ID: 924616718

View in Genome Browser
Species Human (GRCh38)
Location 1:245618028-245618050
Sequence CCTGACTTTGGTGGGAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 277}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924616718_924616733 13 Left 924616718 1:245618028-245618050 CCTTTCCTCCCACCAAAGTCAGG 0: 1
1: 0
2: 2
3: 22
4: 277
Right 924616733 1:245618064-245618086 GAGAAGGAGGCAGGGAGGGAGGG 0: 2
1: 103
2: 1594
3: 11298
4: 25680
924616718_924616734 19 Left 924616718 1:245618028-245618050 CCTTTCCTCCCACCAAAGTCAGG 0: 1
1: 0
2: 2
3: 22
4: 277
Right 924616734 1:245618070-245618092 GAGGCAGGGAGGGAGGGAAAAGG 0: 1
1: 41
2: 344
3: 1567
4: 5665
924616718_924616729 5 Left 924616718 1:245618028-245618050 CCTTTCCTCCCACCAAAGTCAGG 0: 1
1: 0
2: 2
3: 22
4: 277
Right 924616729 1:245618056-245618078 AGAAGGAAGAGAAGGAGGCAGGG 0: 1
1: 8
2: 149
3: 1648
4: 10183
924616718_924616735 24 Left 924616718 1:245618028-245618050 CCTTTCCTCCCACCAAAGTCAGG 0: 1
1: 0
2: 2
3: 22
4: 277
Right 924616735 1:245618075-245618097 AGGGAGGGAGGGAAAAGGAAAGG 0: 3
1: 38
2: 295
3: 1773
4: 9203
924616718_924616730 8 Left 924616718 1:245618028-245618050 CCTTTCCTCCCACCAAAGTCAGG 0: 1
1: 0
2: 2
3: 22
4: 277
Right 924616730 1:245618059-245618081 AGGAAGAGAAGGAGGCAGGGAGG 0: 1
1: 25
2: 489
3: 5252
4: 20607
924616718_924616727 0 Left 924616718 1:245618028-245618050 CCTTTCCTCCCACCAAAGTCAGG 0: 1
1: 0
2: 2
3: 22
4: 277
Right 924616727 1:245618051-245618073 GTTACAGAAGGAAGAGAAGGAGG 0: 1
1: 0
2: 9
3: 96
4: 932
924616718_924616726 -3 Left 924616718 1:245618028-245618050 CCTTTCCTCCCACCAAAGTCAGG 0: 1
1: 0
2: 2
3: 22
4: 277
Right 924616726 1:245618048-245618070 AGGGTTACAGAAGGAAGAGAAGG 0: 1
1: 0
2: 4
3: 81
4: 724
924616718_924616728 4 Left 924616718 1:245618028-245618050 CCTTTCCTCCCACCAAAGTCAGG 0: 1
1: 0
2: 2
3: 22
4: 277
Right 924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG 0: 1
1: 1
2: 23
3: 442
4: 3704
924616718_924616731 9 Left 924616718 1:245618028-245618050 CCTTTCCTCCCACCAAAGTCAGG 0: 1
1: 0
2: 2
3: 22
4: 277
Right 924616731 1:245618060-245618082 GGAAGAGAAGGAGGCAGGGAGGG 0: 1
1: 30
2: 529
3: 5285
4: 21846
924616718_924616736 29 Left 924616718 1:245618028-245618050 CCTTTCCTCCCACCAAAGTCAGG 0: 1
1: 0
2: 2
3: 22
4: 277
Right 924616736 1:245618080-245618102 GGGAGGGAAAAGGAAAGGAAAGG 0: 3
1: 21
2: 285
3: 1940
4: 11865
924616718_924616732 12 Left 924616718 1:245618028-245618050 CCTTTCCTCCCACCAAAGTCAGG 0: 1
1: 0
2: 2
3: 22
4: 277
Right 924616732 1:245618063-245618085 AGAGAAGGAGGCAGGGAGGGAGG 0: 1
1: 92
2: 1497
3: 10735
4: 23782

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924616718 Original CRISPR CCTGACTTTGGTGGGAGGAA AGG (reversed) Intronic
900391722 1:2436590-2436612 ACTGACCTTGGAGGGAGGAAGGG - Intronic
900694778 1:4002894-4002916 CCTGACTGCGGATGGAGGAAGGG + Intergenic
902550812 1:17218609-17218631 CCTTGGTGTGGTGGGAGGAAAGG + Intronic
902635870 1:17734928-17734950 CCTTCCCTTGGTGGGAGGGAGGG - Intergenic
907438611 1:54464892-54464914 CCTGACTATGCAGGGAGGAGAGG - Intergenic
908455256 1:64297128-64297150 TCTGACTAGGGTGGTAGGAAGGG - Intergenic
911220534 1:95240764-95240786 CCTGAATTAGGAGGGTGGAAGGG + Intronic
913250458 1:116909089-116909111 CCCGACTTGGTTGGGAGAAATGG - Intergenic
913548417 1:119893175-119893197 AGTGATTTTGGTGGGAGGAGAGG - Intergenic
914876680 1:151517470-151517492 CCTTCCCTTGGTGGGAGGAAGGG + Intronic
915239090 1:154507097-154507119 CCTGATTCTGGGAGGAGGAAGGG + Intronic
915561504 1:156690799-156690821 CCAGAACTTGGTGGGAGGAGCGG + Intergenic
915945666 1:160149750-160149772 TCTGAGTTTGGAGGGAGGGAAGG + Intergenic
916303520 1:163302780-163302802 TCTGAATTTGGTGTGAGGAAGGG - Intronic
917163209 1:172080832-172080854 ACTGACTGTGCTGTGAGGAATGG - Intronic
918993191 1:191725107-191725129 TCTGACATTGATGGGAGGGATGG + Intergenic
919986075 1:202676178-202676200 TCTGAATTGGGTGGGGGGAAGGG - Intronic
923925477 1:238622062-238622084 TATTATTTTGGTGGGAGGAAAGG + Intergenic
924616718 1:245618028-245618050 CCTGACTTTGGTGGGAGGAAAGG - Intronic
924889078 1:248254248-248254270 CCTGAAAGTGATGGGAGGAATGG + Intergenic
1062871877 10:911833-911855 CCTGACTTTTGTGTGTGCAATGG + Intronic
1063668327 10:8079783-8079805 CCTGCCTTTGGTGGCAGGGCTGG + Intergenic
1065549696 10:26858284-26858306 GCTGACTTTGGTGCTAAGAATGG - Intronic
1065940020 10:30555953-30555975 CCTGAGTTTCTTGGGAGGAGAGG + Intergenic
1066584044 10:36912653-36912675 CCTGAAAGTGATGGGAGGAATGG - Intergenic
1067535257 10:47104785-47104807 CTTAACTTTGCTAGGAGGAAGGG - Intergenic
1067789484 10:49277044-49277066 CCGGGGTCTGGTGGGAGGAAAGG - Intergenic
1067901502 10:50246435-50246457 CCTGACTATTGTCTGAGGAAGGG - Intronic
1068528040 10:58153594-58153616 TCTTACTTTGGCTGGAGGAAAGG - Intergenic
1069243122 10:66166915-66166937 CTTGAGTTTGGTGGGAGGAGTGG + Intronic
1069942477 10:71964787-71964809 CCAGACTTTGGAGGGAGAAGGGG + Intronic
1070481305 10:76885411-76885433 CCTGTCTTTGGTGTGGGGGAGGG + Exonic
1071312227 10:84353610-84353632 CCTGACTTAGGTGGGTGAATGGG + Intronic
1072924018 10:99600343-99600365 CCTGGGTATGGTGGGAGGTAGGG - Intergenic
1074148524 10:110738459-110738481 CCTGACTTTGCTGGGAGAAAGGG - Intronic
1076309253 10:129492419-129492441 CGAGACTGGGGTGGGAGGAAAGG - Intronic
1077898962 11:6474554-6474576 AGTGTCTTTGGTGTGAGGAAGGG - Intergenic
1078546655 11:12252097-12252119 CCTGGGCTTTGTGGGAGGAAAGG - Intronic
1080565633 11:33506892-33506914 CCTGGTTTTGGTGGGAGGTGGGG - Intergenic
1081397295 11:42601748-42601770 CCTGACTCTGGTAGGAGAAAAGG - Intergenic
1081684839 11:45034968-45034990 ACTGACTTCCGTGGAAGGAAAGG + Intergenic
1081875852 11:46408013-46408035 CCTGAAATAGGTGAGAGGAAGGG + Intronic
1083234716 11:61344059-61344081 CTTGACTATGGTGGGAGGTGTGG - Intronic
1084015055 11:66373477-66373499 GCTGGCATTGGTGGGAGGAGGGG + Intergenic
1084048674 11:66586542-66586564 CGAGACTCTCGTGGGAGGAAGGG + Intergenic
1084550020 11:69835528-69835550 CCTGGCTTTGGTTTGAGAAACGG + Intergenic
1087216718 11:95502893-95502915 CCTGACTATTGGGGGAGGAGGGG - Intergenic
1089007699 11:115106057-115106079 TCTGGCTTTGATGGGAGGAAAGG - Intergenic
1089190536 11:116650210-116650232 CCTGATGGTGGTGGGAGGCAGGG - Intergenic
1090638569 11:128709958-128709980 ACTGACTTTGGTGTGAGTGAAGG + Intronic
1093176373 12:15917800-15917822 GCTGACTTTGGTGCTGGGAAAGG - Intronic
1093934809 12:24989182-24989204 TCTGGGTTTGGTGGGAGGATTGG + Intergenic
1094127786 12:27041564-27041586 CCTGAAAGTGATGGGAGGAATGG + Intronic
1094173742 12:27521354-27521376 CCTGACTAGGGCTGGAGGAATGG + Intergenic
1095785919 12:46109006-46109028 TCTGAGCTTGGTGGGAGTAAGGG - Intergenic
1096683757 12:53274315-53274337 CCTGACTTCGCTGTGATGAATGG + Intronic
1097145496 12:56936795-56936817 CCTCACCTTGGTGGCAGAAAGGG + Intergenic
1097362391 12:58672112-58672134 ACAGACTTTGGTGGGGGGAAGGG - Intronic
1097951845 12:65438691-65438713 TTTTACTTGGGTGGGAGGAAAGG + Intronic
1100249359 12:92800393-92800415 CATGACTTTGGTTGGAGGGTGGG - Intronic
1100729569 12:97449422-97449444 CCTGTCTTGGGGAGGAGGAAAGG - Intergenic
1101217782 12:102602259-102602281 GCTGACATTTGAGGGAGGAATGG - Intergenic
1102642598 12:114380095-114380117 CCTGAATCTGTTGGGAAGAAGGG - Intronic
1104022279 12:125001012-125001034 CCTCACTTTTGGTGGAGGAAGGG + Intronic
1105355114 13:19652730-19652752 CTTGAGCTTGGTGGGAGGAGGGG + Intronic
1105417766 13:20227920-20227942 CCTGACTTTGGTGGGTGGACAGG + Intronic
1105624939 13:22103548-22103570 CCAGACTTAAGTGGGAAGAATGG + Intergenic
1105704379 13:22960338-22960360 CCTGACTTTGCAGGCAGGGAAGG + Intergenic
1105857330 13:24385390-24385412 CCTGACTTTGCAGGCAGGGAAGG + Intergenic
1106298578 13:28440924-28440946 CCTGACATTCTTGGGAGGAGGGG - Intronic
1106568316 13:30905993-30906015 CCTGCCTATGGTGGGCGGCAGGG - Intergenic
1107093784 13:36512916-36512938 CCTAACATTGGTGGGGGGAGGGG + Intergenic
1108523790 13:51268026-51268048 CCTGCCTTGAGTGAGAGGAAGGG + Intronic
1113094695 13:106651331-106651353 TCTAAACTTGGTGGGAGGAAAGG - Intergenic
1115084021 14:29492230-29492252 CTTCTCCTTGGTGGGAGGAATGG + Intergenic
1115445369 14:33483797-33483819 GCTGACTTTGGGTGGAGAAAAGG - Intronic
1117333166 14:54734368-54734390 CCTGAATTTGGTGGCAGCAGTGG + Intronic
1117353922 14:54905652-54905674 CCTGCCTTTAGTGAGTGGAAGGG - Intergenic
1118486132 14:66215904-66215926 CCTGACTTTGGGGGAAGAGATGG + Intergenic
1119568400 14:75648245-75648267 CCTGTCTTAGGTGTGGGGAAGGG + Intronic
1119576660 14:75729566-75729588 GCTGGCATTGGTGGGGGGAATGG - Intronic
1122944327 14:104999075-104999097 CCTGGCATCTGTGGGAGGAAGGG - Intronic
1123067553 14:105626237-105626259 CCTGACTTTGGCTGGGGGCAGGG - Intergenic
1125314083 15:38412498-38412520 CCTGACTTGGATTGGAGGCAAGG + Intergenic
1126878910 15:53073355-53073377 CCAGACTTTGGAGGGAGGTAGGG + Intergenic
1129267786 15:74403299-74403321 CCCGACATTGATGGGAGGGACGG + Intergenic
1130355337 15:83124893-83124915 CCAGGCTTTGATGGGAGGAATGG - Intronic
1134758832 16:16695125-16695147 CCTGACTTAGCAGGGAAGAATGG + Intergenic
1134987243 16:18664046-18664068 CCTGACTTAGCAGGGAAGAATGG - Intergenic
1136157082 16:28390339-28390361 CCTAACTCTGGTGGAACGAATGG - Exonic
1136206004 16:28724942-28724964 CCTAACTCTGGTGGAACGAATGG + Exonic
1136511375 16:30739857-30739879 CCCTACTTTGGTGGGAAGAAGGG - Exonic
1138448931 16:57081432-57081454 CCTGACCTTGGCCTGAGGAAGGG + Intronic
1139320734 16:66111802-66111824 CATGAATTTGGTGGGTGGAGAGG + Intergenic
1139443294 16:66979755-66979777 GCTGACTTGGGTGGGGGGACTGG + Intergenic
1139563841 16:67760563-67760585 CCTGGCCTTTGTGGGAGGAGAGG - Intronic
1140910662 16:79448870-79448892 CCAGACCTTGGGGGGAGGCAGGG + Intergenic
1141672375 16:85499017-85499039 CCTGCATTTGGTGGAAGGCAGGG + Intergenic
1142494534 17:299354-299376 CCTGCCTTCCGTGGGAGGGAGGG - Intronic
1143844332 17:9762324-9762346 GCTGACTCTGAAGGGAGGAAGGG + Intergenic
1144178159 17:12728453-12728475 CCTGACTCAGGTGGGAAGACTGG - Intronic
1144776690 17:17788343-17788365 CCTGGCTTGAATGGGAGGAAGGG - Intronic
1144802179 17:17937206-17937228 CATCACTTCTGTGGGAGGAAGGG - Intronic
1145915326 17:28570779-28570801 GCTGAGTTGGGTGGGAGGAGCGG - Intronic
1146000761 17:29129010-29129032 CCTGGGATTGGTGGTAGGAATGG - Intronic
1146304929 17:31723624-31723646 CCTGACTGCGGGGGCAGGAAAGG - Intergenic
1147767937 17:42849383-42849405 CCTGGCCTGGGTGGAAGGAAAGG + Intronic
1147986825 17:44311815-44311837 CCTGGCTTCTTTGGGAGGAAGGG - Intronic
1148905970 17:50912276-50912298 CCTGACCTAGGAGGTAGGAAGGG + Intergenic
1149312998 17:55414092-55414114 CGGGGCTTTGGTGGGAGGAAGGG - Intronic
1151554676 17:74840683-74840705 CCTGACTCTGGGAGGAGGAGGGG + Intergenic
1152462370 17:80448357-80448379 GCTGGCTTGGGTGAGAGGAATGG + Intergenic
1153020097 18:621164-621186 TCTGACTGGGGTGGGGGGAATGG - Intronic
1153915565 18:9741570-9741592 CCTTTCTGTGCTGGGAGGAAGGG + Intronic
1153975787 18:10267547-10267569 CCTGACTTTGGTGTCAGGAGGGG + Intergenic
1154941039 18:21112658-21112680 GTTGACTGTGGTGTGAGGAAAGG + Intergenic
1157142239 18:45121051-45121073 CATGACTTGGGTGGTAAGAATGG - Intergenic
1158857415 18:61556770-61556792 CCTGCCTTTCATGGGAAGAAAGG - Intergenic
1158865269 18:61632421-61632443 CCTGCCGTTGGCGGGTGGAAGGG - Intergenic
1159490052 18:69120946-69120968 CATGACTTGGGTGGGAGGATGGG - Intergenic
1159913043 18:74164622-74164644 CTGGACCTTGGTGGGAGGACCGG - Intergenic
1160665802 19:327638-327660 TCTGGCTTTGGTGGGTGGAGGGG - Intronic
1162495778 19:11022669-11022691 CCTGTCTAAGGTGGGAAGAAGGG - Intronic
1163550635 19:17964732-17964754 ACTGACTCAGGTGGGAGGCAAGG + Intronic
1164048882 19:21567138-21567160 CCTGAGTTAGGCTGGAGGAATGG + Intergenic
1165979312 19:39706458-39706480 CCTGACTGTGGTAGGGTGAAAGG + Intronic
1167358789 19:49019146-49019168 CCTGGCGTGGGTGGCAGGAAGGG - Intergenic
1167366480 19:49057394-49057416 CCTGGCGTGGGTGGCAGGAAGGG - Exonic
926048719 2:9729466-9729488 ACTAACTTTGCTGGGAAGAAGGG - Intergenic
926953579 2:18270831-18270853 GCTGATTTTGGTGGGGGGAAGGG - Intronic
928024335 2:27727725-27727747 CCTCACTTTGCAGAGAGGAAAGG - Intergenic
928433528 2:31239292-31239314 CCTGGCCTTGGTGGGTGGACAGG - Intronic
929452071 2:42044685-42044707 TCTGACTTTGTGTGGAGGAATGG + Intergenic
930024332 2:47021157-47021179 CCTGGGTTGGATGGGAGGAAGGG + Intronic
930238245 2:48908611-48908633 CCTGCCTTGGCTGGGAGGGAAGG - Intergenic
931227857 2:60349530-60349552 CCTGACTTAGGAGGTAGTAATGG - Intergenic
931285974 2:60832038-60832060 CCATTTTTTGGTGGGAGGAATGG + Intergenic
931501535 2:62874455-62874477 CCTGTTTTTGGTGAGAGGACTGG - Exonic
934857202 2:97736841-97736863 CCTGAGTTGGGTGGGAGCTAGGG + Intronic
936867033 2:117086719-117086741 CCAGACTTTGAGGGGATGAAAGG - Intergenic
937253247 2:120537250-120537272 CCTGCCCTTGGTGGTAGGATGGG + Intergenic
939840617 2:147182807-147182829 CCTGAGCTTGGTCGGGGGAAGGG + Intergenic
942147145 2:173038143-173038165 CCTGCCTTTGGTGTGAGGGGTGG - Intronic
942151192 2:173076734-173076756 CCCGGCTCCGGTGGGAGGAAAGG - Intronic
942419588 2:175794474-175794496 CCTGTCTTTTGTGATAGGAATGG - Intergenic
943112341 2:183621797-183621819 CTTGAGTTTGGTGGGGGGAGGGG - Intergenic
943350720 2:186793302-186793324 CTTGAGTTTGGTGGGGGGAGGGG + Intergenic
947206157 2:227663055-227663077 CCTTACATTGGAGGGAGGACAGG - Intergenic
947492125 2:230603940-230603962 CTTGAGCTTGGTGGGAGGAGGGG + Intergenic
947499852 2:230664124-230664146 CCTGCCTTTGGGGGGTGGCAAGG - Intergenic
1170949591 20:20924727-20924749 GCTGCCTGTGGTGGGAGGAGGGG - Intergenic
1171433022 20:25097992-25098014 CAGGAATTTGGAGGGAGGAAGGG + Intergenic
1173105140 20:40126683-40126705 CGTGACTTTGGGGAGATGAAAGG - Intergenic
1174175069 20:48639476-48639498 CCTGACTTTGGAGGTTGAAAAGG - Intronic
1174568221 20:51482264-51482286 CTTGAATTTGGTGGCAGGCAGGG - Intronic
1174831843 20:53820515-53820537 CCTGACCTGGGTGAGAGGAGAGG - Intergenic
1177313241 21:19424462-19424484 CTTGAGCTTGGTGGGAGGAGCGG + Intergenic
1177892791 21:26826628-26826650 CATGGCTGTGGTGGGAGGTAGGG - Intergenic
1178085899 21:29111680-29111702 CCTAACTCTGGGGTGAGGAAAGG + Intronic
1178532843 21:33389664-33389686 CTGGACTGTGCTGGGAGGAATGG + Intergenic
1179195809 21:39161268-39161290 CCTCCCTTTAGCGGGAGGAAAGG + Intergenic
1180818020 22:18805126-18805148 CCTACCTTTGCTGGGAGGAGTGG - Intergenic
1181204238 22:21239581-21239603 CCTACCTTTGCTGGGAGGAGTGG - Intergenic
1182613802 22:31572058-31572080 ACTGACGTTGGTGGGAGCATGGG + Intronic
1182770239 22:32789865-32789887 CCCAGCTTGGGTGGGAGGAAAGG + Intronic
1183318339 22:37149035-37149057 CCTGGCTGTGGGGGAAGGAAGGG + Intronic
1183944288 22:41315926-41315948 CGTGAATTTGGGGGGATGAAGGG - Intronic
1183968805 22:41460363-41460385 ACTGATGTTGGGGGGAGGAAGGG + Exonic
1203222684 22_KI270731v1_random:55834-55856 CCTACCTTTGCTGGGAGGAGTGG + Intergenic
1203268145 22_KI270734v1_random:30980-31002 CCTACCTTTGCTGGGAGGAGTGG - Intergenic
949377660 3:3407867-3407889 CTTGAGCTTGGTGGGGGGAAGGG + Intergenic
950346910 3:12303795-12303817 TCTTGCTTTGGTGGGAGAAATGG + Intronic
953234671 3:41095715-41095737 AATGACTTTGGCAGGAGGAAAGG - Intergenic
954884054 3:53856590-53856612 GCTGAGTATGGTGGGAGGCACGG - Intronic
956117852 3:65936239-65936261 CAGGAATATGGTGGGAGGAAGGG + Intronic
958586251 3:96091489-96091511 CTTCAGTTTGGTGGGGGGAAGGG + Intergenic
959116998 3:102190445-102190467 GCCGACTTTGTTTGGAGGAATGG + Intronic
960071882 3:113440452-113440474 CATGAATTGGGTGAGAGGAACGG - Intronic
962705096 3:138035607-138035629 CCTGACTTTAGCTGAAGGAATGG - Intergenic
963598195 3:147354967-147354989 CGTGACTTTGGGGGGTGGGAGGG + Intergenic
966493730 3:180556590-180556612 CCTGAGTTTGGTGGGGGTAGGGG + Intergenic
967144018 3:186590748-186590770 GTTGACATTGGTGGGAGCAAAGG + Intronic
968114082 3:196075745-196075767 CATGATGTTGGTGGGAGCAAGGG + Intronic
969428612 4:7140010-7140032 CCAGCCTTTAGAGGGAGGAAGGG + Intergenic
969579435 4:8055539-8055561 CCTCACCTTCGTGGGAGCAAAGG - Intronic
970243617 4:14035235-14035257 CCTGACATTTGTGGGATGGAGGG + Intergenic
970861266 4:20705421-20705443 ACTGACTGTGGTGGTAGGTAGGG + Intronic
971347772 4:25827198-25827220 TATGAATTTGGTGGGAGGAGGGG - Intronic
975232301 4:71949087-71949109 CCTGAATGTGATGGGAAGAATGG + Intergenic
975826043 4:78320404-78320426 ACAGACTCTGGTGGGAGGAGAGG + Intronic
976655918 4:87488931-87488953 CTTGAGTTTGGTGGGGGGGAGGG - Intronic
976840302 4:89425058-89425080 CCTCAATTTGGGGGTAGGAAGGG + Intergenic
977986185 4:103385694-103385716 CTAGAGTTTGGTGGGAGGAGGGG + Intergenic
978096410 4:104784379-104784401 TCTAACTTTGGTGGCAGAAAGGG - Intergenic
978342382 4:107732282-107732304 CCTGAATATGGTAGCAGGAATGG + Intergenic
978649578 4:110984396-110984418 CTTGATATTGGTGGGAGGATGGG - Intergenic
978893189 4:113853670-113853692 CCTGAAAGTGGTGGGAAGAATGG + Intergenic
979856973 4:125646045-125646067 CCTGCCTGGGGTTGGAGGAATGG - Intergenic
980189211 4:129501957-129501979 CCTGACTTTAGTGTGGAGAATGG + Intergenic
982291068 4:153783240-153783262 CCTCACCATGGTGGGAGAAATGG + Intronic
982323882 4:154109080-154109102 CTTGAGGTTGGTGGGGGGAAGGG + Intergenic
982925289 4:161329657-161329679 CATGACTTTTGTGGCAGGAATGG + Intergenic
986037870 5:3958533-3958555 CCTGACTGTGATGGGAGAAGCGG - Intergenic
986809415 5:11340003-11340025 CCTGATTTGGGTGGGTGGACAGG + Intronic
987687598 5:21225555-21225577 CTGAAGTTTGGTGGGAGGAAGGG + Intergenic
990510005 5:56481218-56481240 GTTGACTTTGGTGGGGGGACAGG + Intronic
990897587 5:60715756-60715778 CTTGAGCTTGGTGGGAGGAGGGG - Intergenic
991337768 5:65568548-65568570 CCTGGCTGTGGTGAGATGAATGG + Intronic
991397745 5:66222688-66222710 CTTGAGCTTGGTGGGGGGAAGGG - Intergenic
992369304 5:76126524-76126546 CCTGACTTGGGAGGGAGGTGTGG + Intronic
993809491 5:92458186-92458208 CCTGAGTTTGGGGGTAGGAAAGG - Intergenic
995024434 5:107402855-107402877 CGTAACCTTTGTGGGAGGAAAGG + Intronic
995100539 5:108296592-108296614 CCTCACTTTGATGTCAGGAATGG + Intronic
996592274 5:125160978-125161000 CCTGAGTTTGGTGAGGGGAGGGG + Intergenic
996762696 5:127002332-127002354 CCAGACTTAAGTGGTAGGAAAGG - Intronic
997402323 5:133612360-133612382 CCGGACTTGGGCGGGAGGGAGGG + Exonic
997507186 5:134426725-134426747 CTTGACTGTGGTGGGAAGAAAGG - Intergenic
997522729 5:134533617-134533639 CCTGACATCGGTGGGTGGAGTGG - Intronic
997560448 5:134841788-134841810 CCTGACTTTGGGGGAGGGGATGG + Intronic
998108987 5:139486714-139486736 CCTGAGTTTGGAAGGAGGATGGG + Intergenic
1001949376 5:175805656-175805678 TCTGACTGTGCTGGAAGGAAAGG - Intronic
1002578178 5:180190021-180190043 TTTGCCTTTGGTGGGAAGAATGG - Intronic
1005825146 6:29627894-29627916 CCTGATTTTGTGGGGAGGAGGGG + Intronic
1006358551 6:33574714-33574736 CCTAACTCTGGTGGTAGCAATGG + Intronic
1007173357 6:39879577-39879599 CCTTTCTTTGGTGGGGGGTAAGG + Intronic
1007404914 6:41629631-41629653 CCTGGCCTTGGGGGGAGGCAGGG - Intergenic
1008086296 6:47248398-47248420 CTTGGCTAGGGTGGGAGGAAAGG - Intronic
1012537197 6:100313274-100313296 CCTGACTTTGAAGGGTGGATAGG - Intergenic
1012772430 6:103456100-103456122 GATGACTTTGGTGGGAGGTGTGG - Intergenic
1014560085 6:122879455-122879477 CCTGTCAGTGGTGGGGGGAAGGG - Intergenic
1014619567 6:123648997-123649019 CTTGTCTTTGGTGGGAGAATTGG - Intergenic
1014663592 6:124205993-124206015 CCTGATTTTGATGGGAGAAATGG + Intronic
1015120143 6:129692259-129692281 CCTGCCTTTGAGGAGAGGAAAGG - Intronic
1015541700 6:134320709-134320731 CCTTAATTTGGAGGGGGGAAGGG + Intergenic
1016234656 6:141848774-141848796 CCTGACTTTGGAGGGATGTGGGG - Intergenic
1017106737 6:150895105-150895127 CCTGCGTTTGGGTGGAGGAAAGG - Intronic
1017530052 6:155280781-155280803 CTTGAGTTTGGTGGGTGGATGGG - Intronic
1019845584 7:3496851-3496873 CCTAACTGTGGTGGGGGGAAAGG - Intronic
1021838406 7:24703100-24703122 CCAGACTCTGGGGGAAGGAAAGG + Intronic
1022399624 7:30024819-30024841 GCTGACTTTGGTGGTAGCCATGG - Intronic
1025637774 7:63338711-63338733 CCTGACATTGATGGGGAGAATGG - Intergenic
1025644923 7:63409388-63409410 CCTGACATTGATGGGGAGAATGG + Intergenic
1026762217 7:73135311-73135333 CCTGACTTATGAAGGAGGAAAGG - Intergenic
1026867079 7:73830622-73830644 CCAGGCTTAGGTGGGAGGACAGG - Exonic
1027085007 7:75257374-75257396 CCTGACTTATGAAGGAGGAAAGG + Intergenic
1027177260 7:75912575-75912597 CCTGACTTTTTTGGGGGGGATGG - Intronic
1027658019 7:80955455-80955477 CCTCTCTTTGGGGAGAGGAAAGG - Intergenic
1028147815 7:87337826-87337848 CCTGAATTGGATGGGAGGAGTGG - Intergenic
1032834658 7:135662078-135662100 CTGGACTTTGCGGGGAGGAAAGG - Intergenic
1034324460 7:150218035-150218057 TACGACTTTGGTGGAAGGAAAGG - Intergenic
1034339669 7:150343676-150343698 CCTGACTTTGGTGGGGGCTGGGG + Intergenic
1034768734 7:153751196-153751218 TACGACTTTGGTGGAAGGAAAGG + Intergenic
1035331425 7:158099243-158099265 CCGGGATGTGGTGGGAGGAAGGG - Intronic
1035331627 7:158099738-158099760 CCGGGATGTGGTGGGAGGAAGGG - Intronic
1035404682 7:158589209-158589231 CCTGACTTTGTAGGAGGGAAGGG - Intergenic
1039420203 8:37431480-37431502 GCTGAATTTCGTGGGAGGACAGG - Intergenic
1039551272 8:38444811-38444833 ACTGACTTTGCTGAGAGTAAGGG - Intronic
1040448419 8:47520021-47520043 CCTGAATCCTGTGGGAGGAAAGG + Intronic
1041222128 8:55662512-55662534 CCTGAGGTTGGAGGAAGGAAAGG - Intergenic
1045326748 8:101122935-101122957 CATGAATTTGGAGGGAGTAAGGG + Intergenic
1046601427 8:116321406-116321428 TCTTGCTTTGGAGGGAGGAAGGG + Intergenic
1047236616 8:123047425-123047447 TTTGACTTGAGTGGGAGGAAGGG - Intronic
1048191217 8:132291113-132291135 CCAGACTAGGGTGGGAGGAAAGG + Intronic
1049433478 8:142575802-142575824 CCTCCCTTTGGTTGGAGGACTGG + Intergenic
1049787872 8:144459751-144459773 CCTGACTCTGGTGAGAAGAGGGG - Intronic
1050636415 9:7617503-7617525 GGTGGCTGTGGTGGGAGGAATGG + Intergenic
1051256262 9:15216927-15216949 CCTAGTTTTGGTGGGAGGCAGGG + Intronic
1051778444 9:20661425-20661447 CCTGACTTGGTTGTGAGGAGTGG + Intronic
1052849374 9:33367328-33367350 CCTGGCATAGGTGGGTGGAAGGG + Intronic
1052915875 9:33924030-33924052 CCTTTCTCTGGTTGGAGGAAGGG - Intronic
1054948090 9:70818467-70818489 GCTGACTTTGGGGAGAGGCAAGG - Intronic
1054982521 9:71223108-71223130 CCTGGGTTTGGGGGGAGGAGTGG - Intronic
1055894814 9:81162711-81162733 CTCGAGTTTGGTGGGAGGAGGGG + Intergenic
1056200721 9:84273573-84273595 CCTGATTTTGCTAAGAGGAAGGG + Intergenic
1057507471 9:95647781-95647803 CCTGACACTGGTGAGAGGCAGGG - Intergenic
1057815001 9:98287668-98287690 CCTGATTTTGGGGTAAGGAAGGG - Intergenic
1060587617 9:124796174-124796196 CCCAACTTTGGGGTGAGGAAGGG - Intronic
1060803952 9:126563380-126563402 CCTGGCTTTGGTGAGGGGCAGGG + Intergenic
1060990229 9:127844847-127844869 CCTCAAGGTGGTGGGAGGAATGG + Intronic
1061074222 9:128331408-128331430 CCTCTCTGTGGTGGGGGGAAGGG + Intronic
1062697081 9:137880972-137880994 GCTGGCTTAGGTGGGAGGGATGG - Intronic
1186372417 X:8960644-8960666 CCTCACTTTGGAGAGTGGAATGG + Intergenic
1189069265 X:37847197-37847219 CCTGACTTGGGTGCGAGGAGTGG - Intronic
1189155217 X:38750004-38750026 CCTACCTTGGTTGGGAGGAAGGG - Intergenic
1190901048 X:54673329-54673351 TCTGATATTGGTGTGAGGAAGGG - Intergenic
1191119746 X:56890921-56890943 CTTGAGCTTGGTGGGGGGAATGG + Intergenic
1191601767 X:63016749-63016771 CTTGAGCTTGGTGGGGGGAAGGG - Intergenic
1191787749 X:64935127-64935149 CTCGAGTTTGGTGGGAGGAGGGG + Intronic
1194905767 X:99575006-99575028 CTTGACTTTGGTGTGTGTAATGG - Intergenic
1195810626 X:108825057-108825079 CTTGAGTTTGGTGGGGAGAAGGG - Intergenic
1196006039 X:110838244-110838266 CCTGGCTGTGATGGGAGGGAAGG + Intergenic
1196657416 X:118232987-118233009 CCTGTTTATGGTGTGAGGAATGG - Intergenic
1197095679 X:122591855-122591877 TGTGACTGTGGTAGGAGGAAGGG + Intergenic
1197729726 X:129799246-129799268 CCTGACTTGGGAGGGGGGAAGGG - Intergenic
1198169479 X:134091587-134091609 CCTGACCAAGGTGGGAAGAAGGG + Intergenic
1198259263 X:134951382-134951404 CTGGAGTTTGGTGGGGGGAAGGG + Intergenic
1198308362 X:135404775-135404797 TATGAATTTGGTGGGGGGAATGG + Intergenic
1198880842 X:141279442-141279464 CATGACTTTAGTGTCAGGAAGGG + Intergenic
1200035015 X:153321308-153321330 TCTGGCTTTCGGGGGAGGAAGGG - Intergenic
1200127365 X:153822333-153822355 CCTGAGGTGGGTGGGAGGATGGG - Intronic
1200808575 Y:7458888-7458910 GCTGGCTTTCATGGGAGGAATGG + Intergenic
1200819213 Y:7564922-7564944 CCTCACTTTGCTGGTATGAACGG - Intergenic