ID: 924602148

View in Genome Browser
Species Human (GRCh38)
Location 1:245500675-245500697
Sequence CTTGAACTTCACCAGGGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924602139_924602148 26 Left 924602139 1:245500626-245500648 CCTTCCAAACTCTCAGAAGAACA 0: 1
1: 0
2: 0
3: 14
4: 257
Right 924602148 1:245500675-245500697 CTTGAACTTCACCAGGGCGAGGG 0: 1
1: 0
2: 0
3: 7
4: 83
924602143_924602148 2 Left 924602143 1:245500650-245500672 CCAAGGCCAGGCAGCTTATGTAG 0: 1
1: 0
2: 0
3: 9
4: 161
Right 924602148 1:245500675-245500697 CTTGAACTTCACCAGGGCGAGGG 0: 1
1: 0
2: 0
3: 7
4: 83
924602140_924602148 22 Left 924602140 1:245500630-245500652 CCAAACTCTCAGAAGAACATCCA 0: 1
1: 0
2: 0
3: 9
4: 206
Right 924602148 1:245500675-245500697 CTTGAACTTCACCAGGGCGAGGG 0: 1
1: 0
2: 0
3: 7
4: 83
924602144_924602148 -4 Left 924602144 1:245500656-245500678 CCAGGCAGCTTATGTAGCTCTTG 0: 1
1: 0
2: 1
3: 9
4: 86
Right 924602148 1:245500675-245500697 CTTGAACTTCACCAGGGCGAGGG 0: 1
1: 0
2: 0
3: 7
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924602148 Original CRISPR CTTGAACTTCACCAGGGCGA GGG Intronic
901263557 1:7891998-7892020 GTGGAACTTCACCAGGCAGAGGG - Intergenic
909358396 1:74733858-74733880 CTTGAACATCACCAGTGTTAAGG + Intronic
909567210 1:77066621-77066643 CCTGAATTCCACCAGGGTGATGG + Intergenic
914347432 1:146811845-146811867 GATGAACTTCAGCAGGGCCAAGG + Intergenic
916073463 1:161186001-161186023 CTTGAACTTCTCTAGGGACAGGG + Exonic
919820343 1:201468469-201468491 CTTGAACTTGACCAGGCCTAGGG + Exonic
920159869 1:203988330-203988352 CTTGGATTTCACCAGGGTAATGG + Intergenic
920914372 1:210248187-210248209 CTTGAAGTTAAACAGGGGGATGG + Intergenic
921917198 1:220626257-220626279 ATTGATATTCACCACGGCGATGG + Intronic
922574764 1:226654396-226654418 CCTGAGCTTCCCCAAGGCGAGGG - Intronic
924513487 1:244747687-244747709 CTTGAACTGAACCCGGGAGATGG - Intergenic
924602148 1:245500675-245500697 CTTGAACTTCACCAGGGCGAGGG + Intronic
1062923805 10:1299392-1299414 CTAGATCTTCACCAGGGGCAGGG - Intronic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1073114715 10:101085267-101085289 CTTGAACTCCACCTGGGAGGTGG + Intergenic
1081739588 11:45429092-45429114 CTTGAACTCCTCCAGGGACAAGG - Intergenic
1082101333 11:48175748-48175770 CTCGCACTTCACCAAGGGGATGG + Intergenic
1089402350 11:118171620-118171642 CTTGAACCTCACCATCTCGAAGG + Intronic
1091371747 11:135066166-135066188 CGTGAGCTTCACCAGGGCCCTGG + Intergenic
1092515071 12:9202771-9202793 CTTCAGCTTCACCAAGGAGAAGG + Intronic
1096650967 12:53061815-53061837 CTTGTCCTTCAGCAGGGCAATGG - Exonic
1101147594 12:101855651-101855673 CTTGAGTTTCAACAGGGAGAAGG + Intergenic
1104679992 12:130743428-130743450 CCTGTACCTCACCAGGGAGAGGG - Intergenic
1122205939 14:100147970-100147992 CTTGAACTTCACCACAGCCCAGG - Intronic
1130567337 15:85007986-85008008 CTTGACCTTGCCCAGGGTGATGG + Intronic
1131152305 15:90054624-90054646 CTTGAACTTCATCAGGGCCTGGG - Intronic
1131938717 15:97536801-97536823 ATTGAACTTTTCCAGGGAGAAGG + Intergenic
1133315801 16:4883282-4883304 CTTGGCCTGCACCAGGGCAAGGG + Exonic
1138563479 16:57815982-57816004 CTTGAACTTCACCTGGGGTGAGG + Intronic
1139986555 16:70903400-70903422 GATGAACTTCAGCAGGGCCAAGG - Intronic
1146490438 17:33277624-33277646 ATTAATCTTCACCAGGGCAAAGG - Intronic
1147717592 17:42518868-42518890 CATGAAGTTCCCCAGGGCAAGGG - Intronic
1148638825 17:49169661-49169683 CTTGAACTGGACCCGGGTGAGGG - Exonic
1155347294 18:24870751-24870773 CGTGATCTGCACCAGGGCAATGG + Intergenic
1160014948 18:75133421-75133443 CTGGAACTTCCCCAAGGAGAGGG - Intergenic
1160490266 18:79331924-79331946 CTTGAACAACACGAGGGCCAGGG + Intronic
1161030255 19:2054813-2054835 CTTGAACGTCCACAGGGCGATGG - Intergenic
1163026975 19:14518212-14518234 CTTGAACTTCTCCTCGGCGCCGG + Exonic
1163857678 19:19717638-19717660 CTTGAATTTCACAAGTGAGAAGG - Intronic
1166144671 19:40825972-40825994 CTTCAGCTTCTCCAGGGAGAAGG + Intronic
1166183072 19:41122235-41122257 CTTCAGCTTCTCCAGGGAGAAGG - Intronic
1167870394 19:52364657-52364679 CTTGAACCTCACATGGGGGAAGG - Intronic
927926033 2:27014415-27014437 CTGGAACTTCAGCAGGGCTCAGG + Intronic
928666955 2:33558983-33559005 TTTGAACTTGACCAGGATGAAGG + Exonic
928994632 2:37274431-37274453 TTTGCACTTCTCCAGGGCAAGGG - Exonic
936992643 2:118382630-118382652 CTTGAACAACACAAGGGTGAGGG - Intergenic
940231649 2:151460626-151460648 CTTTCATTTCACCAGGGCCATGG - Intronic
940897336 2:159093511-159093533 CTTTAACTGCACAAGGGCAAGGG - Intronic
941026537 2:160462152-160462174 CATCAGATTCACCAGGGCGAGGG + Intronic
943786342 2:191882068-191882090 CTTGAACTTCTCCTCGGCGCCGG + Intergenic
948846472 2:240685134-240685156 CCTGAACTTCCCCAGAGGGAGGG + Intergenic
948847390 2:240689599-240689621 CCTGAACTTCCCCAGAGGGAGGG - Intergenic
1177057104 21:16319526-16319548 CTTGAAATTAGCCACGGCGAAGG + Intergenic
1178575777 21:33788647-33788669 CTTGAACTTCATCACGGCAGAGG + Intronic
1185247011 22:49778213-49778235 CGGAAACTTCACCAGGCCGAAGG + Intronic
952012763 3:28919843-28919865 CCTGAAGTTCACCAGTGAGAAGG + Intergenic
953353542 3:42234293-42234315 CGTGAACTTCAACAGGGCAGGGG - Intergenic
953414507 3:42707993-42708015 CTCCAAGTTCACCATGGCGAGGG + Intronic
955956029 3:64291247-64291269 CTAGAAATTCACTAGGTCGATGG - Intronic
959348178 3:105225944-105225966 CTTGAACTTGACCCGGGAGGTGG + Intergenic
961782466 3:129328593-129328615 CTTGAAAATCATCAGGGTGATGG + Intergenic
963608296 3:147433315-147433337 CTTGAACTAAAACAGGGTGACGG + Intronic
967861733 3:194157208-194157230 TTTGAACTTCAGCAGGGAGTGGG - Intergenic
969675764 4:8613576-8613598 CTTGAACTTCAGAAGGGCGTGGG + Intronic
970372889 4:15425973-15425995 CTTGAAATTGACCATGGCGGGGG + Intronic
976245479 4:83002317-83002339 CTTGAACTCCACCTGGGCTTAGG - Intronic
978346244 4:107773179-107773201 CCTGAACTTGAGCAGGGCCAAGG - Intergenic
988383597 5:30532186-30532208 CTTGATTTTAACCAGGGCTAGGG - Intergenic
990962045 5:61404405-61404427 TGTGAACTTCAAGAGGGCGATGG - Intronic
996963174 5:129275978-129276000 CTTGGACCTCACCAGGCCTAGGG + Intergenic
999278326 5:150347226-150347248 CTTGAAATCCCCCAGGGAGAGGG - Intergenic
1001629387 5:173163477-173163499 CATGAGCGTCACCAGGGAGAAGG - Intronic
1003188194 6:3850567-3850589 CTTCATCATCGCCAGGGCGAGGG + Exonic
1004540684 6:16546986-16547008 CTAGAACTTCCCCAAGGGGAGGG - Intronic
1018077071 6:160226882-160226904 CTTGAACTCCAAAAGGGAGAGGG - Intronic
1024222110 7:47297191-47297213 CTTGTCCTTCAACATGGCGATGG + Exonic
1029968123 7:104761890-104761912 CTAGAACATCACCAGGAGGAAGG + Intronic
1030711738 7:112757825-112757847 TTTGAACTTCACTAGGGCCATGG - Intergenic
1030764875 7:113396202-113396224 ATTAAACTTAACCAGGGTGAAGG - Intergenic
1040463604 8:47673849-47673871 CTTGGAGTTCACCATGTCGAAGG + Exonic
1047409137 8:124609949-124609971 TTTGCACATCACCAGGGAGAGGG - Intronic
1056731434 9:89169602-89169624 CTTGACCCACACCAGGGCAAAGG + Intronic
1058124134 9:101172170-101172192 CTTCAACTTGACCTGGGCCATGG + Intronic
1059136847 9:111815310-111815332 CTGGTACTTGTCCAGGGCGATGG - Intergenic
1060190884 9:121591776-121591798 CTTGAACTACACCCAGGCCATGG - Intronic
1060282278 9:122222637-122222659 CTCCAAGTTCACCAGGGAGAGGG - Intronic
1187308770 X:18121143-18121165 CTTCACCTTCCCCAGGGCTAAGG + Intergenic
1189462484 X:41253602-41253624 CTTGAACTTCACTAGGGAGGCGG + Intergenic
1200066349 X:153505864-153505886 CTTGTTGTTCACCAGGACGAGGG - Exonic
1200339293 X:155381963-155381985 TTTGCACCTCACCAGGGCAAGGG + Intergenic
1200347177 X:155458730-155458752 TTTGCACCTCACCAGGGCAAGGG - Intergenic