ID: 924616722

View in Genome Browser
Species Human (GRCh38)
Location 1:245618036-245618058
Sequence TCTGTAACCCTGACTTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924616722_924616733 5 Left 924616722 1:245618036-245618058 CCCACCAAAGTCAGGGTTACAGA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 924616733 1:245618064-245618086 GAGAAGGAGGCAGGGAGGGAGGG 0: 2
1: 103
2: 1594
3: 11298
4: 25680
924616722_924616731 1 Left 924616722 1:245618036-245618058 CCCACCAAAGTCAGGGTTACAGA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 924616731 1:245618060-245618082 GGAAGAGAAGGAGGCAGGGAGGG 0: 1
1: 30
2: 529
3: 5285
4: 21846
924616722_924616734 11 Left 924616722 1:245618036-245618058 CCCACCAAAGTCAGGGTTACAGA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 924616734 1:245618070-245618092 GAGGCAGGGAGGGAGGGAAAAGG 0: 1
1: 41
2: 344
3: 1567
4: 5665
924616722_924616735 16 Left 924616722 1:245618036-245618058 CCCACCAAAGTCAGGGTTACAGA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 924616735 1:245618075-245618097 AGGGAGGGAGGGAAAAGGAAAGG 0: 3
1: 38
2: 295
3: 1773
4: 9203
924616722_924616727 -8 Left 924616722 1:245618036-245618058 CCCACCAAAGTCAGGGTTACAGA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 924616727 1:245618051-245618073 GTTACAGAAGGAAGAGAAGGAGG 0: 1
1: 0
2: 9
3: 96
4: 932
924616722_924616730 0 Left 924616722 1:245618036-245618058 CCCACCAAAGTCAGGGTTACAGA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 924616730 1:245618059-245618081 AGGAAGAGAAGGAGGCAGGGAGG 0: 1
1: 25
2: 489
3: 5252
4: 20607
924616722_924616729 -3 Left 924616722 1:245618036-245618058 CCCACCAAAGTCAGGGTTACAGA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 924616729 1:245618056-245618078 AGAAGGAAGAGAAGGAGGCAGGG 0: 1
1: 8
2: 149
3: 1648
4: 10183
924616722_924616728 -4 Left 924616722 1:245618036-245618058 CCCACCAAAGTCAGGGTTACAGA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG 0: 1
1: 1
2: 23
3: 442
4: 3704
924616722_924616736 21 Left 924616722 1:245618036-245618058 CCCACCAAAGTCAGGGTTACAGA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 924616736 1:245618080-245618102 GGGAGGGAAAAGGAAAGGAAAGG 0: 3
1: 21
2: 285
3: 1940
4: 11865
924616722_924616732 4 Left 924616722 1:245618036-245618058 CCCACCAAAGTCAGGGTTACAGA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 924616732 1:245618063-245618085 AGAGAAGGAGGCAGGGAGGGAGG 0: 1
1: 92
2: 1497
3: 10735
4: 23782

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924616722 Original CRISPR TCTGTAACCCTGACTTTGGT GGG (reversed) Intronic
900568959 1:3349003-3349025 TCTGTGCTCCTGCCTTTGGTGGG + Intronic
901254076 1:7805772-7805794 TCTTTAACCCTGACTGGGGCTGG - Intronic
901923015 1:12549342-12549364 TCTGTCATCCTGGCTTTGGGCGG + Intergenic
904808310 1:33146961-33146983 TCTGTAGCTCTGACCTTGATAGG - Exonic
905123192 1:35698226-35698248 CCTGTAATCCTAACTTTGGGAGG - Intergenic
905783268 1:40731429-40731451 CCTGTAACCCCAACTTTGGGAGG - Intronic
907240204 1:53077068-53077090 TCTGTACCCTTGAGTTTGGATGG + Intronic
907660744 1:56390411-56390433 TCTGAGACCCTGACTTTCTTAGG + Intergenic
908513784 1:64871929-64871951 GCTTTAACCCTGAGTGTGGTGGG - Intronic
909131720 1:71745462-71745484 TATAGAGCCCTGACTTTGGTGGG + Intronic
910658512 1:89644007-89644029 TCTCTAACCCTTAATTTAGTAGG - Intronic
915930288 1:160056429-160056451 TCTGTCTCCCTGTCTTTGCTCGG + Intronic
916870613 1:168910776-168910798 TCTGTTCCCCTGACTTGAGTTGG - Intergenic
918461306 1:184779564-184779586 TCTGTACCACTGACTCTGGAGGG + Intergenic
919430443 1:197485670-197485692 CCTGCAACCCTGAGTTTAGTCGG + Intergenic
920575702 1:207058749-207058771 CCTGTAATCCTCACTTTGGGAGG - Intronic
921898596 1:220426738-220426760 TCTGTTACTCTGACTATAGTTGG + Intergenic
923250942 1:232179174-232179196 ACTGTTACTCTGACCTTGGTGGG + Intergenic
924616722 1:245618036-245618058 TCTGTAACCCTGACTTTGGTGGG - Intronic
1065872288 10:29965827-29965849 TCAGCAACTCTGACTTTTGTGGG - Intergenic
1066113000 10:32213837-32213859 TCTGTAACCAGCACTTTGGGAGG - Intergenic
1069901165 10:71707373-71707395 TCTGTCACCCAGACTTGGGGCGG - Intronic
1074069618 10:110052820-110052842 TCTGCAACCCTGTCTTTGAATGG - Intronic
1075604645 10:123795780-123795802 AGTGTAACCCTGACTTTGTGAGG + Intronic
1079559904 11:21809055-21809077 TCTGTAACTCAGACTTAGGGAGG + Intergenic
1081344948 11:41973874-41973896 TCCCTCACCCTGCCTTTGGTTGG + Intergenic
1081397297 11:42601756-42601778 TCTCTATGCCTGACTCTGGTAGG - Intergenic
1084136680 11:67188532-67188554 TCTGTAATCCCAACTTTGGGAGG + Intronic
1090355694 11:126139139-126139161 TCTTTAACCCATAATTTGGTGGG + Intergenic
1090705473 11:129332462-129332484 TCTGTAACCATGAATTAAGTTGG - Intergenic
1092725423 12:11480800-11480822 TCAGTAACCCTGACTGTGGCTGG - Intronic
1093800676 12:23368025-23368047 TTAGCAACCCTGACTTTAGTAGG - Intergenic
1094775352 12:33720182-33720204 TCTGTTAACCTGTCTTTGTTTGG + Intergenic
1095199336 12:39364201-39364223 TCTATAACCATGACTTTGTTAGG + Intronic
1095484411 12:42670369-42670391 TGTGTAACCCCGGCTTTGCTAGG - Intergenic
1098608730 12:72427521-72427543 TTTGTATCCCTGGCTTTTGTTGG + Intronic
1101266005 12:103088518-103088540 TCTCTACCACTGATTTTGGTGGG - Intergenic
1101973870 12:109337757-109337779 TCTGGAACCCTGCTTTTGGGAGG + Intergenic
1102019615 12:109672959-109672981 TGTGTAACCCTGACCTTCATGGG + Intergenic
1107217301 13:37936211-37936233 TCTGTGTCCCTGATTTTTGTTGG - Intergenic
1107403574 13:40092503-40092525 TCAGTAACACTGAGTTTGGCAGG - Intergenic
1108080843 13:46733369-46733391 TCTATATCCCTGGCTTTGGTGGG + Intronic
1113789009 13:113017519-113017541 CCTGTAAACATGACTTTGTTTGG - Intronic
1118075977 14:62299652-62299674 TTTGTAACCTTGATTTTTGTGGG + Intergenic
1129706812 15:77799061-77799083 TGTGTGACCCTGACCCTGGTTGG - Intronic
1133701617 16:8314656-8314678 TCTGAAACCATGATTTTGGCAGG + Intergenic
1135048559 16:19173743-19173765 TCTGTACCCCTCATTTTGTTCGG + Intronic
1138807759 16:60111021-60111043 TCTGTAACCCCAAATTTGATTGG - Intergenic
1139150125 16:64372141-64372163 TCTGCAACCCTCAGTTTGCTGGG + Intergenic
1139382007 16:66538439-66538461 CCTGTGACCCAGACTCTGGTGGG - Intronic
1139458135 16:67099608-67099630 TCTGTAATCATGAGTTTGGTTGG + Exonic
1139571600 16:67816435-67816457 TCTGTGACCCTGACCCTCGTGGG + Intronic
1140200172 16:72888576-72888598 TCTGCAAGCCTGACTCTGGCTGG - Intronic
1150897046 17:69224077-69224099 TCTGGAGCTTTGACTTTGGTGGG - Intronic
1153378319 18:4406899-4406921 TCTGCAATGTTGACTTTGGTTGG + Intronic
1158568197 18:58573754-58573776 TTTGTAATCCTGACTTTCTTGGG - Intronic
1158588207 18:58758829-58758851 TCTGGAACTCTGAGCTTGGTGGG - Intergenic
1158848885 18:61474098-61474120 AGTGTAACACTGACTTTGGCAGG - Intronic
1159234864 18:65658625-65658647 CCTGTAACCCTAAATTTGGAAGG - Intergenic
1164960366 19:32423519-32423541 CCTGTAATCCTAACTTTGGGAGG - Intronic
1166091244 19:40510559-40510581 CCTGTAATCCTAACTTTGGGAGG - Intronic
1166817575 19:45555944-45555966 TCTTTAAACCAGACATTGGTAGG + Intronic
925533842 2:4894549-4894571 CCTGTAACCCCAACTTTGGGAGG - Intergenic
931749465 2:65317911-65317933 TCCGTAACCATGTCTTTGGAAGG + Intronic
934696820 2:96406008-96406030 TGTCCAACCCTGACTTTGGCAGG + Intergenic
935020059 2:99221706-99221728 TCTGTAACACTAAGTTGGGTTGG - Intronic
936526448 2:113244787-113244809 TCTGTTTCCCTCACTTGGGTAGG + Intronic
936526561 2:113245530-113245552 TCTGGAATCCTGACCTTGCTTGG + Intronic
936741297 2:115512354-115512376 TCTGTAATCCTCCCTTTGGGAGG - Intronic
937517106 2:122667818-122667840 TCACTAACCCTACCTTTGGTAGG + Intergenic
943781124 2:191825282-191825304 ACAGTGACCCTGACTTTGGAGGG - Intergenic
946615345 2:221503022-221503044 TCAGAAACCCTGACTTTAGCAGG + Intronic
947783897 2:232797270-232797292 CCTGTTACCCTGAAATTGGTTGG + Intronic
1170530242 20:17284036-17284058 CATGTAGCCCTGACTTTTGTGGG + Intronic
1174799404 20:53550588-53550610 TCTGTAATCCCAACTTTGGGAGG + Intergenic
1175910320 20:62402207-62402229 TCTGTGAGCATGACTTTGGATGG - Intronic
1177083675 21:16675023-16675045 TCTGTAAACCAGACTTTGTATGG + Intergenic
1178067179 21:28917708-28917730 CCTGTAATCCCTACTTTGGTAGG - Intergenic
1179408068 21:41141466-41141488 TCTGTGAACCTGACTTTCTTTGG - Intergenic
1181114759 22:20624635-20624657 GCTGTAGCCCTGATTTTGTTGGG - Intergenic
1181661328 22:24351340-24351362 TCTGTTACCTTGGCTTTTGTGGG + Intronic
1181925289 22:26353748-26353770 TCTGTAACTGTGACCTTGATTGG + Intronic
1181925298 22:26353851-26353873 TCTGTAACCGTGACCTTGATTGG + Intronic
1181925308 22:26353954-26353976 TCTGTAACCATGACCTTGATTGG + Intronic
1181925314 22:26354009-26354031 TCTGTAACTGTGACCTTGATTGG + Intronic
1181925320 22:26354064-26354086 TCTGTAACTGTGACCTTGATTGG + Intronic
1182687067 22:32129375-32129397 TCTGTAACCTCTACCTTGGTTGG - Intergenic
950934839 3:16828425-16828447 TCAGTTTCCCTGACTTGGGTGGG + Intronic
953025681 3:39143613-39143635 TCAGTGACTCTGACTTCGGTGGG - Exonic
953467313 3:43133816-43133838 TCTGCCTCCCTGAATTTGGTTGG - Intergenic
953503069 3:43456720-43456742 TCTGTGACCCTCCCTTTTGTAGG - Intronic
953548275 3:43880847-43880869 TCTGTGACCCAGACTTGGTTAGG - Intergenic
954535617 3:51357368-51357390 TCTGTAATCCTGATTATGGGAGG + Intronic
956552840 3:70480991-70481013 CCTGTAACTCTGTCTTTGATAGG - Intergenic
965174450 3:165313585-165313607 TCTGTAACTCTGAGTTTTGTAGG - Intergenic
968091579 3:195901347-195901369 TCTGGTACCCTGACCTTGGCAGG - Intronic
971170251 4:24226371-24226393 TCTGCACTCCTGACTTAGGTAGG + Intergenic
971730879 4:30378237-30378259 TCTGTGCACCTGAATTTGGTAGG - Intergenic
973985551 4:56348817-56348839 TCTGAAAGCTTGACTTGGGTTGG - Intronic
974354553 4:60795427-60795449 TCTGTAACCCAGGGTTTTGTTGG - Intergenic
974399281 4:61381043-61381065 TATGTAAGCCTGTCCTTGGTTGG + Intronic
977200308 4:94107190-94107212 TCTGTGACCGTGACTTTGTTTGG - Intergenic
980099366 4:128525674-128525696 TCTTTCGCCTTGACTTTGGTAGG + Intergenic
983031279 4:162804873-162804895 CATGTATCCCTGACTTAGGTAGG - Intergenic
983089121 4:163483654-163483676 TCTCTCTCCCTGACTTTGGATGG + Intergenic
984304198 4:177965997-177966019 TCTGTAACACTGCCTTTGTCTGG + Intronic
992139708 5:73783507-73783529 TCTGTAAAGTTCACTTTGGTGGG + Intronic
996873825 5:128219567-128219589 CCTGTATTCCTGAATTTGGTTGG + Intergenic
997549168 5:134737486-134737508 TCTGTAATCCTAACTTTGGGAGG - Intergenic
1004754340 6:18595689-18595711 TGTGTAACCCCGACTGTGCTGGG - Intergenic
1005103737 6:22200980-22201002 TCTGTAATCCTAGCTTTGGGAGG - Intergenic
1005836307 6:29712020-29712042 TCTGTAAGCCCCACTGTGGTAGG - Intergenic
1006998269 6:38283691-38283713 TCTCTTACCCTGGCTGTGGTAGG - Intronic
1008748724 6:54706479-54706501 GCTGTAACTCTGACTTGGATTGG + Intergenic
1010079114 6:71837197-71837219 TCAGTGACCCAGACTGTGGTTGG + Intergenic
1010146791 6:72679779-72679801 TCTGTAATCCCCACTTTGGGAGG + Intronic
1010521196 6:76839618-76839640 ACTGTAACCCTGACACTAGTTGG - Intergenic
1010753668 6:79642778-79642800 TCTGTCACCCCAAATTTGGTGGG + Intronic
1012214486 6:96564996-96565018 TCTGTAATCCTAGCTTTGGGAGG + Intronic
1012566906 6:100667578-100667600 ACTTTAACCTTGACTTTGTTTGG - Intronic
1018474899 6:164130540-164130562 TCCGTAGCACTGACCTTGGTTGG + Intergenic
1019102355 6:169641508-169641530 TCTAAAACCCTGACCTAGGTAGG - Intronic
1023072365 7:36448540-36448562 TCTGAAACCCTGACTTCCCTTGG - Intronic
1031045702 7:116885378-116885400 TCTGTGACCCAGTGTTTGGTGGG + Intronic
1033297840 7:140157394-140157416 CCTGTAACCCTGGCCTTGGGAGG + Intronic
1033782984 7:144694648-144694670 TCTATAATCCTGGCTTTGGGAGG - Intronic
1037358657 8:18049982-18050004 CCTGTAATCCTAACTTTGGCAGG - Intergenic
1040732702 8:50469387-50469409 TATGGAACCCTGACCGTGGTGGG - Intronic
1041700799 8:60787096-60787118 TGTGTAGCCCTGACTTCTGTAGG + Intronic
1047878510 8:129167412-129167434 ACTGTAAACCTGTCTTAGGTTGG + Intergenic
1056504655 9:87246730-87246752 TCTGTCATCCTAAATTTGGTTGG - Intergenic
1057403365 9:94744134-94744156 CCTGTAATCCAGACTTTGGGAGG + Intronic
1060560642 9:124539969-124539991 TCTGTAGCTCTCCCTTTGGTGGG + Intronic
1060580908 9:124745722-124745744 TCTGTAATCCTAGCTTTGGGAGG + Intronic
1185910072 X:3973022-3973044 TCTGGAACTCTGAAGTTGGTAGG - Intergenic
1188491890 X:30746660-30746682 TCTGTATCCATGCCTTTGATTGG + Intergenic
1190430898 X:50376984-50377006 TCTGTGAGCCTGACGTTTGTGGG + Intronic
1190495481 X:51024547-51024569 CCTGCAAACCTGACTTTTGTGGG - Intergenic
1192728588 X:73778749-73778771 TCTGTAGCCAGGACTGTGGTAGG + Intergenic
1198938397 X:141924840-141924862 TCGGTAAACGTGACCTTGGTAGG - Intergenic
1199867238 X:151863249-151863271 TCTGCAACCCTCACTGTGGCTGG - Intergenic
1200070798 X:153528087-153528109 TCTGGAACCCTGAGGTTGATGGG + Intronic
1201274155 Y:12283137-12283159 TGTATAACCCTTGCTTTGGTTGG + Intergenic