ID: 924613152

View in Genome Browser
Species Human (GRCh38)
Location 1:245590246-245590268
Sequence CCGCGCATGCGCAGGGTCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 2, 1: 3, 2: 8, 3: 27, 4: 153}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924613144_924613152 -7 Left 924613144 1:245590230-245590252 CCCTGGCCGCACCGTGCCGCGCA 0: 1
1: 1
2: 1
3: 4
4: 58
Right 924613152 1:245590246-245590268 CCGCGCATGCGCAGGGTCCCGGG 0: 2
1: 3
2: 8
3: 27
4: 153
924613134_924613152 24 Left 924613134 1:245590199-245590221 CCACCCGGCGAGTCAGAGCAGGG 0: 1
1: 2
2: 1
3: 4
4: 111
Right 924613152 1:245590246-245590268 CCGCGCATGCGCAGGGTCCCGGG 0: 2
1: 3
2: 8
3: 27
4: 153
924613138_924613152 20 Left 924613138 1:245590203-245590225 CCGGCGAGTCAGAGCAGGGGTCG 0: 1
1: 1
2: 3
3: 13
4: 126
Right 924613152 1:245590246-245590268 CCGCGCATGCGCAGGGTCCCGGG 0: 2
1: 3
2: 8
3: 27
4: 153
924613145_924613152 -8 Left 924613145 1:245590231-245590253 CCTGGCCGCACCGTGCCGCGCAT 0: 1
1: 0
2: 1
3: 5
4: 55
Right 924613152 1:245590246-245590268 CCGCGCATGCGCAGGGTCCCGGG 0: 2
1: 3
2: 8
3: 27
4: 153
924613137_924613152 21 Left 924613137 1:245590202-245590224 CCCGGCGAGTCAGAGCAGGGGTC 0: 1
1: 1
2: 2
3: 18
4: 162
Right 924613152 1:245590246-245590268 CCGCGCATGCGCAGGGTCCCGGG 0: 2
1: 3
2: 8
3: 27
4: 153
924613143_924613152 -6 Left 924613143 1:245590229-245590251 CCCCTGGCCGCACCGTGCCGCGC No data
Right 924613152 1:245590246-245590268 CCGCGCATGCGCAGGGTCCCGGG 0: 2
1: 3
2: 8
3: 27
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924613152 Original CRISPR CCGCGCATGCGCAGGGTCCC GGG Intronic
900671431 1:3857215-3857237 TCGCGCACGCGCAGAGGCCCTGG - Intergenic
902560138 1:17272216-17272238 CCGAGCATGCGCAAAGGCCCGGG + Intronic
903043939 1:20552409-20552431 CCGCGCCTGTGCAGGGTCCCGGG + Intergenic
903184767 1:21622673-21622695 ACGCGCAGGCGCGGTGTCCCGGG - Intronic
914710988 1:150213629-150213651 CTGCGCATGCGCGGGGGCGCAGG - Intergenic
915637049 1:157194830-157194852 ACGCCCAGGCGAAGGGTCCCCGG + Intergenic
924052394 1:240092177-240092199 CCGAGGATGCGCTGGGGCCCAGG + Exonic
924613152 1:245590246-245590268 CCGCGCATGCGCAGGGTCCCGGG + Intronic
1065319280 10:24494139-24494161 CCTAGCATTCGCAGTGTCCCAGG - Intronic
1076143573 10:128098459-128098481 CCGCGGAATCTCAGGGTCCCAGG - Exonic
1077103856 11:833488-833510 CCGCGCCTGCCAAGCGTCCCCGG - Intronic
1081669433 11:44934849-44934871 CCAGGCATGGGCAGGGCCCCAGG + Exonic
1084006985 11:66328356-66328378 CCCCCCATTCGCAGGGTCCCAGG + Intergenic
1094828997 12:34291298-34291320 CAGCCCCTGCACAGGGTCCCAGG - Intergenic
1094836902 12:34326322-34326344 CAGCACCTGCGCAGGGCCCCAGG - Intergenic
1094838694 12:34334097-34334119 CAGCGCATGCGCGGGGGCCAGGG + Intergenic
1094838787 12:34334432-34334454 TCGTGCATGCGCGGTGTCCCGGG + Intergenic
1094838834 12:34334602-34334624 CCAAGCATGTGCAGGTTCCCAGG + Intergenic
1094838883 12:34334747-34334769 CCGCGCATGCGCGGGGTCCCTGG + Intergenic
1094839241 12:34336033-34336055 CCACGCATGCGCGGAGTCCTGGG + Intergenic
1094839279 12:34336206-34336228 CTGCGCATGCGCGGGGTCTCCGG + Intergenic
1094839378 12:34336579-34336601 CCACGCATGCGTGGGGTCCCGGG + Intergenic
1094839427 12:34336751-34336773 CCGCGCATGCGTGGGGTCCCGGG + Intergenic
1094839483 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG + Intergenic
1094839677 12:34337680-34337702 CCACACATGAGCAGGGTTCCGGG + Intergenic
1094839791 12:34338071-34338093 CCGCGCATTCGCGGGGTCCGGGG + Intergenic
1094839999 12:34338883-34338905 CCGCGCATGTACGGGGTCCTGGG + Intergenic
1094840129 12:34339358-34339380 CCGCTCATGCACGGGGTCCAGGG + Intergenic
1094840235 12:34339753-34339775 CTGTGCATGCACTGGGTCCCGGG + Intergenic
1094840653 12:34341412-34341434 CCACGCATGCGCGGGGTCCCAGG + Intergenic
1094840898 12:34342329-34342351 CTGCACATGCGCAGGATCCCGGG + Intergenic
1094841064 12:34342899-34342921 CCGCGCAAGCGCGGGGTCCAGGG + Intergenic
1094841113 12:34343088-34343110 CCGCACATGCGCGGTGTCCCAGG + Intergenic
1094841200 12:34343342-34343364 CCGCGCATGCGCAGGGTCCCAGG + Intergenic
1094841249 12:34343531-34343553 CCGCGCATGCGCGTGGTCCAGGG + Intergenic
1094841314 12:34343757-34343779 CCACGCATGCACGGGGGCCCGGG + Intergenic
1094841608 12:34344744-34344766 CCGTGCATGCGCGAGGTCCCGGG - Intergenic
1094841760 12:34345284-34345306 CCGCGCATACGCGGGATCCCGGG - Intergenic
1094841970 12:34346000-34346022 CCGCGCATGCGCGGGGTCCCGGG - Intergenic
1094842170 12:34346725-34346747 CCACGCATGCGCGGGGTCCCTGG - Intergenic
1094842518 12:34348034-34348056 CCACGCATGCACGGTGTCCCGGG - Intergenic
1094842733 12:34348797-34348819 CCGTGCATGCGCGGGGTCCCGGG - Intergenic
1094842835 12:34349174-34349196 CCGCACATGCGCGGTGTCCCAGG - Intergenic
1094842938 12:34349558-34349580 CTGCACATGCGCAGGGTCCTGGG - Intergenic
1094843041 12:34349918-34349940 CCGTGCATAAGCAGGGTCCTAGG - Intergenic
1094843091 12:34350106-34350128 CTGCGCATGCAGGGGGTCCCGGG - Intergenic
1094843195 12:34350467-34350489 CCGCACATGCGCGGTGTCCCGGG - Intergenic
1094843656 12:34352180-34352202 CCGCGCATGTGCGGGGTCCCAGG - Intergenic
1094844358 12:34354945-34354967 CTGCGCATGCGCGGGGCCCAGGG - Intergenic
1094844638 12:34356073-34356095 CCGCGCAAGTGCAGGGCCCAAGG - Intergenic
1094844866 12:34357031-34357053 CCGTGCATGCGCAGGCCCCAAGG - Intergenic
1094845082 12:34357970-34357992 CCGCGCATGTGCGGGGCCCAGGG - Intergenic
1094845123 12:34358159-34358181 CCGCTCATGCGCAAGGCCCAGGG - Intergenic
1094845450 12:34359475-34359497 CCGCCGATGGGCAGGGTCCAGGG - Intergenic
1094845682 12:34360416-34360438 CTGTGCATACGCAGGGTCCAGGG - Intergenic
1094845960 12:34361531-34361553 CCGCGCATGAGTGGGGTCCAGGG - Intergenic
1094846108 12:34362095-34362117 CCGCGCATGCGTGGGGCCCTAGG - Intergenic
1094846382 12:34363227-34363249 CCACGCATGCGCGGGGCCCAGGG - Intergenic
1094846429 12:34363416-34363438 CCGTGCATGCGCAGGGCCCAGGG - Intergenic
1094847069 12:34366004-34366026 CCGCGCATGCACGGGGCCCAGGG - Intergenic
1094847384 12:34367308-34367330 CCGCGCATACGCAGGGCCCAGGG - Intergenic
1094847619 12:34368249-34368271 CCGCGCATGCGTGGGGCCCAGGG - Intergenic
1094847844 12:34369185-34369207 CCGCACATGCGCATGGCCCAGGG - Intergenic
1094848421 12:34371625-34371647 CCACGCATGCACAGGGTCCACGG - Intergenic
1094849327 12:34375358-34375380 CCGCCCATGGGCAGGGCCCAGGG - Intergenic
1094849376 12:34375545-34375567 CTGCGAATGCGCAGGGCCCAGGG - Intergenic
1094849463 12:34375919-34375941 CCGCACATGCACAGGGCCCAGGG - Intergenic
1094849556 12:34376296-34376318 CTGGGCATGCGCAGGGCCCAGGG - Intergenic
1094849657 12:34376673-34376695 CCACGCATGCACAGGGCCCAGGG - Intergenic
1094849699 12:34376861-34376883 CCGTGCATGCGCAGGGCTCACGG - Intergenic
1094849747 12:34377050-34377072 TCGCGCATGTGCAGGGCCCAGGG - Intergenic
1094849792 12:34377238-34377260 CCGCGCATTCGCGGGGCCCAGGG - Intergenic
1094850196 12:34378938-34378960 CCGCGCATACGCAGGGCCCAGGG - Intergenic
1094851081 12:34382678-34382700 CCATGCATGCCCAGGGTCCAGGG - Intergenic
1094851175 12:34383052-34383074 CCACGCATGGGCAGGGCCCAAGG - Intergenic
1094851638 12:34384889-34384911 CCGCGCATGTGCAGAGCCCACGG - Intergenic
1094852552 12:34388772-34388794 CTGCGCATGCACAGGGCCCAGGG - Intergenic
1094854582 12:34397260-34397282 CCGCACATGTGCAGGGCCCTGGG + Intergenic
1094855204 12:34399802-34399824 CCGCGCATTCACAGGGCCCAGGG + Intergenic
1094855288 12:34400176-34400198 CCGCACATGCGCAGGGCTCAGGG + Intergenic
1094855333 12:34400365-34400387 CCGCACATGTGCAGGGCCCAAGG + Intergenic
1094855850 12:34402489-34402511 CCGCGCATGCGTGGGGCCCAAGG + Intergenic
1094856493 12:34405220-34405242 CCGCTCATGCGCAGGGCCCCAGG + Intergenic
1094872809 12:34607433-34607455 CCACGCATGCACAGGGCCCAGGG + Intergenic
1094872895 12:34607809-34607831 CCGCGCATGTGCAGGGCCCAGGG + Intergenic
1095937924 12:47705523-47705545 CCGCCCCATCGCAGGGTCCCTGG - Intronic
1101053503 12:100888446-100888468 CCGCGCAAGAGCAGGAGCCCTGG + Intronic
1103915430 12:124373417-124373439 CAGTGCGTGCGCAGGGGCCCCGG + Intronic
1103915442 12:124373459-124373481 CAGTGCGTGCGCAGGGGCCCCGG + Intronic
1103915453 12:124373501-124373523 CAGTGCGTGCGCAGGGGCCCCGG + Intronic
1103915464 12:124373543-124373565 CAGTGCGTGCGCAGGGGCCCCGG + Intronic
1103915476 12:124373585-124373607 CAGTGCGTGCGCAGGGGCCCCGG + Intronic
1103915488 12:124373627-124373649 CAGTGCGTGCGCAGGGGCCCCGG + Intronic
1103915499 12:124373672-124373694 CAGTGCGTGCGCAGGGGCCCCGG + Intronic
1103915510 12:124373717-124373739 CAGTGCGTGCGCAGGGGCCCCGG + Intronic
1103915543 12:124373852-124373874 CAGTGCGTGCGCAGGGGCCCCGG + Intronic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1113696279 13:112348418-112348440 CCGTGCATGCACTGGGTCTCAGG + Intergenic
1113841175 13:113362730-113362752 CCGCCCAGGTGCAGGGCCCCTGG + Intronic
1113990568 14:16024411-16024433 CTGCGCATGCGCAGGTCCGCGGG - Intergenic
1114484655 14:23055637-23055659 CCGGGCCTGGGCAGGGTCCCGGG - Exonic
1119200235 14:72746713-72746735 CCAGGGATGGGCAGGGTCCCGGG - Intronic
1122347034 14:101067150-101067172 CTGCCCATGCCCAGGGTCCAGGG + Intergenic
1122786033 14:104163684-104163706 CCGCGCATGCTCGGGGTTCCGGG - Intronic
1122800960 14:104229261-104229283 CCCCTCCTGGGCAGGGTCCCCGG - Intergenic
1125546719 15:40511648-40511670 GCGCGCAGGGGCAGGTTCCCTGG + Intergenic
1127953539 15:63833606-63833628 CCGCGGATCCCCCGGGTCCCCGG - Intronic
1128161099 15:65423118-65423140 GCGCGCGGGCGCAGGGTCCCCGG - Intergenic
1129814553 15:78540416-78540438 CCGCGCATGCGCAGAACCGCTGG - Exonic
1132396241 15:101476946-101476968 CCCCACATGCCCTGGGTCCCTGG - Intronic
1133242824 16:4425853-4425875 CGGCGCAGGCGCAGAGTCCCCGG + Exonic
1136105258 16:28025693-28025715 CCGCTCTTTCACAGGGTCCCAGG - Intronic
1136397280 16:30000199-30000221 CCACGCATGGCCAGGGTGCCAGG - Intronic
1139510273 16:67424160-67424182 CCGCCCCTGCACAGGCTCCCTGG + Intergenic
1139655458 16:68384610-68384632 CTCCACATGGGCAGGGTCCCTGG - Intronic
1141092726 16:81141296-81141318 CCTGGCATGTGCAGGGGCCCAGG + Intergenic
1142151416 16:88514237-88514259 CCGGGCAGGTGCTGGGTCCCAGG - Intronic
1144946095 17:18970290-18970312 CCTCTCATGCGGTGGGTCCCAGG - Exonic
1147383435 17:40068986-40069008 CCCCGCATGCGCAGAGCCACAGG - Intronic
1148461446 17:47841127-47841149 CTGGGCATGCGCAGGGCCGCAGG - Intronic
1151755740 17:76074478-76074500 CGGCGCACACGCAGGGTCCGGGG + Intronic
1151831796 17:76557195-76557217 CCGCGGCTGCCCAGGGGCCCGGG - Intergenic
1152758543 17:82097201-82097223 CCGCGCAGGTGAAGGGTGCCAGG - Intronic
1152856086 17:82665106-82665128 CCACGCATGTGCAGGGACACGGG + Intronic
1154210774 18:12377106-12377128 CCGCGCCTGCGCAGCGTCCCGGG - Exonic
1160242321 18:77132676-77132698 GCGCCCACGCGCGGGGTCCCCGG + Exonic
1160452399 18:78974316-78974338 GTGCGCGTGCGAAGGGTCCCAGG - Intergenic
1160678596 19:403390-403412 CCACGCAGGCGCAGAATCCCTGG + Intergenic
1160701132 19:507924-507946 CAGCGCCGGCGCAGGGGCCCGGG + Intronic
1160824918 19:1074988-1075010 CCGCGCATGCGCAGGAGGCCGGG - Intronic
1160937808 19:1605452-1605474 CCGCGCCTGCGCAGTGTAGCCGG - Exonic
1163118066 19:15200149-15200171 CCGCGCAGGGGCGGGGTCCCAGG + Intronic
926358829 2:12066139-12066161 TGGCCCATGGGCAGGGTCCCTGG + Intergenic
932201220 2:69829942-69829964 CCCAGCAGGCGCAGGGTGCCAGG + Exonic
932355936 2:71068540-71068562 CCGCGCATGCGCACGCGCACAGG + Exonic
936514136 2:113171103-113171125 CAGCGCAGTCCCAGGGTCCCAGG - Intronic
938817445 2:134918703-134918725 CCGCGCATGCGCAAGGGCGGAGG + Intronic
945958610 2:216109272-216109294 CTGCGCATGCTCAGAGTTCCGGG + Exonic
948921997 2:241070209-241070231 CCGCCCACGCGCAGGGCCCACGG - Intronic
949018167 2:241725264-241725286 CCGAGCATCAGCAGGGACCCCGG + Exonic
1171771319 20:29325269-29325291 CTGCGCATGCGCAGGTCCGCGGG + Intergenic
1171824011 20:29878376-29878398 CTGCGCATGCGCGGGTTTCCAGG - Intergenic
1172973839 20:38892321-38892343 CCACGCATCCCCAGGGGCCCAGG - Intronic
1176057672 20:63157307-63157329 CAGCGCAGGCGCCTGGTCCCTGG + Intergenic
1176121924 20:63457920-63457942 CAGCGCCTGCTCACGGTCCCTGG + Intronic
1176414912 21:6468469-6468491 CTGCGCCTCCGCAGCGTCCCCGG + Intergenic
1178831508 21:36060564-36060586 TCGCGCATGCGCAGTGTTCGCGG + Intronic
1179437795 21:41374217-41374239 CAGCACATGCTCTGGGTCCCCGG + Intronic
1179478370 21:41662294-41662316 CCGCCCTTGTGGAGGGTCCCGGG + Intergenic
1179495017 21:41766245-41766267 CCGCGCAAGCGCCGGGCGCCCGG + Intronic
1179690412 21:43076791-43076813 CTGCGCCTCCGCAGCGTCCCCGG + Intronic
1179977027 21:44874019-44874041 CCGCGCAGGCGCAGGAGCCGCGG - Intergenic
1180316702 22:11283115-11283137 CTGCGCATGCGCAGGTCCGCGGG + Intergenic
1180699716 22:17774558-17774580 CCGCGCCGGCGCGGGCTCCCCGG - Intronic
1182903799 22:33920276-33920298 CCCCGCATGGGCAGGGGCCTGGG + Exonic
1184698110 22:46150766-46150788 CGGCGCATGCGCGGGGCCCGGGG + Intronic
1185113798 22:48919887-48919909 CCTCGCATGAGCAGGGTCAGGGG - Intergenic
1185409647 22:50674906-50674928 TCGCGGAGGCGCGGGGTCCCGGG + Intergenic
950992847 3:17459344-17459366 CCTCGCATGCACAGGGTTCATGG + Intronic
953027464 3:39153317-39153339 CCGCGCCCGCTCAGGGTGCCGGG + Intronic
961631360 3:128301407-128301429 CCGCCCATGTGCAGAGCCCCAGG - Intronic
962247207 3:133805785-133805807 CCGCGCCTGCGCAGAGTGCAGGG + Exonic
968524506 4:1049175-1049197 CAGCTCCTGCCCAGGGTCCCGGG + Intergenic
968672090 4:1857147-1857169 CCGCTCATGCGCCGTCTCCCAGG + Intergenic
970364093 4:15341314-15341336 CAGCCCAAGAGCAGGGTCCCAGG - Intronic
970676729 4:18459044-18459066 CAGGGGATGCCCAGGGTCCCAGG + Intergenic
972345216 4:38187118-38187140 CCTAGCATGTGCAGGGTCCTCGG + Intergenic
985445870 4:190021159-190021181 CTGCGCATGCGCAGGTTTGCAGG - Intergenic
985828146 5:2207939-2207961 CCGCCCATCCACAGGGACCCAGG - Intergenic
992542213 5:77776352-77776374 GCGCGCATGCGCAGGCTGCGCGG + Exonic
992663553 5:78984739-78984761 CCGGGCATGCGCAGAGGCCGCGG + Intronic
1014019521 6:116571463-116571485 GGGCGCAGGCGCAGAGTCCCCGG - Exonic
1014913573 6:127119807-127119829 CCGCGCAGGCGCTCGCTCCCTGG - Intronic
1019156852 6:170044990-170045012 CCTCCCATGTGCAGGCTCCCTGG - Intergenic
1019916019 7:4133162-4133184 AAGCGCATGCCCTGGGTCCCGGG + Intronic
1020257031 7:6508177-6508199 CAGCGCCTGAGCAGGGCCCCGGG + Exonic
1021925410 7:25529505-25529527 CCACGCATGCTTGGGGTCCCGGG - Intergenic
1035376723 7:158411433-158411455 CCGGGCATGTGCAAGGGCCCAGG - Intronic
1036739501 8:11347851-11347873 CCGGGCGCGCGCAGGGTCCCCGG + Intergenic
1037716567 8:21406206-21406228 CCGTGCAGGCTGAGGGTCCCTGG - Intergenic
1037855296 8:22367255-22367277 CCGGGCATGCGCGCGGTGCCGGG + Exonic
1040079386 8:43271984-43272006 TTGCGCCTGCGCAGCGTCCCGGG - Intergenic
1053443260 9:38132733-38132755 CAGGGCATGGGCAGGGGCCCTGG + Intergenic
1054337163 9:63817474-63817496 CTGCGCATGCGCGGGTTTCCAGG - Intergenic
1057195296 9:93113006-93113028 CCGAGGACGCGCCGGGTCCCTGG - Exonic
1060192004 9:121599433-121599455 CCCCGCCCGCGCTGGGTCCCGGG + Intronic
1062151324 9:135020641-135020663 CCCAGGATGTGCAGGGTCCCCGG + Intergenic
1062382517 9:136294388-136294410 CCACACATGCCAAGGGTCCCTGG + Intronic
1185450780 X:280193-280215 CTCCGGATGCCCAGGGTCCCGGG - Intronic
1186859001 X:13653042-13653064 GCGCGCATGCACTGGGTCCCAGG + Intergenic
1188683497 X:33041278-33041300 GCGCGCATGCGCAGGCTGCGCGG - Intronic
1190285417 X:48957958-48957980 GCGCGCGTGCGCAGCGCCCCGGG - Intronic
1199445035 X:147911783-147911805 GCGCGCATGCGCGCGCTCCCAGG + Intergenic