ID: 924606987

View in Genome Browser
Species Human (GRCh38)
Location 1:245543536-245543558
Sequence CCACGTGGCCACTGGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 355}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924606987_924607000 17 Left 924606987 1:245543536-245543558 CCATCTGCCCAGTGGCCACGTGG 0: 1
1: 0
2: 0
3: 25
4: 355
Right 924607000 1:245543576-245543598 CTGATCTGCTCAGGCTTCTGGGG 0: 1
1: 0
2: 2
3: 26
4: 290
924606987_924607001 22 Left 924606987 1:245543536-245543558 CCATCTGCCCAGTGGCCACGTGG 0: 1
1: 0
2: 0
3: 25
4: 355
Right 924607001 1:245543581-245543603 CTGCTCAGGCTTCTGGGGCATGG 0: 1
1: 0
2: 3
3: 41
4: 509
924606987_924607002 23 Left 924606987 1:245543536-245543558 CCATCTGCCCAGTGGCCACGTGG 0: 1
1: 0
2: 0
3: 25
4: 355
Right 924607002 1:245543582-245543604 TGCTCAGGCTTCTGGGGCATGGG 0: 1
1: 0
2: 0
3: 17
4: 262
924606987_924606999 16 Left 924606987 1:245543536-245543558 CCATCTGCCCAGTGGCCACGTGG 0: 1
1: 0
2: 0
3: 25
4: 355
Right 924606999 1:245543575-245543597 CCTGATCTGCTCAGGCTTCTGGG 0: 1
1: 0
2: 0
3: 20
4: 212
924606987_924606993 8 Left 924606987 1:245543536-245543558 CCATCTGCCCAGTGGCCACGTGG 0: 1
1: 0
2: 0
3: 25
4: 355
Right 924606993 1:245543567-245543589 GCCACCCTCCTGATCTGCTCAGG 0: 1
1: 0
2: 2
3: 16
4: 170
924606987_924606997 15 Left 924606987 1:245543536-245543558 CCATCTGCCCAGTGGCCACGTGG 0: 1
1: 0
2: 0
3: 25
4: 355
Right 924606997 1:245543574-245543596 TCCTGATCTGCTCAGGCTTCTGG 0: 1
1: 0
2: 0
3: 17
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924606987 Original CRISPR CCACGTGGCCACTGGGCAGA TGG (reversed) Intronic
900231473 1:1560989-1561011 CCACATGGCAAGTAGGCAGATGG + Intronic
900339986 1:2183737-2183759 CCACGTGTCCACATGGCAGAAGG + Intronic
900584292 1:3424992-3425014 CCCCGTGTCCCCTGGGCAGGCGG - Intronic
900915205 1:5632677-5632699 CCGCCTGGCCACAGGGCAGCAGG - Intergenic
900957213 1:5893411-5893433 TCACGTGTCCACTGGACAGGGGG + Intronic
901332946 1:8424300-8424322 TCACCTGCCCACCGGGCAGAGGG + Intronic
901534537 1:9873631-9873653 CCAGGTGGCCACTGGGGAAGAGG - Intronic
901636269 1:10671651-10671673 CCAGGTGGGCACTTGGCAGGGGG + Intronic
902247298 1:15129312-15129334 CCTCCTGGCCCCTGGGCATATGG + Intergenic
902379559 1:16046270-16046292 TCACGAGCCCACTTGGCAGATGG + Intronic
902883814 1:19390665-19390687 CCAGGAGGCCACTGGAAAGACGG + Intronic
905202679 1:36324441-36324463 CCCCGTGGAGACAGGGCAGAAGG - Intronic
905709025 1:40085303-40085325 TCACGTGTCCACTGGACAGGGGG - Intronic
905835615 1:41117803-41117825 TCACGTGTCCACTGGACAGGGGG - Intronic
906253079 1:44326318-44326340 CCTCCTGGCCACAGGGAAGAGGG + Intronic
909455308 1:75843121-75843143 TCACGTGTCCACTGGACAGGTGG - Intronic
911073480 1:93850516-93850538 TCACGTGTCCACTGGACAGGGGG + Intergenic
911958046 1:104262892-104262914 TCACGTGTCCACTGGACAGGGGG + Intergenic
912546926 1:110457560-110457582 CCTCGTGGGCTCTGGGCAGGTGG + Intergenic
915146115 1:153796576-153796598 CAGTGTGGGCACTGGGCAGAGGG + Intergenic
915481934 1:156192863-156192885 TCACGTGTCCACTGGACAGGGGG - Intergenic
915603842 1:156938744-156938766 ACAGGTGGCCCTTGGGCAGATGG + Intronic
920292803 1:204935834-204935856 CATCATGGCCACTGGGCACAGGG + Intronic
923863504 1:237916012-237916034 TCACGTGTCCACTGGACAGGGGG - Intergenic
924606987 1:245543536-245543558 CCACGTGGCCACTGGGCAGATGG - Intronic
924941635 1:248816346-248816368 CCACGTGGGCTCTGGGCTTATGG - Intronic
1063219732 10:3956029-3956051 GCAGGTGGCCAGTTGGCAGATGG + Intergenic
1063666141 10:8061889-8061911 CTACTTGGGCACTGGGCAGAGGG - Intronic
1063787563 10:9402677-9402699 TCACGTGTCCACTGGACAGGGGG - Intergenic
1063814634 10:9758306-9758328 CCACTTGGCCAATGGGGAAATGG + Intergenic
1064005842 10:11698310-11698332 CCAGGTGCCAACTGAGCAGAGGG - Intergenic
1064018835 10:11793377-11793399 TCACGTGTCCACTGGACAGGGGG - Intergenic
1068117650 10:52752035-52752057 CCACATGGCCACAGGGCATGTGG - Intergenic
1068673305 10:59744576-59744598 CCGGGTGGCGGCTGGGCAGAGGG - Intergenic
1069420087 10:68239265-68239287 ACACATGGACACTGTGCAGATGG - Intergenic
1069751282 10:70746837-70746859 CCCGGTGGCAAGTGGGCAGAAGG + Intronic
1070152496 10:73813494-73813516 CCACAGGGGCACTTGGCAGAGGG + Exonic
1070159683 10:73858657-73858679 CCACCTGGCCTCTGAGCAGACGG + Intronic
1070415282 10:76183561-76183583 CAACGTCACCACTGGGGAGAGGG + Intronic
1070509754 10:77149863-77149885 CCACATGACCACTAAGCAGATGG - Intronic
1070873227 10:79776859-79776881 CCATGTGGGCAGTGGTCAGAGGG - Intergenic
1071640152 10:87299009-87299031 CCATGTGGGCAGTGGTCAGAGGG - Intergenic
1071655080 10:87438936-87438958 CCATGTGGGCAGTGGTCAGAGGG + Intergenic
1071974319 10:90939873-90939895 CCACGGGACCACTGGACACAGGG + Intergenic
1072863262 10:99029550-99029572 TCACGTGTCCACTGGACAGGGGG + Intronic
1075896257 10:125997732-125997754 CTGCGTGTCCACTGGGCACAGGG - Intronic
1076026445 10:127118722-127118744 GAACAGGGCCACTGGGCAGAGGG - Intronic
1076258104 10:129044846-129044868 CCAGGAGGCCAGTGGGCAGTCGG + Intergenic
1076896330 10:133314424-133314446 TCACGTGTCCACTGGACAGGGGG - Intronic
1077006741 11:361630-361652 TCACGTGTCCACTGGACAGGGGG + Intergenic
1077035275 11:491446-491468 CCAAGTGGGCACTGGGCATGAGG - Intergenic
1077520119 11:3028180-3028202 TCACGTGTCCACTGGACAGGGGG - Intronic
1077706623 11:4492987-4493009 TCACGTGTCCACTGGACAGGGGG + Intergenic
1078210209 11:9264733-9264755 AGACGTGGCCACTGCGCAGCGGG + Intronic
1083258961 11:61513017-61513039 CCACTTGGCCTCTGGGGAGTAGG + Intergenic
1083295427 11:61712752-61712774 CCTCTCGGCCACTGGGAAGAAGG + Intronic
1083349447 11:62017035-62017057 TCACGTGTCCACTGGACAGGGGG - Intergenic
1086834839 11:91607855-91607877 CAACATGGGCACTGGGCAAAAGG - Intergenic
1088746069 11:112806067-112806089 CCAAGCGGGCACTGGGGAGAAGG + Intergenic
1089190549 11:116650265-116650287 CCAGGTGGGCAGTGGGCAGGTGG - Intergenic
1089321897 11:117632031-117632053 CTATATGGCCACTGGGGAGAGGG - Intronic
1090752401 11:129759105-129759127 GCAAGGGGCCAGTGGGCAGACGG + Intergenic
1091239336 11:134042084-134042106 CCACGTTGCACCTAGGCAGACGG - Intergenic
1091316006 11:134614538-134614560 CCACCTTGCCACTGAGCAGCTGG - Intergenic
1091475680 12:769840-769862 CCACGTGCTCACATGGCAGAGGG + Intronic
1091764993 12:3113915-3113937 CCACGTGCTCACTGGGCAGTAGG + Intronic
1092208752 12:6632835-6632857 GAATGTGGCCCCTGGGCAGAAGG - Intronic
1092224955 12:6742260-6742282 TCACGTGTCCACTGGACAGGGGG - Intergenic
1092444194 12:8538426-8538448 TCACGTGTCCACTGGACAGGGGG - Intronic
1092449058 12:8585088-8585110 TCACGTGTCCACTGGACAGGGGG - Intergenic
1096413044 12:51391112-51391134 CCACGTTGCGCCTGAGCAGAAGG - Intronic
1096578649 12:52570338-52570360 GCATGTTGCCACAGGGCAGAGGG - Intronic
1097089984 12:56497315-56497337 TCACGTGTCCACTGGACAGGGGG - Intergenic
1097090523 12:56500955-56500977 TCACGTGTCCACTGGACAGGGGG + Intergenic
1097591673 12:61582429-61582451 TCACGTGTCCACTGGACAGGGGG + Intergenic
1098935338 12:76472617-76472639 TCACGTGTCCACTGGACAGGGGG + Intronic
1102306945 12:111812027-111812049 TCACGTGTCCACTGGACAGGGGG + Intergenic
1103357996 12:120336044-120336066 TCACGTGTCCACTGGACAGGGGG - Intergenic
1104878220 12:132051505-132051527 TCACATGGCCACTGGACAGGGGG + Intronic
1104934677 12:132358106-132358128 CCACGTGGCCACAGAGATGACGG + Intergenic
1105020185 12:132811047-132811069 TCACGTGCCCACTGGACAGGGGG - Intronic
1105287150 13:19013764-19013786 TCACGTGTCCACTGGACAGGGGG - Intergenic
1105422303 13:20264009-20264031 CCAGGGGACCACTGGGCAGAGGG - Intergenic
1107828627 13:44353702-44353724 CCCCGTGCCCACTAGCCAGAAGG - Intergenic
1109281877 13:60366154-60366176 CCACATGGGCACTGTGCTGACGG + Intergenic
1110484011 13:76016902-76016924 TCAGGTGGCCACTGTGCTGATGG - Intergenic
1113671966 13:112181673-112181695 CCACGGGGCCACTTGGAAGTCGG - Intergenic
1113856745 13:113450613-113450635 TCACGTGTCCACTGGACAGGGGG + Intronic
1115176063 14:30562887-30562909 TCACGTGTCCACTGGACAGGGGG - Intronic
1115440720 14:33432141-33432163 CCACCCCTCCACTGGGCAGAAGG + Intronic
1117632555 14:57708854-57708876 TCACGTGTCCACTGGACAGGGGG + Intronic
1117705581 14:58463921-58463943 CAACCTGGGCACTGGGGAGATGG + Intronic
1118496621 14:66313925-66313947 ACACATGGCCACTGGGAACATGG + Intergenic
1118747399 14:68784357-68784379 CCACTTGCCTGCTGGGCAGAAGG - Intergenic
1119647209 14:76356559-76356581 CCACATGGCCATGGGCCAGAAGG - Intronic
1119835826 14:77747878-77747900 CGGGGTGGCCTCTGGGCAGAGGG - Intronic
1119850123 14:77861118-77861140 CCACATGGCCACTGTGCTCAGGG - Intronic
1121050155 14:90815190-90815212 CACCGTGGCCAGAGGGCAGAGGG - Intronic
1121408426 14:93733274-93733296 CCACCTGTGCACTGGGTAGACGG - Intronic
1121439846 14:93941706-93941728 CCCCGGGGCCGCTGGACAGATGG + Intronic
1121508271 14:94492936-94492958 CCACCTGGCCTCTGTGCAGGAGG - Intronic
1121536629 14:94695494-94695516 CGAGGTGGGCACTGGGCAGTGGG - Intergenic
1122294821 14:100699455-100699477 CCTGGTGGCCAGTGGGAAGAGGG + Intergenic
1122421869 14:101582912-101582934 CCAGGTGGTGACTGGGCACATGG - Intergenic
1122588345 14:102826762-102826784 CCACGCGGCCTCTGCTCAGATGG - Intronic
1122918498 14:104869724-104869746 CTGCGTCCCCACTGGGCAGAAGG - Intronic
1122972592 14:105158463-105158485 CCAGGTGGCCCGGGGGCAGAGGG - Intronic
1123014421 14:105367031-105367053 AAACGTGGCCACTGGGGAGAGGG - Intronic
1124627109 15:31314467-31314489 CCACGTGGACAGTGGCCAGGTGG + Intergenic
1125477873 15:40059823-40059845 CGAGGTGTCCACTAGGCAGACGG + Intergenic
1125760295 15:42091883-42091905 TCACGTGTCCACTGGACAGGGGG - Intronic
1125885196 15:43224170-43224192 CCGCGTGGACACAGGGAAGAGGG - Intergenic
1126212974 15:46120593-46120615 CCAGGTGGCCACAGGGCTTATGG + Intergenic
1127877552 15:63123677-63123699 TCACGTGTCCACTGGACAGGGGG + Intronic
1128329235 15:66745039-66745061 CCAGGTGACCTCTGGCCAGAGGG + Intronic
1128843658 15:70871480-70871502 CCAGGTGGCGGCCGGGCAGAGGG + Intronic
1129814234 15:78538039-78538061 CCACCTGGACCCTGGGCTGATGG + Intergenic
1129921099 15:79319744-79319766 TCACGTGTCCACTGGACAGGGGG + Intronic
1129923288 15:79339205-79339227 TCACGTGTCCACTGGACAGGGGG - Intronic
1132004572 15:98215058-98215080 CCACTTGGCCTCTGTGGAGATGG + Intergenic
1132764040 16:1525475-1525497 ACACGTGGCCAGGGGGCAGTGGG + Intronic
1132967921 16:2669773-2669795 TCACGTGTCCACTGGACAGGGGG + Intergenic
1135757722 16:25111880-25111902 GCCCATGGCCACTAGGCAGAGGG + Exonic
1136191204 16:28615791-28615813 TCACGTGTCCACTGGACAGGGGG + Intronic
1136390592 16:29961982-29962004 CCGCGTGGCCACTGCGCATGCGG + Intronic
1138537278 16:57666774-57666796 CCACCTGGGAAGTGGGCAGAGGG - Intergenic
1139121533 16:64024340-64024362 CCAAGTACCCACTGGGCATAGGG - Intergenic
1139374963 16:66491180-66491202 CCAGGTGGCTCCTGGGCAGGAGG + Intronic
1140481320 16:75264385-75264407 TCCTGTGGGCACTGGGCAGAGGG - Exonic
1141884641 16:86883071-86883093 CCACGTGGCAGCTGGGGAGTTGG + Intergenic
1141984856 16:87573125-87573147 CCACTTGGCCACTGGGGATGTGG - Intergenic
1142031313 16:87839880-87839902 CCACCTGGCTCCTGGGCACAGGG - Intronic
1142198809 16:88751301-88751323 CCACGGTGCCAATGGGGAGATGG - Intronic
1142364159 16:89640981-89641003 TCACGTGTCCACTGGACAGGGGG + Intergenic
1142415353 16:89938118-89938140 TCACGTGTCCACTGGACAGGGGG + Intergenic
1142587453 17:982512-982534 TCACGTGTCCACTGGACAGGGGG - Intergenic
1142904566 17:3033471-3033493 GCACGTGGCCATGGGGCAGCAGG - Exonic
1142974848 17:3637062-3637084 CCAGGCGGCAACTGAGCAGAAGG - Intronic
1142975353 17:3640395-3640417 CCATGTGGCCACTGGGGTGGTGG + Intronic
1143464498 17:7127002-7127024 TCACGTGTCCACTGGACAGGGGG - Intergenic
1143575481 17:7790156-7790178 TCACGTGCCCTCTGGGCAGGGGG + Intronic
1144759051 17:17697020-17697042 CCAAGGGGCAGCTGGGCAGAGGG - Intronic
1145732037 17:27198160-27198182 TCACGTGTCCACTGGACAGGGGG - Intergenic
1147384197 17:40072046-40072068 GCACGTGCCCACTGGGGGGAGGG - Intronic
1147820078 17:43236270-43236292 TCACGTGTCCACTGGACAGGGGG - Intergenic
1147823883 17:43258198-43258220 TCACGTGTCCACTGGACAGGGGG - Intergenic
1147824641 17:43262637-43262659 TCACGTGTCCACTGGACAGGGGG - Intergenic
1147825798 17:43269121-43269143 TCACGTGTCCACTGGACAGGGGG - Intergenic
1147826970 17:43275903-43275925 TCACGTGTCCACTGGACAGGGGG - Intergenic
1147827818 17:43280463-43280485 TCACGTGTCCACTGGACAGGGGG - Intergenic
1147828926 17:43286623-43286645 TCACGTGTCCACTGGACAGGGGG - Intergenic
1147830021 17:43292766-43292788 TCACGTGTCCACTGGACAGGGGG - Intergenic
1147834951 17:43323373-43323395 TCACGTGTCCACTGGACAGGGGG + Intergenic
1148685913 17:49501210-49501232 CCATGTGGCCACTGGGAACAGGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1151959834 17:77399874-77399896 TCACGTGGCCGCAGGGCAGCAGG - Intronic
1152303557 17:79508789-79508811 CCATGTGTCCCCAGGGCAGAGGG + Intronic
1152682516 17:81676488-81676510 TCACGTGTCCACTGGACAGGGGG - Intergenic
1152755750 17:82086328-82086350 CCAGGAGGCCGCTGAGCAGAGGG + Exonic
1152970616 18:158302-158324 CCACGTGGCCAGTGCGCGCAGGG + Intergenic
1157520527 18:48342279-48342301 CCACTTGGGCTCTGGGCAGGGGG - Intronic
1160036463 18:75305832-75305854 GCACGTGGGCAGTGGTCAGAGGG - Intergenic
1160212727 18:76895981-76896003 CCACGTGGGCACTGGCCACAGGG + Intronic
1160856869 19:1221684-1221706 TCCCAAGGCCACTGGGCAGATGG - Intronic
1160929712 19:1564681-1564703 GCACGTAGCTACTGGGGAGAGGG + Intronic
1161047310 19:2142622-2142644 CCACGTGGCCGCCTGGCTGAGGG + Intronic
1161834053 19:6632976-6632998 TCACGTGTCCACTGGACAGGGGG + Intergenic
1161894046 19:7066903-7066925 TCACGTGTCCACTGGACAGGGGG + Intergenic
1162046203 19:8002071-8002093 TCAGGTGTCCACTGGGCAGAGGG - Intronic
1162224198 19:9206102-9206124 TCACGTGTCCACTGGACAGGGGG - Intergenic
1162290494 19:9776500-9776522 TCACGTGTCCACTGGACAGGGGG - Intronic
1162729986 19:12712644-12712666 TCACGTGTCCACTGGACAGGGGG - Intronic
1162809553 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG + Intergenic
1162925841 19:13930171-13930193 CCGGGTGGGCACTGGGCAGCGGG + Intronic
1163075631 19:14888626-14888648 TCACGTGTCCACCGGACAGAGGG + Intergenic
1163181551 19:15607862-15607884 CCACGAGCCCACTGGGAGGAAGG - Intergenic
1163303722 19:16463973-16463995 CCAGGGGGCCACAGAGCAGAGGG + Intronic
1163456258 19:17407489-17407511 TCACGTGTCCACTGGACAGGGGG + Intronic
1163843623 19:19626843-19626865 CCACGCGGCCACGGGGCAGGCGG + Exonic
1163881797 19:19930153-19930175 TCACGTGTCCACTGGACAGGGGG + Intronic
1163992148 19:21008648-21008670 TCACGTGTCCACTGGACAGGGGG - Intergenic
1164675398 19:30097192-30097214 CCAGCAGGCCAGTGGGCAGATGG - Intergenic
1164955165 19:32376856-32376878 TCACGTGTCCACTGGACAGGGGG + Intronic
1165541173 19:36492865-36492887 TCACGTGTCCACTGGACAGGGGG + Intergenic
1165671199 19:37680779-37680801 TCACGTGTCCACTGGACAGGGGG + Intronic
1166483276 19:43191449-43191471 TCACGTGTCCACTGGACAGGGGG + Intronic
1167042812 19:47032575-47032597 CCACTTGGCGGCTGGACAGAGGG + Intronic
1167471263 19:49677580-49677602 CCACGTGGCCGCTGCGCGGTGGG + Intronic
1167519070 19:49941621-49941643 TCACGTGTCCACTGGACAGGGGG - Intronic
1167719572 19:51169061-51169083 TCACGTGTCCACTGGACAGGGGG + Intergenic
1167970268 19:53184873-53184895 TCACGTGTCCACTGGACAGAGGG + Intronic
1167979139 19:53258326-53258348 TCACGTGTCCACTGGACAGGGGG - Exonic
1167990956 19:53360262-53360284 TCACGTGTCCACTGGACAGGGGG + Intergenic
1168107556 19:54173852-54173874 GGAGGTGGCCTCTGGGCAGAGGG + Exonic
1168131469 19:54322630-54322652 TCACGTGTCCACTGGACAGGGGG + Intergenic
1168215084 19:54919387-54919409 TCACGTGTCCACTGGACAGGGGG + Intergenic
1168480891 19:56718773-56718795 TCACGTGTCCACTGGACAGGGGG + Intergenic
926824207 2:16886145-16886167 CCTAGTGGCCACTAGGCAAATGG + Intergenic
927091160 2:19713741-19713763 CCACGTGCCCTCTGAGAAGAGGG + Intergenic
927484096 2:23477198-23477220 CCAGGAGGCCACCGGTCAGAAGG - Intronic
927520270 2:23694141-23694163 CCAGAAGGCCACTGAGCAGAGGG - Intronic
928033543 2:27801082-27801104 CTAGCCGGCCACTGGGCAGAGGG + Intronic
928365532 2:30697824-30697846 TCACGTGTCCACTGGACAGGGGG - Intergenic
928595691 2:32856969-32856991 ATAGGTGGGCACTGGGCAGAGGG - Intergenic
929233858 2:39586303-39586325 CCACGAGCCCACTGGGAGGAAGG + Intergenic
929689344 2:44061591-44061613 CAGGGTGGCCTCTGGGCAGAGGG + Intergenic
930115747 2:47716937-47716959 TCACGTGTCCACTGGACAGGGGG - Intronic
930813670 2:55569618-55569640 TCACGTGTCCACTGGACAGGGGG - Intronic
932673013 2:73754491-73754513 TCACGTGTCCACTGGACAGGGGG - Intergenic
933971959 2:87477086-87477108 CCATGTGCTCACTGGGCAGCTGG - Intergenic
934751496 2:96797019-96797041 CCACCTGGCCATCGTGCAGAAGG + Exonic
934755969 2:96825065-96825087 CCACCTGGCCATCGTGCAGAAGG + Exonic
935881883 2:107573477-107573499 TCACGTGTCCACTGGACAGGGGG - Intergenic
936321767 2:111473111-111473133 CCATGTGCTCACTGGGCAGCTGG + Intergenic
937232214 2:120404837-120404859 CCATGTGGACACTGGACAGGGGG - Intergenic
938308047 2:130267896-130267918 CCACGTGGGCAAAGGGCAGGGGG + Intergenic
938422457 2:131155641-131155663 CCACGTGGACACTGCGCAGCTGG + Intronic
940357144 2:152755612-152755634 TCACGTGTCCACTGGACAGGGGG - Intronic
941928240 2:170916695-170916717 TCACGTGTCCACTGGACAGGGGG - Intergenic
943084461 2:183295617-183295639 TCACGTGTCCACTGGACAGGGGG - Intergenic
945779568 2:214152777-214152799 TCACGTGTCCACTGGACAGGGGG + Intronic
945807285 2:214505156-214505178 CCAGATGGCCACTGTGCATATGG - Intronic
947606570 2:231489795-231489817 TCACGTGTCCACTGGACAGGGGG + Intergenic
948462638 2:238137764-238137786 CCACATGGCCGATGGGTAGAGGG + Intergenic
948660150 2:239501923-239501945 CTTTGTGGCCACTGGGCCGATGG + Intergenic
948893395 2:240917528-240917550 CCACGTGGACCCTGGTCAGGAGG + Intergenic
948967070 2:241390980-241391002 CCACCTGGCCACAGGGCTGTGGG + Intronic
949046708 2:241875540-241875562 TCACGTGTCCACTGGACAGGGGG + Intergenic
1169295497 20:4393876-4393898 TCACGTGTCCACTGGACAGGGGG + Intergenic
1171248501 20:23632122-23632144 CCATGGGGCCACCGGGCGGAGGG + Intronic
1171360626 20:24584150-24584172 CCACCAGGCCACAGAGCAGAAGG + Intronic
1172012580 20:31854468-31854490 TGACGTGGGCACAGGGCAGAGGG + Intronic
1172358938 20:34298927-34298949 TCACGTGTCCACTGGACAGGGGG - Intronic
1173163552 20:40670435-40670457 CCTAGTGGCCAATGGGAAGAGGG - Intergenic
1175108507 20:56630383-56630405 CCCCGAGACCCCTGGGCAGATGG + Intronic
1175623337 20:60469234-60469256 CCACGTGGCCTCTGTGTATATGG - Intergenic
1176007466 20:62874269-62874291 TCACGTGTCCACTGGACAGGGGG - Intergenic
1176154985 20:63614825-63614847 TCACGTGCCCACTGGCCAGGGGG - Intronic
1176420293 21:6508635-6508657 TCACGTGTCCACTGGACAGGGGG + Intergenic
1179448038 21:41447252-41447274 CCACAAGGACACTAGGCAGATGG + Intronic
1179537046 21:42059477-42059499 CCATGGGACCACTGGCCAGATGG - Intergenic
1180141145 21:45893917-45893939 CCCCATGGACACTGGGCAGATGG + Intronic
1180201007 21:46224228-46224250 TCACGTGTCCACTGGACAGGGGG - Intronic
1180201239 21:46225758-46225780 TCACGTGTCCACTGGACAGTGGG - Intronic
1180830769 22:18904902-18904924 TCACGTGTCCACTGGACAGGGGG + Intergenic
1181837863 22:25625863-25625885 TCACGTGTCCACTGGACAGGGGG - Intronic
1182415880 22:30221220-30221242 GGACGTGGCCCCTGGGCAGCAGG - Intergenic
1182847933 22:33446800-33446822 TCACGTTGCCTCTGTGCAGATGG - Intronic
1183508925 22:38223800-38223822 GCCTCTGGCCACTGGGCAGAAGG - Intronic
1184467414 22:44677013-44677035 TCACATGGCCAAAGGGCAGAGGG - Intronic
1184769558 22:46589417-46589439 TCACGTGGCCCGAGGGCAGATGG + Intronic
1185355630 22:50367981-50368003 TCACGTGTCCACTGGACAGGGGG + Intronic
1203280858 22_KI270734v1_random:130173-130195 TCACGTGTCCACTGGACAGGGGG + Intergenic
950172900 3:10851781-10851803 GCCCTTGGCCACTGGGCAGGGGG + Intronic
950415774 3:12868459-12868481 CCACGTGTCCACTGGACAGGGGG - Intronic
950718009 3:14863240-14863262 CCACGTTGCCAATGGCAAGAGGG + Intronic
950727018 3:14923195-14923217 CCACCAGGCCACTTGGAAGAAGG - Intronic
951520730 3:23608951-23608973 CCAGGTTGCCACAGGGCAGGCGG - Intergenic
952892679 3:38053661-38053683 CGGGGTGGCCGCTGGGCAGAGGG - Intronic
953059797 3:39417962-39417984 TCACGTGTCCACTGGACAGGGGG - Intergenic
953294183 3:41696410-41696432 TCACGTGTCCACTGGACAGGGGG - Intronic
953905740 3:46867518-46867540 CCACGTGGAGGGTGGGCAGAAGG + Intronic
956430454 3:69181019-69181041 CCAGCGGGCCTCTGGGCAGAAGG - Exonic
957040415 3:75331779-75331801 GCACGAGGGCACTGGGGAGAAGG - Intergenic
958657263 3:97018501-97018523 TCACGTGTCCACTGGCCATAGGG + Intronic
959163013 3:102741884-102741906 CCAAGTAGGCACTGGGCAGCAGG + Intergenic
960593373 3:119386788-119386810 TCACGTGTCCACTGGACAGGGGG + Intronic
961554049 3:127685526-127685548 GCACCTGGCCTCTGTGCAGAAGG - Intergenic
961822280 3:129581129-129581151 CCACGTGGCCCCTCGGGAGCCGG - Intronic
962342939 3:134600612-134600634 CCCCCAGGCCACAGGGCAGAAGG - Intronic
964101432 3:152992638-152992660 TCACGTGTCCACTGGACAGGGGG - Intergenic
964480814 3:157136740-157136762 CCACATGGCCACTGAGTAGGAGG + Intergenic
964642000 3:158918348-158918370 ACACTTAGCCACAGGGCAGAGGG - Intergenic
965644007 3:170860813-170860835 TCACGTGTCCACTGGACAGGGGG - Intergenic
967555362 3:190850463-190850485 CCACCTGTGCACTGGGAAGATGG + Intergenic
968050879 3:195654239-195654261 TCACGTGTCCACTGGACAGGGGG - Intergenic
968104945 3:195994099-195994121 TCACGTGTCCACTGGACAGGGGG + Intergenic
968303240 3:197631686-197631708 TCACGTGTCCACTGGACAGGGGG + Intergenic
968397814 4:259848-259870 TCACGTGTCCACTGGACAGGGGG - Intergenic
968404702 4:329824-329846 TCACGTGTCCACTGGACAGGGGG + Intergenic
968744553 4:2352959-2352981 GCACCTGTCCCCTGGGCAGAAGG + Intronic
968830353 4:2930423-2930445 CCAGGCTGCCACTGTGCAGAGGG + Intergenic
969045693 4:4334985-4335007 TCACGTGTCCACTGGACAGGGGG + Intergenic
972321217 4:37975191-37975213 TCACGTGTCCACTGGACAGGGGG + Intronic
973245249 4:48004194-48004216 TCACGTGTCCACTGGACAGGGGG - Intronic
974493417 4:62595866-62595888 TCACGTGTCCACTGGACAGGGGG - Intergenic
975377789 4:73665705-73665727 TCACGTGTCCACTGGACAGGGGG + Intergenic
975378426 4:73671114-73671136 TCACGTGTCCACTGGACAGGGGG + Intergenic
975387441 4:73773816-73773838 TCACGTGTCCACTGGACAGGGGG + Intergenic
978308082 4:107354070-107354092 TCACGTGTCCACTGGACAGTGGG + Intergenic
981239063 4:142452628-142452650 CCGTGTGGCCACTGGTCAGCTGG - Intronic
982763375 4:159315671-159315693 TCACGTGTCCACTGGACAGGGGG + Intronic
983011322 4:162550973-162550995 TCACGTGTCCACTGGACAGGGGG - Intergenic
983646173 4:169993671-169993693 CCCCCTGGCCAGTGGGCAGGAGG - Intronic
984316654 4:178138720-178138742 CCACTTGGCTGGTGGGCAGATGG + Intergenic
985610700 5:886406-886428 GCACGTGGCCGGTGGGCAGGAGG + Intronic
986353460 5:6902298-6902320 CCAGGTGGCCACTGTTCACAGGG - Intergenic
990626924 5:57624006-57624028 CCATGAGGACACTGAGCAGAAGG + Intergenic
994407451 5:99363090-99363112 CCACGAGGCCTCTGAGCAGAGGG + Intergenic
994516186 5:100775380-100775402 TCACGTGTCCACTGGACAGGGGG - Intergenic
995206289 5:109485166-109485188 CCACGAGGCCACTGAGCAAGCGG + Intergenic
995474748 5:112536486-112536508 GCACCTGGCCACTGTGCACAGGG - Intergenic
1000302986 5:159972429-159972451 CGACGTGGCCAACGGGCAGCCGG + Exonic
1002255975 5:177958832-177958854 GGACGGGGCCACTGGGCAGCCGG + Intergenic
1003324966 6:5084668-5084690 CCGCGCCGCCACTGGGCAGATGG + Exonic
1005709765 6:28491783-28491805 TCACGTGTCCACTGGACAGGGGG - Intergenic
1006141513 6:31932319-31932341 CCAGGTGGCTGCTGGGCGGAGGG + Intronic
1006652098 6:35559962-35559984 TCACGTGTCCACTGGACAGGGGG + Intergenic
1009194926 6:60672527-60672549 CCAAGTGTTCACTGGGCAGTTGG + Intergenic
1009549753 6:65073974-65073996 GTACGTTGCCACTGGGCACATGG + Intronic
1010778615 6:79916853-79916875 CCATGTGACCATTGGGCACACGG - Exonic
1011458589 6:87579301-87579323 CAACGTGGGCTCTGGGCAGAAGG + Intronic
1013830982 6:114272650-114272672 CCACGTGGATCCTGGGCTGAAGG - Intronic
1016241603 6:141938032-141938054 CCACGTGCCAAATGGGGAGAGGG + Intergenic
1017526419 6:155245115-155245137 CCACATGACCACGGGGAAGAAGG - Intronic
1018768274 6:166951124-166951146 TCACGTGTCCACTGGACAGAGGG + Intronic
1019109372 6:169697730-169697752 TCACGTGTCCACTGGACAGGGGG - Intronic
1019158059 6:170052055-170052077 CCACGCGGCTTCTGGGCAGCAGG - Intergenic
1019283478 7:211825-211847 CCACGTGCCCTGTGGGAAGACGG - Intronic
1019501719 7:1368214-1368236 ACCCGTGGCCACTTGACAGATGG - Intergenic
1023074332 7:36468060-36468082 TCACGTGTCCACTGGACAGGGGG - Intergenic
1024297585 7:47857793-47857815 CCATGTTAGCACTGGGCAGATGG - Exonic
1029169535 7:98620880-98620902 CAACTTGGCCACTGTGCAGAGGG - Intronic
1029562135 7:101309470-101309492 TCACGTGTCCACTGGACAGGGGG + Intergenic
1032278709 7:130483616-130483638 GAAGGGGGCCACTGGGCAGAAGG - Intergenic
1033090222 7:138378878-138378900 AGACGTGGCGGCTGGGCAGAGGG + Intergenic
1034834132 7:154336423-154336445 TGCCGTGGCCACTGGGCAGGCGG + Intronic
1036184925 8:6614507-6614529 CCACATGGGCACTGGACAAAGGG - Intronic
1037057265 8:14457744-14457766 TCACGTGTCCACTGGACAGGGGG - Intronic
1038664157 8:29522939-29522961 CCACGCGGCCACTGCACAAATGG + Intergenic
1038980959 8:32759143-32759165 CCACCTGGCCATTGGGGAAATGG + Intronic
1043851211 8:85218994-85219016 CCAGATAGCCACTGTGCAGATGG - Intronic
1047292328 8:123541292-123541314 CCACGTGGCCTCCGGGCCGGGGG - Intergenic
1048241012 8:132741556-132741578 TCACGTGTCCACTGGACAGGGGG + Intronic
1048352365 8:133626492-133626514 CCACGTGGCCAGAGGGGAGTAGG + Intergenic
1048522423 8:135169163-135169185 CCAAGTGGCCACTCGGCAGCTGG - Intergenic
1049220904 8:141428375-141428397 CCCCCTGGGCAGTGGGCAGATGG - Intronic
1049447613 8:142638623-142638645 CCACATGGCCACTGGGGTCATGG - Intergenic
1049458718 8:142710020-142710042 TCACGTGTCCACTGGACAGGGGG + Intergenic
1049592281 8:143468133-143468155 CCACCTGGCCTCCGGGCAGATGG - Intronic
1049733514 8:144191460-144191482 GCACTGGGCCTCTGGGCAGAAGG - Intronic
1049776818 8:144409747-144409769 GCGCGGGGACACTGGGCAGAGGG - Intronic
1049975550 9:858199-858221 TCATGTGGCCAGTGGGAAGAGGG + Intronic
1050149821 9:2608277-2608299 ACAAGTGGGCACTGGGGAGATGG - Intergenic
1053168426 9:35861035-35861057 CCAGGTGGCCCCTGGTCTGAAGG + Intergenic
1053188023 9:36035913-36035935 CCACGTAGCTGCTGGGCTGATGG + Intergenic
1055476280 9:76666572-76666594 TCACGTGTCCACTGGACAGGGGG - Intronic
1056576601 9:87859677-87859699 CCAGGTGTCCACTGGGCACCTGG + Intergenic
1057179527 9:93022263-93022285 CCACGCAGCCACTGTGCAGCGGG - Intronic
1057554497 9:96076876-96076898 TCACGTGTCCACTGGACAGGGGG - Intergenic
1058172069 9:101693686-101693708 CCATGTGCACACTGGGCAGCAGG - Intronic
1058944897 9:109847003-109847025 CAATGTGGCCAGTGGGGAGATGG + Intronic
1060474819 9:123978803-123978825 CCACTTGTCCAATTGGCAGATGG + Intergenic
1060476543 9:123991320-123991342 CCACTTGTCCAATTGGCAGATGG - Intergenic
1060822912 9:126671827-126671849 CCAAGTGGCCTCTGGGCCGCTGG - Intronic
1060995623 9:127873683-127873705 CCACAGCCCCACTGGGCAGAGGG + Intronic
1061039175 9:128129713-128129735 TCACGTGTCCACTGGACAGGGGG + Intergenic
1061048800 9:128182086-128182108 TCACGTGTCCACTGGACAGGGGG - Intronic
1061369622 9:130191159-130191181 CCACGTGGCGACTGGATAGTTGG + Intronic
1061379354 9:130244772-130244794 CCCAGTGGCCACAGGGCAGCAGG + Intergenic
1061422569 9:130480204-130480226 CCAGGTGCCCACTGGACAGGTGG - Intronic
1061785559 9:133025892-133025914 TCACGTGTCCACTGGACAGGGGG - Intergenic
1061856373 9:133443886-133443908 CCACGTGGGCACGGGGGAGATGG - Intronic
1061861054 9:133469027-133469049 CCACCTGGGCACTGAGCAGAGGG + Exonic
1061901990 9:133677744-133677766 GCGCCTGGCCACTGGGAAGACGG - Intronic
1062467608 9:136687936-136687958 CCAGGTGGCCACTGGTCACTCGG - Intergenic
1062639393 9:137510500-137510522 TCACGTGTCCACTGGACAGGGGG - Intronic
1062648003 9:137559718-137559740 TCACGTGTCCACTGGACAGGGGG - Intronic
1185619715 X:1446221-1446243 TCACGTGTCCACTGGACAGGGGG - Intronic
1186226785 X:7407472-7407494 CCACTTGGTGACTGGGCATATGG - Intergenic
1192502658 X:71664008-71664030 CCACCTCGCCACTGGGCTGCAGG - Intergenic
1192509860 X:71715376-71715398 CCACCTCGCCACTGGGCTGCAGG - Intronic
1192516837 X:71766177-71766199 CCACCTCGCCACTGGGCTGCAGG + Intronic
1193494218 X:82190551-82190573 CGATGTGGAAACTGGGCAGAGGG - Intergenic
1194079344 X:89439316-89439338 CCCCCTGGGCACTGGGCATATGG - Intergenic
1195306152 X:103585793-103585815 GCACGTAGGCAGTGGGCAGAGGG + Intronic
1197242744 X:124137172-124137194 TCACGTGTCCACTGGACAGGGGG - Intronic
1198287560 X:135207053-135207075 TCACGTGTCCACTGGACAGGGGG - Intergenic
1198344682 X:135747824-135747846 TCACGTGTCCACTGGACAGGGGG + Intergenic
1198998639 X:142606441-142606463 TCACGTGTCCACTGGACAGGGGG + Intergenic
1200431964 Y:3094621-3094643 CCCCCTGGGCACTGGGCATATGG - Intergenic