGACTGAGGGGCATAAGG - Intergenic
925668206 2:6284193-6284215 GACTATGGATGGTGGGCATATGG - Intergenic
926073330 2:9919423-9919445 GAAACTGGATGAGGTGCATGGGG - Intronic
926171589 2:10556150-10556172 GAACCTGGATGTGGGGTTTATGG - Intergenic
926439570 2:12874111-12874133 GTATTTGACTGAGGGGCATAAGG + Intergenic
926502711 2:13675580-13675602 GAATTTGAGTGAGGGGCATGAGG + Intergenic
926856679 2:17264051-17264073 GAAACTGGATGTGGGGGATATGG - Intergenic
927351530 2:22123007-22123029 GAATTTGACTGAGGGGCATAAGG - Intergenic
928410525 2:31050686-31050708 GGAACTGGGTGAGGGGTATATGG + Intronic
928650552 2:33399736-33399758 GAATTTGACTGAGGGGTATAAGG + Intergenic
928854941 2:35791683-35791705 GAATTTGACTGAGGGGCATAAGG - Intergenic
929929532 2:46241780-46241802 GAAGCTGGATGATGGGTATATGG - Intergenic
930119877 2:47751788-47751810 GAATTTGAGTGAGGGGCGTAAGG + Intronic
930591050 2:53326757-53326779 GAATTTGACTGAGGGGCACAAGG - Intergenic
930667057 2:54109763-54109785 GTAACTGAATGTGGGGCATATGG - Intronic
930668222 2:54120791-54120813 GTGTCTGGATGAGGGGGATGTGG + Intronic
930771182 2:55132149-55132171 GAAGCTGGGTGATGGGAATATGG + Intergenic
930898704 2:56477122-56477144 GAATTATGCTGAGGGGCATAAGG - Intergenic
931114433 2:59149054-59149076 GAATTCAGCTGAGGGGCATAAGG - Intergenic
932390484 2:71385738-71385760 GAAACTGGGTGAAGGGTATATGG + Intronic
932527510 2:72487078-72487100 GAAGCTGGGTGAGGAGTATATGG - Intronic
932719504 2:74128590-74128612 GAAACTGGATGTGGGACATATGG + Intergenic
932870223 2:75390943-75390965 CAATTTGACTGAGGGGCATAAGG + Intergenic
933069189 2:77836339-77836361 GAATTTGGCTGAGGGGCATAGGG - Intergenic
933420994 2:82044287-82044309 GTGTCTGGATGAGGGGAATGTGG - Intergenic
933606436 2:84389303-84389325 GCATCTGGATGAGGGGAACGCGG + Intergenic
933706599 2:85295557-85295579 GAATCTGGATAAAGGTTATATGG - Intronic
933884674 2:86707106-86707128 GAAACTGGGTGAAGGGTATATGG - Intronic
934165686 2:89292141-89292163 GAATGCGACTGAGGGGCATAAGG - Intergenic
934201591 2:89890315-89890337 GAATGCGACTGAGGGGCATAAGG + Intergenic
935225698 2:101050501-101050523 GAACCTGGATGAGGTGTTTAAGG - Exonic
935299965 2:101685612-101685634 GAATTTGACTGAGCGGCATAAGG + Intergenic
935829246 2:106983220-106983242 GAAACTGAATGAGGGCTATATGG - Intergenic
936391895 2:112082485-112082507 GAAGCTGCATGATGGGCACAAGG + Intronic
936746420 2:115581956-115581978 GAATTTGGCTGAGGGACAGAAGG + Intronic
936840614 2:116764081-116764103 GAATTCGACTGAGGGGCATAAGG + Intergenic
937167920 2:119837792-119837814 GAATCTAGATGAGGGGAACACGG - Intronic
937193202 2:120124427-120124449 GAATCTAGTGGAAGGGCATATGG - Intronic
938056640 2:128220467-128220489 GAATTCAAATGAGGGGCATAAGG - Intergenic
938290757 2:130148858-130148880 GAATTCGACTGAGGGGCATAAGG + Intergenic
938655429 2:133426794-133426816 GAAACTAGATGAGAGGTATATGG + Intronic
938891697 2:135712096-135712118 GAACCTGGATGATGGGTACATGG + Intronic
939858475 2:147389565-147389587 GAATTTGACTGAGGGGCATAAGG - Intergenic
940272545 2:151907452-151907474 GAAACTGGGTGAAGGGTATATGG - Intronic
940468336 2:154061120-154061142 GAATCTGGTTAAAGGGGATAGGG - Intronic
940600393 2:155851606-155851628 GAATATGGATGATAGGGATATGG + Intergenic
940611473 2:155997976-155997998 GTATTTGGAGGTGGGGCATATGG + Intergenic
940782984 2:157952924-157952946 AAATTTGGCTAAGGGGCATAAGG - Intronic
940868440 2:158839475-158839497 GAATGGGACTGAGGGGCATAAGG - Intronic
941202164 2:162525421-162525443 GAATTTGGATAAGGGAGATAGGG + Intronic
942211995 2:173680537-173680559 AAATCTGGATAAAAGGCATATGG + Intergenic
943068914 2:183118682-183118704 GAATCTGACTAAGGGGCATAAGG + Intronic
943382364 2:187167608-187167630 GAATCTAAATGAAGGGTATATGG - Intergenic
943633580 2:190280948-190280970 GAATTTGTCTAAGGGGCATAAGG - Intronic
943903018 2:193465442-193465464 GAATTCGACTGAGGGGCATAAGG + Intergenic
943905160 2:193490067-193490089 GAATTTGACTGAGGGGTATAAGG - Intergenic
944053790 2:195501584-195501606 GAAACTGGATGAAGGGTACATGG + Intergenic
944586167 2:201175743-201175765 GAATTTGACTGAGGGGCATAAGG + Exonic
947295087 2:228621842-228621864 GAAACTGGATGAATGGTATAGGG + Intergenic
947402022 2:229740805-229740827 GAATCTGGATGAGAAGAATGGGG + Intergenic
947402029 2:229740854-229740876 GAATCTGGATGAGAAGAAGAGGG + Intergenic
947697234 2:232201891-232201913 GAATCTTGATGAAGGGTATATGG + Intronic
948160691 2:235821606-235821628 GAAGCTGGGTGAAGGGTATATGG - Intronic
948494825 2:238340748-238340770 GAATCTGGGTGAGAGGTATATGG - Intronic
1168984246 20:2034257-2034279 GAATCTGGGTGAAGGATATATGG + Intergenic
1169201483 20:3712384-3712406 GAAACTGGCTGAGCGGGATAGGG - Intergenic
1169315782 20:4589670-4589692 GAATCTGGACTAGGGGCTGATGG - Intergenic
1169421640 20:5465357-5465379 GCATCTGGATGAAGGGAATGTGG - Intergenic
1169708717 20:8537103-8537125 GAATTTGACTGAGGGGCATAAGG + Intronic
1169746072 20:8944343-8944365 GAGTCTGGGTGATGGGTATATGG + Intronic
1169762050 20:9107048-9107070 GAAGCTGGGTGATGGTCATATGG - Intronic
1169844735 20:9977397-9977419 GCAACTGGGTGATGGGCATATGG - Intergenic
1170195591 20:13686102-13686124 GAATATGGATGAAGGGCATATGG + Intergenic
1170282310 20:14663634-14663656 AAATCTGGATGAAGGAGATATGG + Intronic
1170563792 20:17581623-17581645 TAATTTGGATGTGTGGCATAAGG + Intronic
1171319603 20:24229777-24229799 GAATCTTGATAAGGGGGAAAGGG + Intergenic
1171375764 20:24693299-24693321 CAAATTGGGTGAGGGGCATATGG + Intergenic
1172010484 20:31843292-31843314 CTATCTGGATCATGGGCATAGGG - Intergenic
1172318666 20:33978202-33978224 GAAGTTGGATGATGGGCAAATGG + Intergenic
1172576883 20:36016418-36016440 GAAACTGGATGTGGGGTATATGG + Intronic
1172577124 20:36018037-36018059 GAAACTGGGCGTGGGGCATATGG - Intronic
1172641128 20:36441024-36441046 GAGTCTGGATGAGGGGGGCAGGG - Intronic
1172817819 20:37703149-37703171 GAAGCTGGATGAGGAATATACGG - Intronic
1172918009 20:38458478-38458500 GAAGCTGGGTGAAGGGCATATGG - Intergenic
1173721905 20:45266554-45266576 GAATCTGGGTGAAGGGAATATGG - Intergenic
1174728281 20:52888464-52888486 GAAACTGGGTGAGGGGTACATGG + Intergenic
1174775804 20:53342061-53342083 GAAACTGGGTGTGGGGCATGTGG - Intronic
1174867125 20:54148275-54148297 GAATCTGGGTGAATGGTATATGG - Intergenic
1174926150 20:54762288-54762310 GAATCTAGGTAAAGGGCATATGG - Intergenic
1175186977 20:57185305-57185327 GAAACTGGATGAAGGGCACTTGG - Intronic
1175223491 20:57431531-57431553 GAAGCTGGGTGAAGGGCGTATGG + Intergenic
1175369558 20:58478805-58478827 GAATCTGGCTGAGGGCAAAAGGG + Intronic
1175631004 20:60536378-60536400 GAATTTGACTGAGGGGCAGAAGG + Intergenic
1177073209 21:16537768-16537790 AAATCAGGAGGAGGGGAATAAGG + Intergenic
1177547663 21:22579472-22579494 GAATTAGACTGAGGGGCATAAGG - Intergenic
1177559300 21:22729745-22729767 GAATTTGACTGAGGGGCATAAGG + Intergenic
1177804842 21:25864722-25864744 GAAGCTGGATGAAGAGTATACGG - Intergenic
1178123087 21:29489256-29489278 GAATTTGAATGAGGGGCAGAAGG - Intronic
1178369216 21:32013214-32013236 GAAACTGGATGAGGGGTATTTGG - Intronic
1178625749 21:34217009-34217031 GATGCTGGTTGGGGGGCATAGGG + Intergenic
1178837558 21:36111681-36111703 GAATTTGACTGAGGGGCATAAGG - Intergenic
1179054735 21:37920636-37920658 GAATTCGACTGAGGGGCATAAGG - Intergenic
1179072417 21:38084112-38084134 TAAGCTGGATTAGGGGGATACGG - Intronic
1179254819 21:39706497-39706519 GAATTTGACTGAGGGGCATAAGG + Intergenic
1179267126 21:39813487-39813509 GAATGTGGGTAAGGGGAATATGG - Intergenic
1179299263 21:40091735-40091757 GAAGGTGAATGAGGAGCATAGGG + Intronic
1179619136 21:42601125-42601147 GAATTAGACTGAGGGGCATAAGG + Intergenic
1181782126 22:25201052-25201074 GCATCTGGATCAGGGGAAAAGGG + Intronic
1182308853 22:29390458-29390480 GAAGCTGGGTGAAGGGTATATGG - Intronic
1182453194 22:30433223-30433245 GAACCTGGAGGAGGAGGATAGGG + Intergenic
1183614439 22:38934924-38934946 GAATCTGGGTAAAGGGTATACGG - Intergenic
949676453 3:6459837-6459859 GAACTTGACTGAGGGGCATAAGG + Intergenic
949833026 3:8236806-8236828 GAAACTGGATGGGGAGCATATGG + Intergenic
950087177 3:10268089-10268111 GAAGCTGGGTGATGGGCATCTGG - Intronic
950101652 3:10360649-10360671 GAAACTGGATGAAGGGTATACGG - Intronic
950295828 3:11829406-11829428 GAATCTGGGAAAAGGGCATAGGG + Intronic
950373443 3:12550703-12550725 GAATTCGACTGAGGGGCATAAGG - Intronic
951051349 3:18097399-18097421 GAATCTGGATGAAAGGCATAAGG - Intronic
951308146 3:21091571-21091593 GAATCTGGATAAAGGGTATAAGG + Intergenic
951443836 3:22753841-22753863 GAAACTGGTTGAGGAGTATATGG + Intergenic
952675818 3:36029194-36029216 GAATTTGACTGAAGGGCATAAGG + Intergenic
952896950 3:38083999-38084021 GAAGCTGGCTGAGGGGTACATGG - Intronic
952952321 3:38534783-38534805 GAATCTGCATAAAGGGCATATGG - Intronic
953194546 3:40720232-40720254 GAATTTGTCTGAGGGGCATAAGG - Intergenic
953259335 3:41322394-41322416 AAATTTGTCTGAGGGGCATAAGG - Intronic
953323670 3:41994504-41994526 GAAACTGGGCGTGGGGCATATGG - Intergenic
953518431 3:43619463-43619485 GAAGCTAGGTGAAGGGCATAAGG + Intronic
953557964 3:43961898-43961920 GATTCTGAATGAAGAGCATATGG - Intergenic
953658768 3:44874925-44874947 GAATCTGGATAAAGGATATATGG - Intronic
953745752 3:45572788-45572810 GAATCCGATGGAGGGGCATAAGG - Intronic
953812363 3:46124215-46124237 GAATTTGACTAAGGGGCATAAGG - Intergenic
954532177 3:51330502-51330524 GCATCTGGATGGGGGGCAGACGG + Intronic
954883756 3:53854250-53854272 GAAGCTGGGTGAGAGGTATATGG - Intronic
954889574 3:53912932-53912954 GAATTTGACTGAGGGGCATAAGG + Intergenic
955319999 3:57967631-57967653 GAATTTGACTGAGGGGCAAAAGG + Intergenic
955445596 3:59006817-59006839 GAATCTGGGTGGGGAGCAAATGG + Intronic
955548723 3:60059614-60059636 GAATTCAGCTGAGGGGCATAAGG - Intronic
956633765 3:71342798-71342820 AAAACTGGATGAAGGGTATATGG - Intronic
957109214 3:75931111-75931133 GAATCTGGATGAAGCACAAAAGG - Intronic
957130971 3:76222253-76222275 GAATCTGACTGAGAGGCATAAGG + Intronic
957275083 3:78080747-78080769 GAATTTGATTGAGGGACATAAGG - Intergenic
958435422 3:94089852-94089874 GAATTAGACTGAGGGGCATAAGG - Intronic
958943533 3:100339091-100339113 GAAGCTGGATGAGGGCCAAGCGG - Exonic
959327592 3:104956920-104956942 GCATCTAGATGAGGGGAACATGG + Intergenic
959468566 3:106720801-106720823 GCATCTGGATGAGAGGAACATGG + Intergenic
959574348 3:107918228-107918250 GAAACTGGGTGTGTGGCATATGG + Intergenic
959649532 3:108738129-108738151 GAATTTGACGGAGGGGCATAAGG - Intergenic
959714606 3:109418609-109418631 AAATCTGGGTGAAGGGTATAAGG - Intergenic
960045813 3:113196874-113196896 GAAACTGGGTGAAGGGCATATGG - Intergenic
960049676 3:113227817-113227839 GAATCTGGGTGATGGGTACATGG - Intronic
960606771 3:119514239-119514261 GAATCTAGGTGAAGGGTATATGG - Intronic
960942111 3:122941840-122941862 GAAACTGGGTGAAGGGTATATGG + Intronic
961981359 3:131082764-131082786 GAATCTGGATAAAGGGCATATGG - Intronic
962780909 3:138715986-138716008 GAATCTGGATGATGGGTTCATGG + Intronic
962872536 3:139510173-139510195 GAAGCTGGGTGATGGGTATATGG - Intergenic
963156544 3:142103652-142103674 GAATCTGGGTGAAGGGCATCTGG + Intronic
963230745 3:142906661-142906683 GAATTCGACTGAGGGGCATATGG - Intergenic
963458058 3:145572678-145572700 GAATTTGACTGAGTGGCATAAGG + Intergenic
963719409 3:148843267-148843289 GAAGCTGGATGACGGGTATGTGG + Intronic
963750538 3:149174504-149174526 GAATCTGGGTGAAAGGTATATGG + Intronic
963902877 3:150749130-150749152 GAATCTGGATAAAGGCTATAAGG + Intronic
963906011 3:150774186-150774208 GCATCTGGATGAGGGGAACTTGG + Intergenic
964458117 3:156891436-156891458 TAATCTGGATGAGGGAAGTAAGG + Intronic
964647278 3:158971637-158971659 GAAACTGGGTGATGGGTATATGG - Intronic
964661546 3:159125532-159125554 GACACTGGATGTGGGGTATATGG + Intronic
964862366 3:161216975-161216997 GAATTTGACTGAGGGGCATAAGG - Intronic
965918223 3:173877620-173877642 GAACCTGGGTGAAGGGCATGTGG + Intronic
967213383 3:187188819-187188841 GAAGCTGGGTGATGGGCACATGG + Intergenic
967430758 3:189382738-189382760 GAATTCGGCTGAGGGGCACAAGG + Intergenic
967468649 3:189837383-189837405 GAATATAGATGATGAGCATATGG + Intronic
968845834 4:3041149-3041171 GAATCTCGGTGAGGGGCACAAGG - Intergenic
969348435 4:6583630-6583652 GAATTCGACTGAGGGGCATAAGG + Intronic
969417274 4:7068772-7068794 GATGCTGGATGATGGGAATATGG + Intergenic
969529424 4:7722491-7722513 GAAGCTGGAGGAGGTGCAAATGG - Intronic
969537439 4:7765359-7765381 GAGTCAGGACGAGGGGCACAGGG - Intronic
969947028 4:10793815-10793837 GAATTTGAACGAGGAGCATAAGG + Intergenic
970422757 4:15920493-15920515 GAATTTGACAGAGGGGCATAAGG - Intergenic
970471103 4:16380048-16380070 GAATTAGACTGAGGGGCATAAGG + Intergenic
971035790 4:22691627-22691649 GAAACTGGATGAGGGGCCATGGG - Intergenic
971477875 4:27089407-27089429 GAATTTGGCCAAGGGGCATAAGG + Intergenic
971787157 4:31119475-31119497 GAATTTGACTCAGGGGCATAAGG + Intronic
971825308 4:31614090-31614112 GAGTCTGGATGAGGTGGATGTGG + Intergenic
971860354 4:32094092-32094114 GAATTTGACTGAGGGGCATAAGG + Intergenic
971955823 4:33416949-33416971 GAATTTGACTGAGGGGCATAAGG - Intergenic
972241875 4:37202236-37202258 GAATTTGACTGAGGGGCATAAGG - Intergenic
972411911 4:38803340-38803362 GAATTTGTGTGAGGGGCATAAGG - Intronic
972501038 4:39677958-39677980 GAAACTGGGTGAAGGGCACATGG - Intergenic
972575501 4:40347644-40347666 GAAACTGGGTGAAGGGTATAAGG - Intronic
972704787 4:41531685-41531707 GAATCAGAATCAGGGGCAAAAGG - Intronic
972798469 4:42446972-42446994 CAATATGGATGAGAGTCATAGGG + Intronic
972865031 4:43221544-43221566 GAATACGACTGAGGGGCATAAGG + Intergenic
973193339 4:47411712-47411734 GAACCTGGGTGAGGGGTACATGG + Intronic
973222837 4:47748875-47748897 GAGTCTGGATGAAGGATATATGG - Intronic
973342031 4:49015274-49015296 GAGTGGGGAGGAGGGGCATAAGG - Intronic
973534432 4:51867192-51867214 GCACCTGGATGAGGGGAACAAGG + Intronic
974462350 4:62204572-62204594 GAATTTGACTGAGGGGCATAAGG - Intergenic
974615344 4:64272494-64272516 GGGTCTGGATGAGGGGAATGTGG - Intergenic
974691234 4:65300079-65300101 GAATTTGACTGAGGGGCATAAGG + Intergenic
974757636 4:66231927-66231949 GAAGCTGGATAAAGGGAATATGG - Intergenic
974840090 4:67289371-67289393 GAATTTGACTGAGGGGAATAAGG - Intergenic
974859483 4:67501880-67501902 AAATCTTGATGAAGGGGATATGG + Intronic
974876570 4:67710154-67710176 GAATTTGACTGAGGGGCATAAGG + Intergenic
974945297 4:68519624-68519646 GAATTTGACTGAGCGGCATAAGG - Intergenic
974955209 4:68630893-68630915 GAATTTGATTGAGGGGCACAAGG - Intronic
975023642 4:69521405-69521427 ACATCTGGATGAGGGGAATGTGG - Intronic
975346687 4:73299987-73300009 GAGTCTGGCTGAGGGGAATCTGG - Intergenic
975485443 4:74930431-74930453 GAATATAATTGAGGGGCATAAGG + Intergenic
975496440 4:75040686-75040708 GAAGCTGGGTGAAGGGTATACGG + Intronic
975703463 4:77089000-77089022 GAATTTGACTGAGGGGCATAAGG + Intergenic
976008548 4:80459565-80459587 GAATTTGACTGAGGGGCATAAGG - Intronic
976307210 4:83572424-83572446 GAATTTGGGTGATGGGTATAAGG - Intronic
976309112 4:83592715-83592737 AAATGTGGATAAAGGGCATAAGG - Intronic
976427318 4:84920540-84920562 GAATCTGGATAAAGGGCAACTGG + Intronic
976818270 4:89175219-89175241 GAATTTGACTGAGGGGCATAAGG - Intergenic
977768367 4:100827778-100827800 TAATCAGTAAGAGGGGCATAGGG - Intronic
977867769 4:102050206-102050228 GAATTCAGCTGAGGGGCATAAGG - Intronic
977869204 4:102070066-102070088 GAATTTGACAGAGGGGCATAAGG + Intronic
977973475 4:103237699-103237721 GAAACTGGATGAAGGGTAAAAGG + Intergenic
978510984 4:109517774-109517796 GAATCTGGATGAGAGAAATCTGG + Intronic
978592713 4:110343483-110343505 GCATCTAGATGAGGGGAACATGG - Intergenic
978938577 4:114410217-114410239 GAATTTGACTGAAGGGCATAAGG + Intergenic
978944027 4:114472637-114472659 GCATCTGGATGAGGGGAACATGG - Intergenic
979056126 4:115997421-115997443 GAATTTGACTGACGGGCATAAGG + Intergenic
979065205 4:116122871-116122893 GAATGCGACTGAGGGGCATAAGG + Intergenic
979678418 4:123434322-123434344 GTGTCTGGATGAGGGGGATGTGG + Intergenic
979899518 4:126200374-126200396 ACATCTGGACGAGGGGAATATGG + Intergenic
980798418 4:137715100-137715122 GATTTTGACTGAGGGGCATAAGG - Intergenic
981858801 4:149329207-149329229 AAAACTGGATGAAGGGTATATGG - Intergenic
981909191 4:149958500-149958522 GAAGCTGGATGAAGGGCAAATGG - Intergenic
982103746 4:151993591-151993613 GCATTTGACTGAGGGGCATAAGG + Intergenic
982494791 4:156077380-156077402 GCCTCTGGATGAGGGGGACATGG + Intergenic
982545970 4:156733761-156733783 GAGACTGGATGAAGGGTATATGG + Intergenic
983038687 4:162898615-162898637 GAATTTGACTGAGGGGCATAAGG + Intergenic
983406309 4:167335468-167335490 GAATTTGACTGAGGGGCATAAGG + Intergenic
983466556 4:168100468-168100490 GAACCTGTATGAGAGGCTTAAGG - Intronic
983697960 4:170555529-170555551 GAATCTGGATGAAGAATATATGG - Intergenic
983713031 4:170743491-170743513 GAATTTGAATGAGGGACATAAGG + Intergenic
983752135 4:171287750-171287772 GGATCTGGGTGTGGGGTATATGG - Intergenic
984084479 4:175291986-175292008 GAAATTGACTGAGGGGCATAAGG + Intergenic
984946280 4:184971101-184971123 GAAACTGGCTGAGGGGTATATGG + Intergenic
985899163 5:2773959-2773981 GAACCTGGGTAAGGGGGATACGG - Intergenic
986751640 5:10792985-10793007 GAATTTGACTGAGAGGCATAAGG - Intergenic
986977805 5:13412580-13412602 GAATTTGACTGAGGGGCATAAGG - Intergenic
987655012 5:20796203-20796225 GAATTTGACTGAGGAGCATAAGG - Intergenic
988131169 5:27108226-27108248 GAATTTGACTGAGGGGCATAAGG + Intronic
988461022 5:31437994-31438016 TAATTTTGATGAGGGGCATCGGG - Intronic
988681534 5:33488843-33488865 GCGTCTGGATGAGGGGAATGTGG + Intergenic
988768551 5:34407699-34407721 GAATTTGACTGAGGAGCATAAGG + Intergenic
988940485 5:36140127-36140149 GCATCTGGATGAGAGGAATGTGG - Intronic
989260994 5:39420347-39420369 AAATCTGGATGAGGGAAATATGG - Intronic
989425341 5:41290280-41290302 GTGTCTGGATGAGGGGAATGTGG + Intergenic
989537692 5:42582763-42582785 GCATCTGGACGAGGGGAATGTGG - Intronic
990114280 5:52369284-52369306 GAATTTGACTGAGGGGCATAAGG + Intergenic
990213126 5:53502063-53502085 GAATTTGACTGAGGGGCATAAGG + Intergenic
990318054 5:54602564-54602586 GAATTAGACTGAGGGGCATAAGG + Intergenic
990687693 5:58325260-58325282 GAATCTGAACGAGGGACAAAAGG - Intergenic
991083463 5:62625966-62625988 AAAACTGGGTGAGGGGCACATGG - Intronic
991657620 5:68919900-68919922 GAATTTGACTGAGAGGCATAAGG + Intergenic
991686351 5:69185747-69185769 GGATTTGACTGAGGGGCATAAGG + Intergenic
992231924 5:74672171-74672193 GGAGATGGATGAGGGGCATGTGG - Intronic
992399123 5:76395545-76395567 GAATTCGACTGAGGGGCATAAGG - Intergenic
992432596 5:76723835-76723857 GAAGCTGGATGATGGGTATGGGG - Intronic
992560001 5:77941931-77941953 GAAACTGGATGATGGGTGTATGG + Intergenic
992916461 5:81458471-81458493 GAATCTGGGTGAAGGGTGTATGG + Intronic
993406992 5:87524304-87524326 GAATTTGACTGAGGCGCATAGGG + Intergenic
993417292 5:87650965-87650987 GAAACTGAATGCAGGGCATATGG - Intergenic
994080195 5:95700256-95700278 GAAACTGCATGAAGGGCAAATGG - Intergenic
994196575 5:96929274-96929296 GAATTCTGCTGAGGGGCATAAGG - Intronic
994281437 5:97908179-97908201 GAATTTGGCTGAGGGGCATAAGG - Intergenic
994339068 5:98604317-98604339 GAATCTAGATGAAGGGTATGTGG + Intergenic
995077832 5:108008041-108008063 GAATATGCATTAGGGGAATAAGG + Intronic
995130053 5:108620568-108620590 GAATTTGACGGAGGGGCATAAGG + Intergenic
995191400 5:109322450-109322472 GAATTTGACTGAGGGGCATAAGG - Intergenic
995207317 5:109495657-109495679 GAAGCTGAATGAAGGGTATATGG + Intergenic
995245196 5:109927560-109927582 GAATCTAGGTAAAGGGCATATGG - Intergenic
995716102 5:115083141-115083163 GGTTCTGGATGAGGGGCACTAGG + Intergenic
996281976 5:121741049-121741071 GAGTCTCAATGTGGGGCATAGGG + Intergenic
996953383 5:129155018-129155040 GAATTTGACTGAGGGGCATAAGG + Intergenic
998059380 5:139107423-139107445 AAATCTGGATGAAGAGTATATGG - Intronic
998325746 5:141278480-141278502 GAATCATGTTGATGGGCATAGGG + Intergenic
998624521 5:143830963-143830985 GAAACTGGATGAGGGGTATATGG + Intergenic
998796094 5:145820703-145820725 GAATTCGACTGAGGGGCATAAGG + Intronic
999147564 5:149406319-149406341 GAATCTGGGTGATGGGAATTGGG - Intergenic
999207522 5:149860286-149860308 GAATCTGGGTGATGGGTATGTGG + Exonic
999212739 5:149904498-149904520 GCATCTGGCTGAGGGGCAACTGG + Intronic
1000099259 5:157999039-157999061 GAATTTGGATAAAGGGCATTTGG - Intergenic
1000766576 5:165299132-165299154 GAATTTGACCGAGGGGCATAGGG + Intergenic
1001805569 5:174582812-174582834 GAAGCTGGGTGCTGGGCATACGG + Intergenic
1003166414 6:3682844-3682866 GAAACTGGGTGAGGGGTATAGGG - Intergenic
1003201897 6:3969140-3969162 GAATTTGGCTGAGGGGCATAAGG + Intergenic
1003218003 6:4132700-4132722 GAACCTGGATGATGGGTATTGGG - Intronic
1003870858 6:10401945-10401967 GATTCTGGATGATGTGGATATGG - Intronic
1004265227 6:14143676-14143698 CAAGCTGGAGGAGGGGCAGAAGG + Intergenic
1004433875 6:15571188-15571210 GAATCTGGGTGATGGGGACATGG + Intronic
1004915684 6:20329810-20329832 GAAACTGAATGTGGGGTATATGG - Intergenic
1005380812 6:25232362-25232384 GAAACTGGGTGAGAGGTATAAGG + Intergenic
1005485913 6:26299303-26299325 GAATGTGGATGAGCATCATAGGG + Intergenic
1005661965 6:28007548-28007570 GAAACTGGATGTGGGCAATATGG + Intergenic
1005782207 6:29203615-29203637 GAAACTGGTTGAGGTGTATATGG - Intergenic
1005812157 6:29525904-29525926 GAATTCGACTGAGGGGCATACGG + Intergenic
1005901250 6:30218663-30218685 GTATCTGGGTTAGGGACATATGG - Intergenic
1005952849 6:30644230-30644252 GAATCTGGATCTGGGGGAAATGG - Intronic
1006017994 6:31097745-31097767 GAATTTGACTGAGGGGCATAAGG - Intergenic
1006377127 6:33677814-33677836 GAATTAGGATGAGGGGTAGAGGG - Intronic
1006689475 6:35868758-35868780 GAATCTGGGTGATGGGTATCTGG + Intronic
1007101650 6:39251913-39251935 GAAACAGGGTGAGGGGGATAAGG - Intergenic
1007163571 6:39812023-39812045 GAATTTGTATCTGGGGCATAGGG + Intronic
1008282558 6:49613778-49613800 GAAACTGGATGAGGGACATATGG - Intronic
1009401551 6:63262295-63262317 GAATTTGACTGAGGAGCATAAGG + Intergenic
1009560282 6:65232572-65232594 GAAACTGGGTGAGGGGTATATGG - Intronic
1009684007 6:66932984-66933006 GAATATGACTGCGGGGCATAAGG - Intergenic
1010764695 6:79765489-79765511 GCTTCTGGATGAGGGGAATGCGG - Intergenic
1010792934 6:80085541-80085563 GAACCTGGATGAAGAGTATATGG + Intergenic
1010977294 6:82330047-82330069 GAATTCGACTGAGGGGCATAAGG - Intergenic
1011364540 6:86567290-86567312 GAAACTGGATATGGGGTATAGGG + Intergenic
1011436778 6:87346878-87346900 GAAGCTGGATGAAGGGTACAGGG - Intronic
1011532584 6:88339438-88339460 GAAGATGGATCACGGGCATAGGG + Intergenic
1011749272 6:90438939-90438961 GAAGCAGGATGAGGGGAATGAGG - Intergenic
1012000230 6:93645186-93645208 GAATCTGACTGAGGAGCATAAGG - Intergenic
1013087242 6:106866974-106866996 GTGTCTGGATGAGGGGGACATGG - Intergenic
1013095610 6:106942075-106942097 GAATCAGGAAGAGGGACAGAAGG - Intergenic
1013392951 6:109705032-109705054 GAGTCTAGATGAAGGGTATATGG + Intronic
1013470472 6:110459715-110459737 GAAACTGGGTGAGGGTCATATGG + Intronic
1013545875 6:111156833-111156855 GAAACTGGATGTGAGGTATATGG + Intronic
1013906734 6:115228839-115228861 GAAACTGGATGTGGGGTATATGG - Intergenic
1014757281 6:125315413-125315435 GATTCTGAAAGAGGGGCATGTGG - Intergenic
1014817718 6:125953529-125953551 GCATCTGGATGAGGGAAATGTGG - Intergenic
1015129753 6:129795842-129795864 GAATCTGGATGAAGGGTTTCTGG - Intergenic
1015215844 6:130749269-130749291 GCATCTGGATGAGGGGAATACGG + Intergenic
1015824856 6:137300793-137300815 GAATTTGACTGAGGGGCATAAGG + Intergenic
1015848416 6:137546964-137546986 GAAGCTGGGGGAGGGGCAAATGG - Intergenic
1016126707 6:140412397-140412419 GACTTTGATTGAGGGGCATAAGG - Intergenic
1016338765 6:143038133-143038155 GAATCTGGATGAAGAGAATGTGG - Intergenic
1016536224 6:145109636-145109658 GAATCAGGATGTAGGGCCTATGG + Intergenic
1016754754 6:147672656-147672678 GAAGGTGGATGTGGGGGATAAGG - Intronic
1017087384 6:150726528-150726550 GAAGCTGGATGAAAGACATATGG - Intronic
1017426974 6:154332049-154332071 GAATTTGGCTGAGGGGCATAAGG - Intronic
1017474833 6:154779879-154779901 GAAACTGAGTGAGGGGCACATGG - Intronic
1017548255 6:155475070-155475092 GAATCTGGGACAGGTGCATAGGG + Intergenic
1017821495 6:158052281-158052303 GAATCTGGGTGAAGGACATATGG - Intronic
1018134901 6:160769616-160769638 GAATTTGACTGAGGGGCATGAGG - Intergenic
1018994060 6:168697465-168697487 GAATCTGAGTGAAGGGCACATGG + Intergenic
1019702979 7:2483074-2483096 GATTCTGAATGAGGGGAACAGGG + Intergenic
1019817733 7:3213429-3213451 GAATTCGACTGAGGGGCATAAGG - Intergenic
1020473697 7:8569605-8569627 GAAGCTGGATGATGGGTCTATGG + Intronic
1020762916 7:12290159-12290181 GCATCTGGATGAGAGGAACATGG - Intergenic
1021269915 7:18573768-18573790 GTGTCTGGATGAGGGGAACATGG + Intronic
1021506381 7:21390034-21390056 GAATTTGACTGAGGAGCATAAGG - Intergenic
1021839487 7:24711133-24711155 GAAGCTGGATGGTGGGCACATGG + Intronic
1022217125 7:28274358-28274380 GAATCTGGATGATGGACATATGG - Intergenic
1022232353 7:28426435-28426457 GGATGTGGCTGAGGGGCCTAGGG - Intronic
1022474437 7:30700736-30700758 AAATCTGGAAAAGGGGTATATGG + Intronic
1022597422 7:31725703-31725725 GAAACTGGGTGAAGGGTATATGG + Intergenic
1022702552 7:32775480-32775502 GAATCTGGATGGGGAACAAAGGG - Intergenic
1022859523 7:34352816-34352838 GAAACTGGGTGAAGGGCACATGG + Intergenic
1023599229 7:41865134-41865156 GCATCTGAATGAGGGGAATGTGG + Intergenic
1023684308 7:42719049-42719071 GAATTTGTCTGAGGAGCATAAGG + Intergenic
1023708681 7:42968877-42968899 GAAACTGGATGAGGGGTCTATGG - Intergenic
1024940890 7:54761867-54761889 GCATTTGGATGAGGGGCTTCTGG - Intergenic
1026352194 7:69527104-69527126 GAATTTGACTGAGGGGCATAAGG - Intergenic
1027473838 7:78605682-78605704 GAATCTGGAAGGAGGGCAGAAGG + Intronic
1027596783 7:80184169-80184191 GAATTCGGCCGAGGGGCATAAGG + Intronic
1027616558 7:80431309-80431331 GAATTTGACTGAGGGGCATAAGG - Intronic
1027924927 7:84447936-84447958 GAATCTGCATGTGGTGCATCTGG + Intronic
1028525856 7:91785886-91785908 GAAACTGGGTGACGGGCATATGG + Intronic
1030257744 7:107529803-107529825 GAATTCGACTGAGGGGCATAAGG - Intronic
1030414795 7:109229678-109229700 GAATTTATCTGAGGGGCATAAGG + Intergenic
1030515554 7:110533799-110533821 GAATTTGACTGAGAGGCATAAGG - Intergenic
1030816843 7:114049328-114049350 GAATTTGGCTGAATGGCATAAGG - Intronic
1030825751 7:114155712-114155734 GAATTTGATTGAGGGGCATAAGG + Intronic
1030827767 7:114182055-114182077 CAATCAGGTTGAGGGGAATAAGG - Intronic
1031847315 7:126821702-126821724 GAACCAGGATAAGGGGAATATGG - Intronic
1032360619 7:131251574-131251596 GAATCTTTATGAGGGCCTTATGG - Intronic
1032371419 7:131356864-131356886 GAATTCGAATGAGGGGCATAAGG + Intronic
1032444433 7:131969733-131969755 GAAGCTGGATGATGGGTACAGGG - Intergenic
1032649036 7:133857737-133857759 GCATCTGGATGAGGGGAATGTGG + Intronic
1032767025 7:135005036-135005058 GAATCTAGTTGATGGCCATATGG - Intronic
1033153090 7:138933610-138933632 GAAGCTGAATGAAGGGTATATGG + Intronic
1033248498 7:139738687-139738709 AAATCTGGATATGGGGTATAGGG + Intronic
1033315780 7:140296266-140296288 GAAGCTGGGTGAAGGCCATATGG + Intronic
1034149992 7:148907762-148907784 GAATCTGGGTGAAGGATATATGG - Intergenic
1034196309 7:149250734-149250756 GAATCTGGAGGATTGGCAGAAGG + Exonic
1034651452 7:152694012-152694034 GAAACTGGATGCTGGGTATATGG + Intergenic
1034685621 7:152968364-152968386 GAATTTGACTGAGGGCCATAAGG - Intergenic
1034734355 7:153414300-153414322 GAAACTGGATAAAGGGTATATGG - Intergenic
1034852665 7:154509921-154509943 GAATGGGGGTGAGGGGCATGGGG + Intronic
1036479179 8:9122884-9122906 GAGTCTGAATGAAAGGCATACGG - Intergenic
1036625967 8:10471782-10471804 GAGTTTGACTGAGGGGCATAAGG + Intergenic
1037132874 8:15427673-15427695 GAATTTGACTGAGGGGCATAAGG - Intronic
1037714934 8:21389436-21389458 AAACCTGTATGAAGGGCATAAGG + Intergenic
1037968976 8:23158222-23158244 GAATTGGACTGAGGGGCATAAGG - Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038509003 8:28113249-28113271 GAATGTGGATGCAGGGCAGAAGG - Intronic
1038526510 8:28278765-28278787 GAAACTGGGTGAGGGGTAGACGG + Intergenic
1038669195 8:29568529-29568551 GTTTCTGGATGAAGGGCACATGG + Intergenic
1039095965 8:33885669-33885691 GAATTTGACTGAGGGGCATAAGG + Intergenic
1039228705 8:35419461-35419483 GCATCTGGATGAGGGGGACATGG + Intronic
1039375476 8:37028435-37028457 GAATCTGGGTAAAGGGCATATGG - Intergenic
1039500061 8:38009581-38009603 GAATTCGACTGAGGGGCATAAGG - Intergenic
1039959213 8:42232824-42232846 GAATTTGACTGAGGGGCATAAGG + Intergenic
1041085580 8:54253431-54253453 GAAGATGGAGGAGGGGCATTGGG + Intergenic
1041086441 8:54261139-54261161 GAATCTGTGTAAGGGGTATACGG - Intergenic
1041361407 8:57058271-57058293 GAAACTGGACGAAGGGCACAGGG - Intergenic
1041395654 8:57388309-57388331 AAATTTGACTGAGGGGCATAAGG - Intergenic
1041482814 8:58342440-58342462 GAATTTGACTGAGGGGCATAAGG + Intergenic
1041565350 8:59271347-59271369 GAAACTGGGTGAAGGGTATATGG - Intergenic
1041956102 8:63559264-63559286 ACATCTGGATGAGGGGAATGTGG + Intergenic
1042281739 8:67063460-67063482 GAAGCTGGAAGAGGTGCATAGGG - Intronic
1042589888 8:70387686-70387708 GAATCTGGATGGGGGATAGAGGG + Intronic
1042758952 8:72250872-72250894 GAAGTTGGATGAGTGGCCTAAGG - Intergenic
1042917445 8:73889404-73889426 GAATTCAGTTGAGGGGCATAAGG - Intergenic
1042924259 8:73951288-73951310 GAAGCTGGATGATGGGCACATGG + Intronic
1043215992 8:77588924-77588946 GAAGCTGGATGAGGGGTATAAGG + Intergenic
1044085512 8:87937772-87937794 GAATTCGACTGAGGGGCATAAGG - Intergenic
1044123357 8:88425607-88425629 GAATTTAACTGAGGGGCATAAGG - Intergenic
1044266654 8:90189823-90189845 GACTCCTGATGAAGGGCATATGG + Intergenic
1044289288 8:90448502-90448524 GAATCTGGAGGAGGAGCTTCTGG - Intergenic
1044390294 8:91642104-91642126 GAATTTAGATGTTGGGCATATGG - Intergenic
1044709017 8:95037519-95037541 GAATTTGGAAGAGAGGCCTATGG + Intronic
1044739457 8:95311196-95311218 GAATTTGGATGAAGGGTATGTGG - Intergenic
1045427762 8:102084328-102084350 TAATTTGACTGAGGGGCATAAGG + Intronic
1045434489 8:102147750-102147772 GAAACTGGGTGAGGGATATATGG + Intergenic
1045838749 8:106554574-106554596 GAATCTGGGTGAAGTGTATATGG + Intronic
1045977719 8:108148580-108148602 GAATTCGGCTGAGGGTCATAAGG + Intergenic
1046001119 8:108421744-108421766 GAATCTGGAAGTGGGGACTATGG + Intronic
1046184301 8:110692978-110693000 GAATTTGACTAAGGGGCATAAGG + Intergenic
1046465878 8:114602560-114602582 GAAACTGGATGAAGGAAATATGG + Intergenic
1046946955 8:119983181-119983203 GGTGCTGGATGAAGGGCATAAGG + Intronic
1047152944 8:122285021-122285043 GAATTTGACGGAGGGGCATAAGG - Intergenic
1047243003 8:123110566-123110588 GAAGCTGGGTGATGGGCATGGGG - Intronic
1047300828 8:123612334-123612356 GAAACTGAATGAGGGGTGTATGG - Intergenic
1048117841 8:131545262-131545284 GAATTTGATTGAAGGGCATAAGG + Intergenic
1048128460 8:131663800-131663822 GAATTTGACTGAGGGGCATAAGG - Intergenic
1049140572 8:140950349-140950371 GCATCTGGATGAGGGGAACGAGG - Intronic
1050297563 9:4221261-4221283 GAATCTGGGTGAAGGGCATATGG + Intronic
1050523806 9:6528230-6528252 TTATCTGGATAAGGGGCATCAGG + Intergenic
1051379353 9:16439563-16439585 GAAGCATGATGAGAGGCATAAGG + Intronic
1051880764 9:21837512-21837534 GAATCTGGGTGATGTGTATATGG + Intronic
1051972979 9:22913370-22913392 GAATGTGACTGCGGGGCATAAGG - Intergenic
1052341999 9:27372929-27372951 GAAACTGGGTGAGGGATATATGG + Intronic
1052424709 9:28289918-28289940 GAATTTGTATGAAGGGCATGGGG - Intronic
1052437263 9:28444644-28444666 GTGTCTGGATGAGGGGAATATGG - Intronic
1052726959 9:32240516-32240538 GAATCTGGATGAAGTGTATATGG - Intergenic
1053117256 9:35516298-35516320 AAATATGGATGAGAGGCATGGGG - Intronic
1053473970 9:38368528-38368550 GAAACTGGATAAGGGGTACATGG - Intergenic
1055199694 9:73645659-73645681 GAATTTGATGGAGGGGCATAAGG + Intergenic
1055530962 9:77183160-77183182 GAATCTAGATAATGGGTATATGG - Intronic
1056435180 9:86569035-86569057 GAATTTGACTGAGGGGCCTAAGG + Intergenic
1058247855 9:102653189-102653211 GAATTTGACTGAGGGACATAAGG - Intergenic
1058460892 9:105181631-105181653 GAAACTAGATGAGGGGTATATGG + Intergenic
1058584112 9:106488190-106488212 GAATTTGGATTAGGGAGATAAGG + Intergenic
1058791782 9:108454142-108454164 GAAGGTGGATGATGGGCACAGGG - Intergenic
1058853041 9:109032005-109032027 GAATCTAGATGAAAGACATATGG - Intronic
1059535278 9:115074926-115074948 GAACCTGGGTGATGGGCACAGGG + Intronic
1059553621 9:115255448-115255470 GAATCTGGATGAAGGGAATATGG - Intronic
1060049270 9:120365810-120365832 GAAACTGGATCATGGGCATCTGG + Intergenic
1060751410 9:126171957-126171979 GAAACTGGATATGGGGTATATGG - Intergenic
1061107936 9:128546573-128546595 GAATCTGGGTGAAGGGTATATGG + Intergenic
1061322620 9:129840554-129840576 GAATCTAGGTGAGGGGTATGTGG - Intronic
1061628107 9:131854088-131854110 GAAGCTGGATGAGGGGTACATGG + Intergenic
1061743128 9:132721952-132721974 GCGTCTGGATGAGGGGAATGTGG + Intergenic
1061766599 9:132885560-132885582 GAATCTGGGTGAGGGTTATATGG - Intronic
1185757508 X:2663414-2663436 GAATTTGACTGAGGGCCATAAGG - Intergenic
1185886738 X:3790006-3790028 GAATTTGACTGAAGGGCATAAGG - Intergenic
1186208403 X:7224458-7224480 GTATTTGGATGAGGGGCCTTTGG + Intronic
1186319962 X:8413562-8413584 GAAGCTGGAGGAGGGACATGTGG - Intergenic
1186620915 X:11239181-11239203 CAAACTGGGTAAGGGGCATAAGG + Intronic
1186744310 X:12551216-12551238 GAAACTGCATGATGGGCATATGG - Intronic
1186821571 X:13293277-13293299 GAAGCTGGATAAAGGGCATATGG + Intergenic
1187418413 X:19113690-19113712 GAATCTGGATTAAGGGCATGGGG + Intronic
1187554630 X:20340176-20340198 TAAGCTGGATGAGGGGTACATGG - Intergenic
1187743187 X:22378791-22378813 GAAACTGGATATGGGGCATACGG - Intergenic
1188015015 X:25098833-25098855 GAATCTGGGTGAAGGGTATATGG + Intergenic
1188284489 X:28311491-28311513 GAATTTGACTGAGGGGCATAAGG + Intergenic
1188881165 X:35493508-35493530 GAATTTGACCGAGGGGCATAAGG - Intergenic
1188883344 X:35518054-35518076 GAATTAGACTGAGGGGCATAAGG + Intergenic
1188898619 X:35700179-35700201 GAATTTGACTGAGGGGCATAGGG + Intergenic
1188953687 X:36408200-36408222 GAATTCGACTGAGGGGCATAAGG - Intergenic
1188989797 X:36803580-36803602 GAATTCTGCTGAGGGGCATAAGG - Intergenic
1189742040 X:44129114-44129136 GAATCTGGGTGAAGGGGATACGG + Intergenic
1189951530 X:46236275-46236297 GAAGGTGGATGAAGAGCATATGG - Intergenic
1190065130 X:47234952-47234974 GAATCTGGATGAAGGACATATGG + Intronic
1190416125 X:50182268-50182290 GAAGCTAGATGAAGGGTATATGG + Intergenic
1190775745 X:53551093-53551115 GAGTCTGGATGAAGGTCACAGGG + Exonic
1192337711 X:70235894-70235916 GAACTTGGATGAGGGGCCTGTGG - Intronic
1192416751 X:70987903-70987925 GAAACTGGATGCAGGGTATATGG + Intergenic
1193518726 X:82503044-82503066 GAATTTGACTGAGGGGAATAAGG - Intergenic
1193583769 X:83295299-83295321 GAATTTGACTGAGGGGTATAAGG - Intergenic
1193731865 X:85111985-85112007 GAATTAGACTGAGGGGCATAAGG + Intergenic
1194234175 X:91361663-91361685 GAATATGAATGAGGGGCATAAGG + Intergenic
1194627594 X:96243657-96243679 GAATTTGACTGAGGGGCATAAGG + Intergenic
1194810610 X:98382952-98382974 GAATTTGACTGAGGGGCATAAGG - Intergenic
1195220433 X:102741120-102741142 GAATTTGACTGAGGGGCATAAGG + Intronic
1195256795 X:103098830-103098852 GAATTTGACTGAGGGGCATAAGG + Intergenic
1196112409 X:111961142-111961164 GAATCTGGATGAAAGGTACATGG + Intronic
1196287010 X:113894453-113894475 GAATTTGACTGAGGAGCATAAGG - Intergenic
1196349717 X:114713147-114713169 GAATCTGGATGATGGTGTTATGG - Intronic
1196373188 X:115001390-115001412 GAATTTGACTGAAGGGCATAAGG + Intergenic
1197837689 X:130712849-130712871 GAATTCGACTGAGGGGCATAAGG - Intronic
1197932247 X:131707924-131707946 GAATCCGACTGAGGGGCATAAGG - Intergenic
1198031065 X:132753914-132753936 GAAACTGGGTGTGGGGCTTATGG - Intronic
1198167216 X:134069821-134069843 GAATCTAGATGATGGGTGTATGG + Intergenic
1198413970 X:136401239-136401261 GAATCAAGATGAGGGACACAAGG - Intronic
1198492950 X:137161906-137161928 GAAGCTGGATTATGGGTATATGG - Intergenic
1198757902 X:140000497-140000519 CAATCTGACTGAGGGGCATAAGG + Intergenic
1198957791 X:142150672-142150694 TAATTTGACTGAGGGGCATAAGG - Intergenic
1199352869 X:146824354-146824376 GAATCTGGGTGAACGGTATAAGG - Intergenic
1199662027 X:150061100-150061122 GAGGCTGGATGATGGGTATAGGG - Intergenic
1199670828 X:150146832-150146854 CAATCTAGATGATGGGCATTTGG + Intergenic
1199703645 X:150405315-150405337 AAAACTGGATGTGGGGAATAGGG + Intronic
1201910023 Y:19124521-19124543 GAATTTGACTGAGAGGCATAAGG + Intergenic