ID: 924611110

View in Genome Browser
Species Human (GRCh38)
Location 1:245574574-245574596
Sequence CCTGAACTCCAGAACCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924611110_924611115 15 Left 924611110 1:245574574-245574596 CCTGGAAGGTTCTGGAGTTCAGG 0: 1
1: 1
2: 1
3: 17
4: 205
Right 924611115 1:245574612-245574634 CCTTCTGCCCCTCAAGTCCATGG 0: 1
1: 0
2: 2
3: 22
4: 252
924611110_924611116 19 Left 924611110 1:245574574-245574596 CCTGGAAGGTTCTGGAGTTCAGG 0: 1
1: 1
2: 1
3: 17
4: 205
Right 924611116 1:245574616-245574638 CTGCCCCTCAAGTCCATGGCAGG 0: 1
1: 0
2: 1
3: 22
4: 180
924611110_924611117 20 Left 924611110 1:245574574-245574596 CCTGGAAGGTTCTGGAGTTCAGG 0: 1
1: 1
2: 1
3: 17
4: 205
Right 924611117 1:245574617-245574639 TGCCCCTCAAGTCCATGGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924611110 Original CRISPR CCTGAACTCCAGAACCTTCC AGG (reversed) Intronic
900129212 1:1080517-1080539 CCTGGCCTCCAGACCCTGCCTGG + Intergenic
901044756 1:6389221-6389243 CCTGATCTCAGGAAACTTCCTGG + Intronic
901052237 1:6431009-6431031 CCTGGGCTCCAGGACCCTCCTGG - Intronic
901225336 1:7609967-7609989 CCTGAAATACAGCACCTGCCGGG + Intronic
902187672 1:14737576-14737598 TCTGAACTCCAGAAGCTGCGAGG - Intronic
902625042 1:17671573-17671595 CCTGAGTTCCAGCACTTTCCAGG - Intronic
902957538 1:19935822-19935844 CCTGCCCTCCAGATGCTTCCAGG - Intergenic
903282915 1:22260226-22260248 CCTGCAATCCACAAGCTTCCAGG - Intergenic
904320086 1:29690903-29690925 CCTCAGCTCCAGGACCTCCCTGG - Intergenic
908882203 1:68744816-68744838 CATGAACACCAGAATCTTCTAGG - Intergenic
910376111 1:86573111-86573133 CATGAACTCAAGAACCTGGCTGG + Intronic
913247822 1:116885691-116885713 CCTGCCCTCCAGGAGCTTCCAGG - Intergenic
913403388 1:118461622-118461644 CCTGAACTCTGAACCCTTCCAGG - Intergenic
914772852 1:150706090-150706112 CCTGACTTCCAGGAACTTCCAGG + Intronic
915086182 1:153390557-153390579 CCTGAAAAACAGAACCTTCTGGG + Exonic
915463828 1:156084419-156084441 CCCCAACTCCAGGACCCTCCCGG - Intronic
915638456 1:157203035-157203057 CTTGAGCTCCACAACCTACCAGG - Intergenic
915732366 1:158062897-158062919 TCTGCACTCCAGAAACTTCTGGG - Intronic
918362611 1:183774223-183774245 CCTGAACTACAGAACCAAGCAGG + Intronic
918794255 1:188872768-188872790 CATCAAATCAAGAACCTTCCCGG - Intergenic
919827389 1:201512977-201512999 CCTGCCCTCCAAGACCTTCCAGG - Intergenic
920839331 1:209540843-209540865 CCTGCAATCCAAAACCTGCCAGG - Intergenic
922690203 1:227683031-227683053 CCTGAAGTCCAGCACCCTGCAGG + Intergenic
923202481 1:231725682-231725704 GTTGAAGTCAAGAACCTTCCTGG + Intronic
924094588 1:240538182-240538204 CCTGAACTCCTGAACGTTTTAGG - Intronic
924611110 1:245574574-245574596 CCTGAACTCCAGAACCTTCCAGG - Intronic
924660768 1:246014772-246014794 CCTGAACTGAAGAAGCCTCCAGG + Intronic
1063030033 10:2225439-2225461 CCGGGACTGCAGCACCTTCCTGG - Intergenic
1064552158 10:16513946-16513968 CCTCAAATCCAGAAAATTCCAGG + Exonic
1066021841 10:31311679-31311701 CCTGACCTCAAGAAGCTTACAGG - Intergenic
1067412659 10:46078553-46078575 CTTCAACTCCAGAATGTTCCTGG - Intergenic
1067705165 10:48601256-48601278 CCTGAAGGGCAGAATCTTCCAGG + Intronic
1069836723 10:71313894-71313916 CCGGAAGTCCAGAACGTTCCTGG + Intergenic
1070656586 10:78275794-78275816 CCTGAACTCCAGACCCACCTGGG - Intergenic
1071010782 10:80937976-80937998 CCCTAGCTCCAGAACTTTCCGGG + Intergenic
1071038537 10:81277919-81277941 CCTTGACTACAAAACCTTCCAGG - Intergenic
1071477746 10:86039245-86039267 CATGAACTCCAGAACTTCCAAGG - Intronic
1072738271 10:97894250-97894272 TCTGATCTCCAGAAGCTACCTGG + Intronic
1078443983 11:11390454-11390476 CCTGAGCTCCATCTCCTTCCAGG + Intronic
1078539064 11:12198927-12198949 CCTGAACCCCAGCTCCTTTCAGG + Intronic
1079201272 11:18379365-18379387 CCTGGGCTCCAGCACATTCCTGG + Intergenic
1080265456 11:30396060-30396082 TCTGAAATCCAGAGCCTTGCTGG - Intronic
1081659850 11:44881362-44881384 CCTGAACACCAGTTCCCTCCAGG + Intronic
1081794383 11:45809567-45809589 CCTGAAGTCCAGATCGGTCCAGG - Intronic
1082086464 11:48054334-48054356 CCTGAAGGGCAGAAACTTCCTGG - Intronic
1082781321 11:57289575-57289597 CCTCACCCCCAGCACCTTCCAGG + Intergenic
1085316932 11:75550960-75550982 CCTGCTCCCCAGAGCCTTCCCGG + Intergenic
1089009027 11:115118071-115118093 CCTGTACCCCAGAGCCTCCCAGG + Intergenic
1089368313 11:117934660-117934682 CCTGCCCTCCAGGACCTCCCAGG + Intergenic
1089454820 11:118620118-118620140 CCTGCACACCAGAGCCTTACGGG - Intronic
1092786129 12:12028720-12028742 CTTCATCTCCAGAACCTTCATGG - Intergenic
1092903926 12:13085159-13085181 CTTGAACTCCAGCACCATCCTGG + Exonic
1094370668 12:29734396-29734418 GATGAACTCCTGACCCTTCCCGG + Intronic
1096717404 12:53499654-53499676 CTTGAACTCCCGCTCCTTCCAGG + Intronic
1097491901 12:60281852-60281874 CCTGGAATCCACAAGCTTCCAGG - Intergenic
1097812722 12:64035969-64035991 CCTGAGCTCCAGTTCCTTCGAGG - Intronic
1100594454 12:96060068-96060090 CTTGAACTTCAGCACTTTCCAGG + Intergenic
1103415618 12:120740128-120740150 CCGGAACTCAGGAACCTCCCAGG - Intergenic
1104301033 12:127565210-127565232 CCTCATCTGCAGAACCTTCAGGG + Intergenic
1105540088 13:21308636-21308658 CCTCAAATCCACACCCTTCCTGG - Intergenic
1105608786 13:21949300-21949322 CCTCAACCACAGAACCTCCCAGG - Intergenic
1105653625 13:22408584-22408606 CCTAAACTCCAAAGCCTTCAGGG - Intergenic
1108312513 13:49209937-49209959 CCAGAGGCCCAGAACCTTCCTGG + Intergenic
1110967567 13:81719330-81719352 ACTGAACCTCAGAAACTTCCTGG - Intergenic
1112004013 13:95238458-95238480 TCTACACTCCAGAATCTTCCGGG - Intronic
1113386901 13:109857356-109857378 CCTTGACTTCAGAATCTTCCTGG - Intergenic
1115961152 14:38837196-38837218 TCTGATGTTCAGAACCTTCCTGG + Intergenic
1117499504 14:56338085-56338107 CTTGAACTCTAGATCCTGCCTGG + Intergenic
1118747843 14:68786658-68786680 GCTGAACTCCCAAAACTTCCTGG + Intergenic
1119791999 14:77359313-77359335 CCTGCACTCAGGACCCTTCCAGG + Intronic
1120279535 14:82421418-82421440 CCTGAACTCCAAAACAATCCTGG - Intergenic
1121329569 14:93041427-93041449 TGTGAGCACCAGAACCTTCCTGG + Intronic
1122282343 14:100630681-100630703 CCAGAAGACCAGGACCTTCCAGG + Intergenic
1122346435 14:101063910-101063932 ACTGAACCCCAGAATGTTCCTGG - Intergenic
1122886363 14:104712161-104712183 CCTGAGCCAGAGAACCTTCCAGG - Intronic
1126755755 15:51923445-51923467 CCTGTCCTTCAGAACCTTGCTGG + Intronic
1131075578 15:89493219-89493241 CTTGGACTCCAGAAGCTCCCTGG - Intronic
1132593668 16:738199-738221 CCAGCACCCCAGCACCTTCCAGG + Intronic
1132646140 16:1000130-1000152 CCCAAACTCAGGAACCTTCCTGG - Intergenic
1133420468 16:5642358-5642380 CCTTAATTCCAGACCTTTCCAGG + Intergenic
1133770501 16:8864848-8864870 GCTGAACTCCAGAACCTTCCAGG - Intronic
1133955852 16:10443326-10443348 CCTGAAGTCCAGCACCCTGCAGG - Intronic
1134436629 16:14264864-14264886 CCTCAACCCCAGATCATTCCAGG + Exonic
1136243135 16:28956824-28956846 CCTGAACTCCACCAGCTTCCTGG + Intronic
1140557046 16:75933813-75933835 CCTGATCACCAGAACATTGCAGG + Intergenic
1141806131 16:86342854-86342876 TCTGACCCCCAGAATCTTCCTGG + Intergenic
1142521528 17:508186-508208 GCTGAACTCCAAAACACTCCTGG + Intergenic
1142932502 17:3298910-3298932 CCTAAACCTCCGAACCTTCCTGG - Intergenic
1143275761 17:5708792-5708814 TCTGAACTCCAAAACATTTCTGG - Intergenic
1144230435 17:13197978-13198000 CCTGAACTCCAGCATCTTTGGGG + Intergenic
1145303147 17:21654496-21654518 CCTGAAGTCCAGTATCTACCTGG - Intergenic
1145346891 17:22047345-22047367 CCTGAAGTCCAGTATCTACCTGG + Intergenic
1146951681 17:36910903-36910925 CCTGAACCCCAAACCCCTCCAGG + Intergenic
1148216233 17:45835340-45835362 CCAGGCCTCCAGAACCTTACTGG + Exonic
1149657470 17:58318017-58318039 CCAGCACTCCAGAGCCTCCCTGG + Intronic
1151461836 17:74258932-74258954 CCTGGACCCCTGAAGCTTCCCGG + Intronic
1151978724 17:77497054-77497076 CCTGCTCTCCAGAAAGTTCCTGG - Intronic
1152892461 17:82890362-82890384 CGGGAACTCCAGAGCCTTCTCGG - Intronic
1153706349 18:7749424-7749446 CCTGCAATCCAGAACCTTCCTGG + Intronic
1157482634 18:48065284-48065306 CCTGAATACCAGAGCCTTGCTGG + Intronic
1157618381 18:49001362-49001384 CCTGGACTCCATGCCCTTCCTGG + Intergenic
1160155430 18:76430059-76430081 CCTGAACTTCAGGAACTTCCTGG + Intronic
1160490515 18:79333793-79333815 CCTGAGCTACAGAAAGTTCCTGG + Intronic
1161768138 19:6217895-6217917 CCTGAGCTCCAGGCCCTCCCCGG + Intronic
1164216910 19:23158537-23158559 CCTGAAGTCCAGTACCCTTCGGG - Intergenic
1166007659 19:39918204-39918226 CCTGGACCCCAGGCCCTTCCTGG - Exonic
1168589270 19:57619085-57619107 CCTGACCTCCAAACCCTTCCTGG - Intronic
925474578 2:4198508-4198530 CCTCAAACCCAGGACCTTCCTGG - Intergenic
925973760 2:9126381-9126403 CCTTCATTCCAGAAGCTTCCTGG + Intergenic
926137507 2:10347114-10347136 GCTGAACTCCAGCACCTGCGGGG - Intronic
926144936 2:10391178-10391200 GCTCAGCTCCAGCACCTTCCTGG + Intronic
927149047 2:20185383-20185405 CTAGGACTCCAGAAACTTCCAGG - Intergenic
929498660 2:42470411-42470433 CCTGTACTCCAGACACTTCGAGG + Intronic
929576684 2:43056710-43056732 CCAGAACTCCACAAGCTGCCAGG + Intergenic
932445608 2:71779205-71779227 CCTCAACTCCAGTTCCTGCCTGG + Intergenic
934066360 2:88345637-88345659 CCTGAGCTCCATTTCCTTCCTGG + Intergenic
934517606 2:94998578-94998600 CCAGATCTCTAGAAGCTTCCAGG + Intergenic
934605642 2:95693220-95693242 CTTGAAATACAGAATCTTCCTGG - Intergenic
936539108 2:113335760-113335782 CTTGAAATACAGAATCTTCCTGG - Intergenic
938408405 2:131045289-131045311 CCTGCACACCTGCACCTTCCTGG - Intronic
940994803 2:160137115-160137137 TATGAACTCCATTACCTTCCAGG - Intronic
943410936 2:187546947-187546969 CCTGAATTCCAGAACCTGTTAGG - Intronic
945201786 2:207289175-207289197 CTTGAAGCCCAGAACCTTCTCGG + Intergenic
947549931 2:231038385-231038407 CGTGCACTCCGGACCCTTCCGGG - Intronic
948235199 2:236383093-236383115 TCAGTACTCCAAAACCTTCCTGG - Intronic
1168801368 20:645532-645554 CCTGAACTCCAGACTCATCCCGG + Intergenic
1169376858 20:5073287-5073309 CCCCACCTTCAGAACCTTCCTGG - Intronic
1171395156 20:24828434-24828456 TCTGAACTCCACAGCCTTTCTGG + Intergenic
1172115632 20:32571924-32571946 CCTGAACTGCAGAATCTTTGGGG + Intronic
1172274683 20:33673290-33673312 CCTGAACGCCAGCCCCCTCCAGG + Intronic
1172445856 20:34993111-34993133 CCTGAACCCCAGTGCCATCCCGG + Exonic
1173474343 20:43348426-43348448 CCTCAGCTCAATAACCTTCCAGG + Intergenic
1174915689 20:54651348-54651370 CCTGAACTCCAGTACAGTGCCGG - Intergenic
1176007614 20:62875060-62875082 AGTGAAATCCAGAACTTTCCTGG + Intergenic
1176912749 21:14587011-14587033 CCTGCTCTACAGAAGCTTCCTGG - Intergenic
1177297774 21:19199755-19199777 CCTGAGCTCCAGGACCCTGCTGG + Intergenic
1177320490 21:19513679-19513701 CCTGCCATCCAGAAGCTTCCTGG - Intergenic
1178409987 21:32355512-32355534 CCAGAGCTCCAGCTCCTTCCAGG + Exonic
1179478747 21:41664711-41664733 CCTGACCTCCAGAAAATTCAAGG - Intergenic
1179718761 21:43303675-43303697 AGTGAACCCAAGAACCTTCCTGG - Intergenic
1181096260 22:20507326-20507348 CCTGAGATCCAGACCCCTCCGGG - Intronic
1181109288 22:20591848-20591870 CATGAACTCCAGCACCTGCCTGG - Intergenic
1182931091 22:34174957-34174979 CATGAATTCCAGAACTTTTCAGG + Intergenic
1183621849 22:38978323-38978345 CTTGAAGTCCTGAACCTGCCAGG - Intronic
1184561805 22:45268232-45268254 CCCGAGCTCCAAAACCGTCCTGG + Intergenic
1185319566 22:50194249-50194271 CCTGGGCTCTAGAACCCTCCTGG - Intronic
950447292 3:13045645-13045667 CCTGCATACCAGAACTTTCCTGG + Intronic
950586191 3:13894372-13894394 CCTGTATTCCACCACCTTCCCGG + Intergenic
951066883 3:18277075-18277097 CCTGAACAAGAGAATCTTCCAGG + Intronic
953603404 3:44390012-44390034 CCTGTTCTACAGAATCTTCCAGG + Intronic
954634663 3:52065013-52065035 CCTGGGCTCCAGGCCCTTCCTGG - Intergenic
955676565 3:61454926-61454948 TCTCTACTCCAAAACCTTCCTGG - Intergenic
956060921 3:65347230-65347252 CCTGAAGTTCAGAATCTGCCAGG - Intergenic
956467879 3:69536581-69536603 CCTGAGCTGCAGCAGCTTCCCGG - Intronic
956873619 3:73441599-73441621 CCTGAGCCCCAGTTCCTTCCTGG - Intronic
960001797 3:112740091-112740113 CCTCAACTGCACAAACTTCCTGG - Intergenic
961979524 3:131062320-131062342 TCTGAACCGGAGAACCTTCCAGG + Intronic
964516259 3:157511722-157511744 TCTGAACTCCAAAACATTTCTGG + Intronic
966677678 3:182606903-182606925 CCTGTACTCCAGATTCTTCCAGG - Intergenic
968389187 4:174890-174912 CCTGAAGGCCATAACCTTCTGGG + Intergenic
968398011 4:261414-261436 CCTGAAAGCCACAATCTTCCAGG + Intergenic
971321495 4:25609561-25609583 ACTGAATTGCAGCACCTTCCTGG - Intergenic
975078978 4:70251953-70251975 CCTGAATTCCAGAAGCTTTCTGG - Intergenic
980258808 4:130420517-130420539 CCTGAATGCCAGAACTTTCTTGG + Intergenic
982678323 4:158400827-158400849 CCTGAACTCCAGTTCCTCACTGG - Intronic
984816973 4:183848055-183848077 CCTGAACTGCATAACTTTCTAGG - Intergenic
986877859 5:12132619-12132641 CCTGTAGTCCAGATGCTTCCTGG - Intergenic
987097558 5:14563456-14563478 GCTGAACTCCAGAATCATGCGGG - Intergenic
988500865 5:31782661-31782683 CCTGAACCCCAGAATCATCTGGG - Intronic
988848647 5:35156610-35156632 CCTGACCTCAGGAACCTGCCCGG - Intronic
995525421 5:113046965-113046987 CATCAACTCCACAACCCTCCGGG + Intronic
998193274 5:140044201-140044223 CCTGAGCTCCACATCCTTCAAGG - Intergenic
1000989542 5:167897954-167897976 CATGAACTCCAGCCCCTTCGTGG + Intronic
1001180193 5:169513198-169513220 CCTGAACTCCAGGACCTACAGGG + Intergenic
1001419080 5:171573468-171573490 ACTGACCTCCAGAAGCTTCCGGG + Intergenic
1002548875 5:179972390-179972412 CCTGACCTGCAGCACCTTCCCGG - Intronic
1003652600 6:7975189-7975211 CCAGAACTTCGGAGCCTTCCAGG + Intronic
1004000432 6:11592485-11592507 CCTGGGCTCCAAACCCTTCCCGG + Intergenic
1004484247 6:16050872-16050894 CCTTAGTTCCAGAACCATCCAGG + Intergenic
1005437291 6:25828190-25828212 GCTGAACTTCAGAACCTTTATGG - Intronic
1006417760 6:33914824-33914846 AGCGAACTCAAGAACCTTCCTGG + Intergenic
1006746712 6:36347758-36347780 CCTGAAATACAGCCCCTTCCAGG - Intergenic
1007801398 6:44396875-44396897 CCTGCACTCAGGACCCTTCCAGG - Intronic
1011401660 6:86969411-86969433 CATGAACTCCAGGACTTTTCTGG + Intronic
1023528776 7:41132046-41132068 CCTGAACTTCAGTACCCTCGAGG - Intergenic
1023779800 7:43645164-43645186 CCTTAACTCCAGGACTTTCCAGG + Intronic
1024299400 7:47875430-47875452 CCTGCACATCAGAATCTTCCAGG + Intronic
1024481461 7:49867635-49867657 CCTGAACTCTAGCACCTGCGAGG + Intronic
1025281151 7:57627150-57627172 CCTGAAGTCCAGTATCTACCTGG - Intergenic
1025303578 7:57838357-57838379 CCTGAAGTCCAGTATCTACCTGG + Intergenic
1032192790 7:129774133-129774155 CCTCTGCTCCAGAACCTTCTAGG + Intergenic
1032579125 7:133087758-133087780 CCAGGACTCCAGAAGCTTCTAGG + Intergenic
1032736960 7:134701562-134701584 CATAACCTCCAGAACATTCCTGG + Intergenic
1033426837 7:141252348-141252370 CCTGAACTCCAGAACCTGTGAGG - Intronic
1034105151 7:148483625-148483647 CCTGAGCTCCAGCGCCTCCCTGG - Intergenic
1034397189 7:150836096-150836118 CGTGAACTCCACAACATTCCTGG - Intronic
1035897421 8:3419268-3419290 CCTGAACTCAAGAATCAACCAGG - Intronic
1036153645 8:6321957-6321979 CCAGAACCCCAGAAGCCTCCCGG - Intergenic
1038134499 8:24770704-24770726 CCTGAAGCCAAGAACCCTCCAGG + Intergenic
1039791440 8:40879024-40879046 CCTGAACTTCATTAGCTTCCAGG - Intronic
1040637556 8:49292929-49292951 CCTGGCTTCCAGAACCTCCCAGG + Intergenic
1041336226 8:56787547-56787569 CCGGAACTCCAGAACCTAACAGG - Intergenic
1047192418 8:122690211-122690233 CCTGAACTGCCGAACCAACCTGG - Intergenic
1048464641 8:134655185-134655207 CCTGAGCTCCTGCCCCTTCCCGG - Intronic
1048936725 8:139363826-139363848 TCTGAACTCCAGCGGCTTCCAGG + Intergenic
1049826413 8:144671684-144671706 CCTGAACTCCACGCCCCTCCCGG + Intergenic
1050607647 9:7317986-7318008 GCAGAACTCCAGAACGTCCCAGG + Intergenic
1052070280 9:24073500-24073522 CCTGTAATCCAAAACCTTCATGG - Intergenic
1054458482 9:65449404-65449426 CCACAACCCCAGAAGCTTCCTGG - Intergenic
1061329075 9:129880957-129880979 CCGGGACTTCAGAGCCTTCCTGG - Exonic
1061519186 9:131107512-131107534 CAAGAACTAGAGAACCTTCCTGG - Intronic
1062513465 9:136920716-136920738 CCTGGCCTCTAGGACCTTCCAGG - Intronic
1062607227 9:137353709-137353731 CATGGACTCCAGGACCTTGCGGG - Intronic
1186270977 X:7887769-7887791 TCTTCACTCCACAACCTTCCAGG + Intergenic
1187396619 X:18924829-18924851 CCTTAATTCCTGATCCTTCCAGG + Intronic
1188441913 X:30221800-30221822 TGTGAAGTCCAGAACCGTCCTGG + Intergenic
1191061203 X:56298496-56298518 CCAGACCTCCAGAAGCATCCAGG + Intergenic
1192915423 X:75646367-75646389 CCTGAAGTCCAGCACCCTGCAGG - Intergenic
1196753634 X:119139182-119139204 CTGCAAGTCCAGAACCTTCCAGG + Intronic
1196902640 X:120401054-120401076 CCTGCAATTCAGAACTTTCCAGG + Intergenic
1198154685 X:133947174-133947196 CCTGCCCTCTAGAAGCTTCCAGG - Intronic
1198962401 X:142196056-142196078 CCTGGACTCCTGAAACTGCCTGG + Intergenic
1198963944 X:142208144-142208166 CCTGGACTCCTGAAACTCCCTGG + Intergenic
1199616806 X:149662532-149662554 CCAGGAGCCCAGAACCTTCCGGG - Intergenic
1199625835 X:149740716-149740738 CCAGGAGCCCAGAACCTTCCGGG + Intergenic