ID: 924616721

View in Genome Browser
Species Human (GRCh38)
Location 1:245618033-245618055
Sequence GTAACCCTGACTTTGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 91}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924616721_924616731 4 Left 924616721 1:245618033-245618055 CCTCCCACCAAAGTCAGGGTTAC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 924616731 1:245618060-245618082 GGAAGAGAAGGAGGCAGGGAGGG 0: 1
1: 30
2: 529
3: 5285
4: 21846
924616721_924616735 19 Left 924616721 1:245618033-245618055 CCTCCCACCAAAGTCAGGGTTAC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 924616735 1:245618075-245618097 AGGGAGGGAGGGAAAAGGAAAGG 0: 3
1: 38
2: 295
3: 1773
4: 9203
924616721_924616726 -8 Left 924616721 1:245618033-245618055 CCTCCCACCAAAGTCAGGGTTAC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 924616726 1:245618048-245618070 AGGGTTACAGAAGGAAGAGAAGG 0: 1
1: 0
2: 4
3: 81
4: 724
924616721_924616728 -1 Left 924616721 1:245618033-245618055 CCTCCCACCAAAGTCAGGGTTAC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG 0: 1
1: 1
2: 23
3: 442
4: 3704
924616721_924616732 7 Left 924616721 1:245618033-245618055 CCTCCCACCAAAGTCAGGGTTAC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 924616732 1:245618063-245618085 AGAGAAGGAGGCAGGGAGGGAGG 0: 1
1: 92
2: 1497
3: 10735
4: 23782
924616721_924616734 14 Left 924616721 1:245618033-245618055 CCTCCCACCAAAGTCAGGGTTAC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 924616734 1:245618070-245618092 GAGGCAGGGAGGGAGGGAAAAGG 0: 1
1: 41
2: 344
3: 1567
4: 5665
924616721_924616736 24 Left 924616721 1:245618033-245618055 CCTCCCACCAAAGTCAGGGTTAC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 924616736 1:245618080-245618102 GGGAGGGAAAAGGAAAGGAAAGG 0: 3
1: 21
2: 285
3: 1940
4: 11865
924616721_924616729 0 Left 924616721 1:245618033-245618055 CCTCCCACCAAAGTCAGGGTTAC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 924616729 1:245618056-245618078 AGAAGGAAGAGAAGGAGGCAGGG 0: 1
1: 8
2: 149
3: 1648
4: 10183
924616721_924616730 3 Left 924616721 1:245618033-245618055 CCTCCCACCAAAGTCAGGGTTAC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 924616730 1:245618059-245618081 AGGAAGAGAAGGAGGCAGGGAGG 0: 1
1: 25
2: 489
3: 5252
4: 20607
924616721_924616733 8 Left 924616721 1:245618033-245618055 CCTCCCACCAAAGTCAGGGTTAC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 924616733 1:245618064-245618086 GAGAAGGAGGCAGGGAGGGAGGG 0: 2
1: 103
2: 1594
3: 11298
4: 25680
924616721_924616727 -5 Left 924616721 1:245618033-245618055 CCTCCCACCAAAGTCAGGGTTAC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 924616727 1:245618051-245618073 GTTACAGAAGGAAGAGAAGGAGG 0: 1
1: 0
2: 9
3: 96
4: 932

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924616721 Original CRISPR GTAACCCTGACTTTGGTGGG AGG (reversed) Intronic
900208963 1:1444225-1444247 GGAGCCCTGCTTTTGGTGGGTGG + Intergenic
911544969 1:99205584-99205606 GTAACTCTGACCATGGTGGTTGG + Intergenic
914340654 1:146757053-146757075 TCAACCCTGCCTTTGGAGGGTGG + Intergenic
920799520 1:209173738-209173760 GGAACCCTGGCCATGGTGGGTGG + Intergenic
922795036 1:228335630-228335652 GTCACCCTGACAGTGATGGGAGG - Intronic
924616721 1:245618033-245618055 GTAACCCTGACTTTGGTGGGAGG - Intronic
1066663085 10:37755550-37755572 GTAAATCTGACTCTGATGGGTGG + Intergenic
1067030391 10:42875651-42875673 GTAACACTGACTCTGGGAGGTGG + Intergenic
1067789097 10:49274065-49274087 GTACCTCTTACTTTTGTGGGAGG + Intergenic
1069243121 10:66166910-66166932 GGAAGCTTGAGTTTGGTGGGAGG + Intronic
1071083603 10:81841814-81841836 GTAAGCCTGACTTTGTCTGGGGG - Intergenic
1073959000 10:108904525-108904547 GTGACCCTGAAGTTGGTGGGTGG - Intergenic
1080962626 11:37178288-37178310 GTAAAGCTGTCTTTTGTGGGGGG + Intergenic
1082117281 11:48341211-48341233 GTCACCCTATTTTTGGTGGGGGG - Intergenic
1083800271 11:65042414-65042436 GTAACCCTGACTGGGCGGGGAGG - Intronic
1087331075 11:96781348-96781370 GTAACACTGAGTATGGTGGAGGG + Intergenic
1088952044 11:114581698-114581720 GTACTCCTGTGTTTGGTGGGTGG - Intronic
1089772373 11:120812886-120812908 CAAAACCTGAATTTGGTGGGTGG + Intronic
1090545678 11:127764782-127764804 GGAACCCTGACTTCTCTGGGTGG - Intergenic
1090666483 11:128918182-128918204 GTAACTCTGCCTGTGGAGGGAGG - Exonic
1092020439 12:5198046-5198068 GTAACCCTGACAGTGAAGGGTGG - Intergenic
1092684215 12:11023525-11023547 GTCACCCTGCCTGAGGTGGGAGG - Intronic
1092686283 12:11050713-11050735 GTCACCCTGCCTGTGGTGGGAGG - Intronic
1092688517 12:11079202-11079224 GTCACCCTGCCTGTGGTGGGAGG - Intronic
1093626702 12:21357977-21357999 CTTACTCAGACTTTGGTGGGTGG + Intronic
1097239452 12:57565046-57565068 GTGACCCTGAAGTTGGAGGGTGG + Intronic
1100249362 12:92800398-92800420 GAAAACATGACTTTGGTTGGAGG - Intronic
1102152661 12:110699414-110699436 GAAACCCTGGCTTGGGTGGGGGG - Intronic
1103942634 12:124509219-124509241 GTGGCACTGGCTTTGGTGGGGGG + Intronic
1106419871 13:29577300-29577322 CTAACCCTGACCTAGTTGGGTGG - Intronic
1111816267 13:93157073-93157095 GTAACCCTGCTTTTCCTGGGTGG - Intergenic
1119639515 14:76304279-76304301 GTACCCCCCACTTGGGTGGGGGG + Intergenic
1124069677 15:26379789-26379811 GTAACCCTGAATTATCTGGGTGG - Intergenic
1124702348 15:31927113-31927135 CTAACCTTGACATTGGTGTGGGG + Intergenic
1127275704 15:57441728-57441750 GTAAGACAGACTTTAGTGGGAGG + Intronic
1131341704 15:91608615-91608637 GTAAAACTGACCATGGTGGGGGG - Intergenic
1131821362 15:96277666-96277688 GCAACCCTGACTTTGCTGCCAGG + Intergenic
1133946356 16:10352033-10352055 CTAACTCTTACTTTTGTGGGAGG - Intronic
1139287301 16:65827080-65827102 GTAATCCTGAATTTGTTGGGGGG - Intergenic
1139993631 16:70960353-70960375 TCAACCCTGCCTTTGGAGGGTGG - Intronic
1144955792 17:19018214-19018236 GGAACCCTGGCTGTGGTGGCAGG - Intronic
1144956543 17:19021575-19021597 GGAACCCTGGCCATGGTGGGTGG - Exonic
1145014951 17:19390649-19390671 CTAACTCTGACTTTGTTGGGAGG + Intergenic
1145777936 17:27542445-27542467 CTAACCCTGACTTTGGTCGTTGG - Intronic
1147744898 17:42688968-42688990 GTCAACCTGACTCTGGTGGAGGG + Exonic
1151378732 17:73710233-73710255 GTGACACAGGCTTTGGTGGGTGG + Intergenic
1154427778 18:14285161-14285183 GTAATCCTGACTGTTGTAGGTGG + Intergenic
1157244352 18:46040321-46040343 GTGACCCTGACTTACTTGGGTGG - Intronic
1157520445 18:48341878-48341900 GAAACCCTGCCGTTGGTGGGGGG + Intronic
1159091137 18:63850812-63850834 GTCACCCTGACTGTGGAGGAGGG - Intergenic
1160665805 19:327643-327665 GTCATTCTGGCTTTGGTGGGTGG - Intronic
926859935 2:17299069-17299091 GTCACCCTGGCTATGATGGGGGG - Intergenic
935497119 2:103794828-103794850 GCAACAGTGACCTTGGTGGGGGG + Intergenic
937288521 2:120767965-120767987 GCAGCACTGACTGTGGTGGGGGG - Intronic
941107370 2:161371201-161371223 GTCACCCTGGCTTTGGTTGTTGG + Exonic
947104141 2:226650544-226650566 TAAACGCTGACTTTGTTGGGGGG - Intergenic
948756408 2:240162093-240162115 GTAACCCTGGATTAGTTGGGTGG + Intergenic
1170404350 20:16020405-16020427 CTAACCCTGTCTTGGGTGGAGGG - Intronic
1175500106 20:59444125-59444147 GTGACCCTGACTGTGCTAGGAGG + Intergenic
1176250506 20:64118049-64118071 GTCACCCTGATGTTGGGGGGGGG + Intergenic
1181661329 22:24351343-24351365 GTTACCTTGGCTTTTGTGGGTGG + Intronic
1183120855 22:35728955-35728977 GTAACCCCTCCTTGGGTGGGTGG + Intronic
1184766226 22:46573904-46573926 GGAGCCCTGAGCTTGGTGGGTGG - Intergenic
949123508 3:417424-417446 GTATCCTTGACTTAGGTGGTAGG + Intergenic
952758046 3:36889675-36889697 CTAAACTTGATTTTGGTGGGTGG - Intronic
960869691 3:122236193-122236215 CTAACCCTGACTTTGATGCTGGG - Intronic
962697568 3:137965525-137965547 TTAACGTGGACTTTGGTGGGGGG - Intergenic
968486398 4:865090-865112 GGAGCCCTGTCCTTGGTGGGTGG + Intronic
968827322 4:2908618-2908640 GTGTCTCTGACTTTAGTGGGTGG + Intronic
972407536 4:38761284-38761306 GGAACCCTGACTTTGGTTTTGGG - Intergenic
975828633 4:78345980-78346002 GCAATACTGACTTTGTTGGGAGG - Intronic
989821761 5:45801115-45801137 GTCACCCAGAATTTGGTGAGCGG - Intergenic
993968946 5:94393265-94393287 GTGACCCTGACTTGGCTGGCTGG - Intronic
994965861 5:106670047-106670069 GTGGCCCTGACTATGGTGAGAGG - Intergenic
998390802 5:141785941-141785963 GTACACCTGACTGTGGTTGGAGG - Intergenic
1000029420 5:157389435-157389457 GTAACCCTGCCTTCTCTGGGGGG - Intronic
1002075823 5:176707842-176707864 GTACCCCTGACCCTGGTGGAGGG + Intergenic
1007977005 6:46112175-46112197 GCAAAGCTGTCTTTGGTGGGCGG + Intergenic
1008113585 6:47520587-47520609 GTAACCATGCCTCTGGTGGGTGG + Intronic
1013405269 6:109837729-109837751 GACACCCTGACTTTGGGAGGAGG + Intergenic
1013490577 6:110642767-110642789 GAAACCCTGTCTTTGATAGGAGG + Intronic
1014824154 6:126029312-126029334 ATAACCTTGACCTTGGTGGCAGG - Intronic
1019015765 6:168878647-168878669 GGAATTCTGACTTGGGTGGGGGG - Intergenic
1021222670 7:17991650-17991672 GTAACCCTACCTTCTGTGGGCGG - Intergenic
1027254952 7:76425290-76425312 GGGGCCCTGGCTTTGGTGGGAGG + Intronic
1037315547 8:17595925-17595947 GGAACCCTGGCCATGGTGGGTGG - Intronic
1038021604 8:23555832-23555854 GTCACCCTGATGTTGGAGGGGGG - Intronic
1039773288 8:40710599-40710621 GAAACCCAGCCTTTTGTGGGGGG + Intronic
1047878511 8:129167415-129167437 GTAAACCTGTCTTAGGTTGGAGG + Intergenic
1048191215 8:132291108-132291130 GTAAGCCAGACTAGGGTGGGAGG + Intronic
1050622451 9:7468540-7468562 GTAGCCTTGGCTATGGTGGGAGG + Intergenic
1052030744 9:23625932-23625954 GGAGCCCTGGCTTTGTTGGGGGG - Intergenic
1053250749 9:36572489-36572511 GTATTCCTGTCTTTGCTGGGTGG + Intergenic
1060558995 9:124527444-124527466 GCATCCCTGACTTTGGCAGGAGG + Intronic
1060600551 9:124874575-124874597 GTAGCCCTAACTGAGGTGGGAGG + Intronic
1061503044 9:131014497-131014519 GTAATCCAGACTCTGGTGGAAGG - Intronic
1196868045 X:120087010-120087032 GTAACCCTGAATTTGCTAGAGGG - Intergenic
1200903733 Y:8460023-8460045 GTGACCCTTCGTTTGGTGGGGGG + Intergenic
1202263257 Y:22992036-22992058 GTAACCCTCGCTTTGGTGCTAGG - Intronic
1202416247 Y:24625777-24625799 GTAACCCTCGCTTTGGTGCTAGG - Intronic
1202454540 Y:25044309-25044331 GTAACCCTCGCTTTGGTGCTAGG + Intronic