ID: 924616723

View in Genome Browser
Species Human (GRCh38)
Location 1:245618037-245618059
Sequence TTCTGTAACCCTGACTTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924616723_924616728 -5 Left 924616723 1:245618037-245618059 CCACCAAAGTCAGGGTTACAGAA No data
Right 924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG 0: 1
1: 1
2: 23
3: 442
4: 3704
924616723_924616733 4 Left 924616723 1:245618037-245618059 CCACCAAAGTCAGGGTTACAGAA No data
Right 924616733 1:245618064-245618086 GAGAAGGAGGCAGGGAGGGAGGG 0: 2
1: 103
2: 1594
3: 11298
4: 25680
924616723_924616736 20 Left 924616723 1:245618037-245618059 CCACCAAAGTCAGGGTTACAGAA No data
Right 924616736 1:245618080-245618102 GGGAGGGAAAAGGAAAGGAAAGG 0: 3
1: 21
2: 285
3: 1940
4: 11865
924616723_924616732 3 Left 924616723 1:245618037-245618059 CCACCAAAGTCAGGGTTACAGAA No data
Right 924616732 1:245618063-245618085 AGAGAAGGAGGCAGGGAGGGAGG 0: 1
1: 92
2: 1497
3: 10735
4: 23782
924616723_924616730 -1 Left 924616723 1:245618037-245618059 CCACCAAAGTCAGGGTTACAGAA No data
Right 924616730 1:245618059-245618081 AGGAAGAGAAGGAGGCAGGGAGG 0: 1
1: 25
2: 489
3: 5252
4: 20607
924616723_924616731 0 Left 924616723 1:245618037-245618059 CCACCAAAGTCAGGGTTACAGAA No data
Right 924616731 1:245618060-245618082 GGAAGAGAAGGAGGCAGGGAGGG 0: 1
1: 30
2: 529
3: 5285
4: 21846
924616723_924616735 15 Left 924616723 1:245618037-245618059 CCACCAAAGTCAGGGTTACAGAA No data
Right 924616735 1:245618075-245618097 AGGGAGGGAGGGAAAAGGAAAGG 0: 3
1: 38
2: 295
3: 1773
4: 9203
924616723_924616729 -4 Left 924616723 1:245618037-245618059 CCACCAAAGTCAGGGTTACAGAA No data
Right 924616729 1:245618056-245618078 AGAAGGAAGAGAAGGAGGCAGGG 0: 1
1: 8
2: 149
3: 1648
4: 10183
924616723_924616727 -9 Left 924616723 1:245618037-245618059 CCACCAAAGTCAGGGTTACAGAA No data
Right 924616727 1:245618051-245618073 GTTACAGAAGGAAGAGAAGGAGG 0: 1
1: 0
2: 9
3: 96
4: 932
924616723_924616734 10 Left 924616723 1:245618037-245618059 CCACCAAAGTCAGGGTTACAGAA No data
Right 924616734 1:245618070-245618092 GAGGCAGGGAGGGAGGGAAAAGG 0: 1
1: 41
2: 344
3: 1567
4: 5665

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924616723 Original CRISPR TTCTGTAACCCTGACTTTGG TGG (reversed) Intronic
No off target data available for this crispr