ID: 924616725

View in Genome Browser
Species Human (GRCh38)
Location 1:245618040-245618062
Sequence TCCTTCTGTAACCCTGACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 204}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924616725_924616731 -3 Left 924616725 1:245618040-245618062 CCAAAGTCAGGGTTACAGAAGGA 0: 1
1: 0
2: 0
3: 20
4: 204
Right 924616731 1:245618060-245618082 GGAAGAGAAGGAGGCAGGGAGGG 0: 1
1: 30
2: 529
3: 5285
4: 21846
924616725_924616735 12 Left 924616725 1:245618040-245618062 CCAAAGTCAGGGTTACAGAAGGA 0: 1
1: 0
2: 0
3: 20
4: 204
Right 924616735 1:245618075-245618097 AGGGAGGGAGGGAAAAGGAAAGG 0: 3
1: 38
2: 295
3: 1773
4: 9203
924616725_924616736 17 Left 924616725 1:245618040-245618062 CCAAAGTCAGGGTTACAGAAGGA 0: 1
1: 0
2: 0
3: 20
4: 204
Right 924616736 1:245618080-245618102 GGGAGGGAAAAGGAAAGGAAAGG 0: 3
1: 21
2: 285
3: 1940
4: 11865
924616725_924616728 -8 Left 924616725 1:245618040-245618062 CCAAAGTCAGGGTTACAGAAGGA 0: 1
1: 0
2: 0
3: 20
4: 204
Right 924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG 0: 1
1: 1
2: 23
3: 442
4: 3704
924616725_924616737 28 Left 924616725 1:245618040-245618062 CCAAAGTCAGGGTTACAGAAGGA 0: 1
1: 0
2: 0
3: 20
4: 204
Right 924616737 1:245618091-245618113 GGAAAGGAAAGGAACCACAATGG 0: 1
1: 0
2: 8
3: 77
4: 805
924616725_924616733 1 Left 924616725 1:245618040-245618062 CCAAAGTCAGGGTTACAGAAGGA 0: 1
1: 0
2: 0
3: 20
4: 204
Right 924616733 1:245618064-245618086 GAGAAGGAGGCAGGGAGGGAGGG 0: 2
1: 103
2: 1594
3: 11298
4: 25680
924616725_924616730 -4 Left 924616725 1:245618040-245618062 CCAAAGTCAGGGTTACAGAAGGA 0: 1
1: 0
2: 0
3: 20
4: 204
Right 924616730 1:245618059-245618081 AGGAAGAGAAGGAGGCAGGGAGG 0: 1
1: 25
2: 489
3: 5252
4: 20607
924616725_924616729 -7 Left 924616725 1:245618040-245618062 CCAAAGTCAGGGTTACAGAAGGA 0: 1
1: 0
2: 0
3: 20
4: 204
Right 924616729 1:245618056-245618078 AGAAGGAAGAGAAGGAGGCAGGG 0: 1
1: 8
2: 149
3: 1648
4: 10183
924616725_924616734 7 Left 924616725 1:245618040-245618062 CCAAAGTCAGGGTTACAGAAGGA 0: 1
1: 0
2: 0
3: 20
4: 204
Right 924616734 1:245618070-245618092 GAGGCAGGGAGGGAGGGAAAAGG 0: 1
1: 41
2: 344
3: 1567
4: 5665
924616725_924616732 0 Left 924616725 1:245618040-245618062 CCAAAGTCAGGGTTACAGAAGGA 0: 1
1: 0
2: 0
3: 20
4: 204
Right 924616732 1:245618063-245618085 AGAGAAGGAGGCAGGGAGGGAGG 0: 1
1: 92
2: 1497
3: 10735
4: 23782

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924616725 Original CRISPR TCCTTCTGTAACCCTGACTT TGG (reversed) Intronic
900738666 1:4316961-4316983 TACTTCTGTAGCCATTACTTTGG + Intergenic
902679440 1:18032712-18032734 CCCTTCTGTAATCCTTACTATGG + Intergenic
903762842 1:25711316-25711338 TCTCCCTGTAGCCCTGACTTTGG - Intronic
905080129 1:35311571-35311593 TCCCTCTGTCACCCAGACTAGGG - Intronic
907603954 1:55796999-55797021 TCCCTCTGTCACCCAGACTGAGG - Intergenic
907750635 1:57259775-57259797 AGCTTCTGCAACCCTGACATGGG + Intronic
908271350 1:62425469-62425491 TCCTTCCCTAAACCTGAGTTTGG - Intergenic
908820747 1:68083985-68084007 TCATTCTGTAATCCTGAGTGTGG + Intergenic
910720382 1:90279832-90279854 TCCTTCTGCAATCCTCACTAAGG - Intergenic
911391442 1:97249534-97249556 TATTTCTGTAACCCTGAATTAGG + Intronic
913126241 1:115793100-115793122 TCCTCCTCTAACGATGACTTTGG + Intergenic
913683031 1:121205004-121205026 TCCTTCTGTCACCCAGACTAGGG - Intronic
914034872 1:143992630-143992652 TCCTTCTGTCACCCAGACTAGGG - Intergenic
914154582 1:145075339-145075361 TCCTTCTGTCACCCAGACTAGGG + Intronic
914790030 1:150869443-150869465 TCCTTCTGTCACCCAGGCTGGGG - Intronic
915373581 1:155372640-155372662 TCCCTCTGTCACCCAGACTGGGG + Intronic
915951203 1:160190833-160190855 TGCCCCTGTACCCCTGACTTGGG - Exonic
919482977 1:198112005-198112027 TCATTCTGAACCCCTGTCTTGGG + Intergenic
920470341 1:206223518-206223540 TCCTTCTGTCACCCAGACTAGGG - Intronic
920690346 1:208141911-208141933 TCCTTCTGGGGCCCTGTCTTGGG + Intronic
920787688 1:209058257-209058279 CCCAACTGTGACCCTGACTTAGG - Intergenic
921159457 1:212462881-212462903 CCCCACTGAAACCCTGACTTTGG - Intergenic
924616725 1:245618040-245618062 TCCTTCTGTAACCCTGACTTTGG - Intronic
1064825639 10:19396167-19396189 TCGTTCTGTCACCCTGGCTGAGG + Intronic
1067448813 10:46368878-46368900 GGCTTCTGTAACCCTGTCCTAGG - Intergenic
1067588559 10:47491887-47491909 GGCTTCTGTAACCCTGTCCTAGG + Intergenic
1067635685 10:47999978-48000000 GGCTTCTGTAACCCTGTCCTAGG + Intergenic
1067877836 10:50020416-50020438 GACTTCTGTAACCCTGTCCTAGG - Intergenic
1067963899 10:50887640-50887662 TCCTGCTGGCACCCTGATTTTGG - Intergenic
1070897318 10:79995949-79995971 TCCTTCTGCAGGGCTGACTTTGG - Intergenic
1071609437 10:87020090-87020112 GGCTTCTGTAACCCTGTCCTAGG - Intergenic
1071884139 10:89931081-89931103 TCCTTCTGGAACCCTGATCTTGG + Intergenic
1072427924 10:95345689-95345711 TCCTTATGGAACCCAGTCTTTGG + Intronic
1073568458 10:104555774-104555796 TCCATTTGTAACCAAGACTTTGG + Intergenic
1075544260 10:123342635-123342657 TCCTTGTGTTGTCCTGACTTCGG - Intergenic
1075840864 10:125502110-125502132 TCCCTCTGTCACCCTGGCTGGGG + Intergenic
1076510003 10:131006591-131006613 TCCTGCTGGCACCCTGACCTAGG + Intergenic
1076537391 10:131188634-131188656 TTCTTCAGTAATACTGACTTGGG + Intronic
1078334786 11:10455088-10455110 GCTAGCTGTAACCCTGACTTGGG - Intronic
1078538948 11:12198258-12198280 TCTTACAGTAACCCTGAATTAGG - Intronic
1079323286 11:19470254-19470276 TCCTACTGGAACCCTGATCTAGG - Intronic
1079559902 11:21809051-21809073 TGCTTCTGTAACTCAGACTTAGG + Intergenic
1086077766 11:82872692-82872714 TCCTGCTGACACCCTGACTTTGG + Intronic
1087011533 11:93518784-93518806 TCCTACTGGAGCCCTGGCTTAGG - Intronic
1087074324 11:94115145-94115167 TATTTCTCTAACCCTGACCTTGG + Intergenic
1087283946 11:96243947-96243969 TCCTTCTTTAACCACGACATAGG + Intronic
1087514943 11:99146751-99146773 TCATTCTGTCACCCAGACTAGGG + Intronic
1088159983 11:106857201-106857223 CCCTTCTGGCACCCTGATTTTGG - Intronic
1088192934 11:107245693-107245715 TCCTACTACAGCCCTGACTTTGG + Intergenic
1088578308 11:111293854-111293876 TTCTTTTGTCACCTTGACTTTGG - Intergenic
1088868376 11:113870493-113870515 TCCCTCTGTCACCCAGACTGGGG - Intronic
1089145341 11:116325773-116325795 TGCTTGTGTACCCCTCACTTAGG + Intergenic
1093481056 12:19604193-19604215 ACTTTATGTAAGCCTGACTTAGG - Intronic
1094576529 12:31691356-31691378 CCCTTCTGTGACCCTCTCTTAGG - Intronic
1094819983 12:34216741-34216763 TCGTTCTGTAGCCCAGGCTTTGG - Intergenic
1095600652 12:44009620-44009642 TCCTTCTGGAACACTCGCTTTGG + Intronic
1096551330 12:52374684-52374706 TCCTTCTGTTAATCTGTCTTTGG + Intergenic
1097870219 12:64595757-64595779 TGCTTCTGAAACCCTCATTTTGG - Intergenic
1101483562 12:105128276-105128298 TCCCTCTTCAACCCTGATTTAGG - Intronic
1102277017 12:111590327-111590349 TCTTTTTGTAACCTTGATTTTGG - Intronic
1102775564 12:115515728-115515750 TCCTTCTGTCCCCCAGTCTTGGG - Intergenic
1102779278 12:115549732-115549754 TCCTTCTGTAACCTCATCTTGGG - Intergenic
1102943205 12:116962058-116962080 TCCTTCTGTACCAGTGACCTGGG + Intronic
1106451875 13:29889478-29889500 TCTTTATGTAACTCTGCCTTAGG - Intergenic
1106474788 13:30089314-30089336 TCCTTCTGTCACCCAGGCTGGGG + Intergenic
1107024352 13:35784665-35784687 TCCCTCTGTAACACAGAATTTGG - Intronic
1107153486 13:37139713-37139735 ACCTGCTGTCACCCTGACCTTGG - Intergenic
1109010035 13:56928641-56928663 TCACTCTGTCACCCTGACTGTGG - Intergenic
1109307411 13:60656001-60656023 TCATTCTGTCACCCAGACTGGGG - Intergenic
1110668186 13:78142845-78142867 ACTTTCTGAAACCCTGTCTTTGG - Intergenic
1111973408 13:94940665-94940687 CCCTTCTGGCACCTTGACTTTGG + Intergenic
1112261789 13:97884179-97884201 TCCTGCTGGAACCCTGACCAGGG - Intergenic
1112305633 13:98271071-98271093 CTCTTCTGTCATCCTGACTTGGG - Intronic
1112408705 13:99143566-99143588 TCCTGCTCTTAACCTGACTTTGG + Intergenic
1112941217 13:104864213-104864235 TCCTTCTGTACTCCTCATTTAGG + Intergenic
1116204707 14:41848878-41848900 GACTTCTGTAACCCTTGCTTTGG + Intronic
1118756488 14:68848460-68848482 TTATTCTGAAACCCTGACTGTGG - Intergenic
1124804189 15:32864498-32864520 TCCTTCTTTAACCTTGGTTTGGG + Intronic
1125487096 15:40119014-40119036 TCCTTCTGTCACCCAGGCTGGGG - Intergenic
1125525735 15:40373080-40373102 TGCCTCTCTAGCCCTGACTTTGG + Intergenic
1125952028 15:43760357-43760379 TCCTTCTGTCACCCAGGCTGGGG - Intronic
1126211003 15:46100117-46100139 GGCTTCTGTTACCATGACTTGGG + Intergenic
1127713083 15:61620641-61620663 TTGTTCTGTGACCCTGACCTAGG - Intergenic
1130017115 15:80196118-80196140 TCATTCTGTAAGCCTGAGGTGGG + Intergenic
1130077246 15:80699713-80699735 TCCTCCTGAAACCCTTACTCTGG - Intronic
1131716423 15:95115492-95115514 TCTTTCTTTATCCTTGACTTGGG - Intergenic
1133491119 16:6269396-6269418 TCCTTCAGTTAATCTGACTTGGG - Intronic
1133634314 16:7651513-7651535 TCCTTCTGCAACCCTCACCTGGG + Intronic
1135621154 16:23957033-23957055 TACTTCTGTAACCTTGAGTGAGG + Intronic
1138349349 16:56338257-56338279 CCCACCTGTACCCCTGACTTGGG + Intronic
1139773481 16:69297880-69297902 TCCTTCTGTCACCCAGGCTGGGG - Intronic
1140310647 16:73845001-73845023 TCCTTCTTTAGCCCTCATTTTGG - Intergenic
1141809832 16:86368429-86368451 CCCTGCTGGCACCCTGACTTTGG - Intergenic
1142770401 17:2092575-2092597 ATCTTCAGTAACCCTGTCTTGGG - Intronic
1148944981 17:51253774-51253796 TCCTACTGTAACTGTCACTTAGG + Intronic
1150064209 17:62095254-62095276 TCCTTCTGGAACCCACAGTTAGG + Intergenic
1153301510 18:3596009-3596031 TAATTCTGTAACCCTGACCTTGG - Intronic
1153741555 18:8134923-8134945 TCCTTCTCTTTCACTGACTTAGG + Intronic
1153771217 18:8417870-8417892 TAATTCTGTACCTCTGACTTAGG + Intergenic
1155256786 18:24005081-24005103 ACCTTCTGGAAACCTGACTGAGG - Intronic
1159500827 18:69266945-69266967 AACTTCTGTAACCCGAACTTGGG - Intergenic
1159590790 18:70332857-70332879 TACTTCTTTATCCCTTACTTTGG - Intergenic
1160884526 19:1339425-1339447 TCGCTCTGTCACCCAGACTTGGG + Intergenic
1160996091 19:1882487-1882509 TCCTTCTCCACCCCTGACTTAGG + Intronic
1161569873 19:5024566-5024588 TCCTGCTGTGACCATGACATGGG - Intronic
1164635071 19:29785907-29785929 TCCTTCTGTATCCCAGCCCTTGG - Intergenic
1166251897 19:41577024-41577046 TCCTTCAGTACCTCTGACCTTGG - Intronic
1166502244 19:43350479-43350501 TCCTTCTGTCACAGTGAATTGGG + Intergenic
1166507863 19:43382977-43382999 TCCTTCTGTCACAGTGAATTGGG - Intergenic
1168141266 19:54388889-54388911 TCCATCTGTAAAACAGACTTGGG - Intergenic
926304460 2:11628006-11628028 TGTTTCTGGAACCCAGACTTTGG + Intronic
926860896 2:17307597-17307619 TCCTCCTGTAATCCTGATCTTGG - Intergenic
926951204 2:18245571-18245593 TCCCTCAGTCACCCTGCCTTGGG - Intronic
926976964 2:18525111-18525133 TCCATCTGTAACACTGAGTTGGG + Intergenic
927199904 2:20571691-20571713 TACTTCTGTGCCCCTGCCTTGGG + Intronic
928161347 2:28928711-28928733 TCATTCTGTCACCCAGACTGGGG + Intronic
928571502 2:32613919-32613941 TGTGTCTGTAACCCTGACTTTGG + Intronic
930175199 2:48294516-48294538 TTCTTATGTAACCCTGCCATGGG + Intergenic
930444963 2:51458872-51458894 TCCTTCTGTTGCCCAGACTAGGG + Intergenic
933292729 2:80455403-80455425 TGCTTCTGTTTCCCTCACTTTGG - Intronic
937501634 2:122485587-122485609 TTGTTCTGTACCCCTGCCTTGGG - Intergenic
937649795 2:124307158-124307180 TCATTCTGGCACCCTGATTTTGG - Intronic
941794988 2:169589122-169589144 TCCTTATTTAACACTGAATTAGG + Intronic
943473313 2:188322781-188322803 TACTTCCCTGACCCTGACTTTGG + Intronic
947663462 2:231887645-231887667 ACATTCTGTAACCCTTACCTTGG + Intergenic
947705085 2:232268137-232268159 TCCTTCTGGGTCACTGACTTTGG + Intronic
948005126 2:234602054-234602076 TCCTTCTGTCCCCAAGACTTTGG - Intergenic
948648948 2:239426860-239426882 TCCTTCTGTCACCCTCCCTCTGG + Intergenic
949057015 2:241933151-241933173 TGCTTCTGAAACCCTTACTGTGG - Intergenic
1171202944 20:23256389-23256411 CCCTTCTGAAACCTTGACTATGG - Intergenic
1171476636 20:25414666-25414688 TCCTTCTGTCACCCAGGCTAGGG - Intronic
1172698722 20:36839660-36839682 TGCTTCTGTTTCCCTGTCTTGGG - Intronic
1173883283 20:46435202-46435224 ACCCGCTGTAACCCAGACTTCGG + Intergenic
1174194785 20:48765540-48765562 TCCTCCTGTACCCCTGGCATTGG - Intronic
1175721016 20:61287441-61287463 TCGTTCTGTCACCCAGACTGGGG - Intronic
1176048754 20:63105669-63105691 TCCTCCTGAAACACTGACTTGGG - Intergenic
1176223003 20:63978990-63979012 TCCTTCTGGAATCCTGACGTTGG - Intronic
1177851795 21:26357944-26357966 CCCTTCTGACACCTTGACTTTGG + Intergenic
1177896372 21:26859217-26859239 TCCTTCTGTTGCCCAGACTTCGG - Intergenic
1178533453 21:33393766-33393788 TCATTCTGTTACCCAGGCTTTGG + Intergenic
1179806083 21:43838180-43838202 TTCTCCTGTTAACCTGACTTAGG - Intergenic
1180967535 22:19798390-19798412 TCCCTCTCTACCACTGACTTAGG - Intronic
1182585488 22:31342322-31342344 TCCTCCAGAAACCCTGGCTTAGG + Intronic
1183009462 22:34932879-34932901 TCCTTCCCTCACCCTCACTTTGG - Intergenic
1183952910 22:41361912-41361934 TACTCCTGTAATCCTGCCTTGGG + Intergenic
1184499478 22:44863184-44863206 TCCCTCTGTGACCCTGGCCTTGG - Intergenic
951958740 3:28290562-28290584 TCTTTCTGTATCCTTGAGTTTGG + Intronic
952897584 3:38088328-38088350 TCCTTTTGGAATCCTGCCTTCGG + Exonic
954784090 3:53080602-53080624 TCCCTCTGTAACCTTGTGTTGGG + Intronic
956022715 3:64949410-64949432 TCCCTCTGTCACCCAGTCTTGGG - Intergenic
959819350 3:110713906-110713928 TTTTTCTGTTACCCTGACCTAGG - Intergenic
959872452 3:111343643-111343665 TCCCTTTGTTACACTGACTTGGG + Intronic
960524230 3:118691433-118691455 TGCTTTTGTAAACCTGACCTAGG + Intergenic
960963873 3:123091144-123091166 TCCTCCTGTCACCCTGGCTGTGG + Intronic
962725362 3:138220719-138220741 TCGTTCTGTCACCCTGACTGGGG + Intronic
963425523 3:145117461-145117483 TCCATCTGTATCCCTCTCTTTGG - Intergenic
964299506 3:155272315-155272337 TCTTTCTTTCATCCTGACTTTGG - Intergenic
965488970 3:169313556-169313578 TCCTTCTGTCACTCTGTCCTTGG - Intronic
967458116 3:189713161-189713183 TCCATTTGTACCCCTGCCTTTGG + Intronic
969685690 4:8672785-8672807 TCCTGCCGACACCCTGACTTTGG - Intergenic
970146724 4:13043775-13043797 TCTTTCTGGAACACTCACTTTGG + Intergenic
970965436 4:21922873-21922895 TCCTTCTGTAATTGTGATTTTGG - Intronic
971170250 4:24226367-24226389 TTCTTCTGCACTCCTGACTTAGG + Intergenic
972144599 4:36007014-36007036 TCCTTCTGTCACCCAGGCTGAGG - Intronic
972407538 4:38761291-38761313 TCTCTCAGGAACCCTGACTTTGG - Intergenic
974446657 4:61993322-61993344 TCATTCTGTCACCCTGGCTGGGG + Intronic
974724518 4:65781478-65781500 TCTTTATGTAATTCTGACTTAGG - Intergenic
976935920 4:90632619-90632641 TGCTTCAGTAAACCTGTCTTTGG + Intronic
980444329 4:132886282-132886304 TCCTTCTGTTGCCCAGACTTTGG - Intergenic
984261142 4:177444777-177444799 ACCTTCTGTTACTCTCACTTAGG + Intergenic
985147670 4:186910546-186910568 TCTTTCTGTAACCCTCTCTCTGG - Intergenic
986311022 5:6551243-6551265 ACTTTCTGTCACCCTGACATGGG - Intergenic
986529799 5:8724569-8724591 TCCTGCTGGAACCCTGATCTTGG - Intergenic
988600950 5:32639020-32639042 TCATTCTGTCACCCAGACTGGGG + Intergenic
989108619 5:37886409-37886431 TCCTTCTGGATCCCCTACTTTGG - Intergenic
991203059 5:64016691-64016713 ACTTTCTGTAACCCCTACTTGGG + Intergenic
994755359 5:103788256-103788278 TTCTTCTGTCACCCTGAATTTGG - Intergenic
1003564787 6:7213995-7214017 TCCTTCTGAAATGCTGACCTGGG + Intronic
1004174432 6:13327636-13327658 TCCGTCTTCAACTCTGACTTTGG - Intronic
1009479671 6:64140899-64140921 TCCTACTGGGACCCTGACTCAGG + Intronic
1013335738 6:109158455-109158477 TCATTCTGTCACCCAGACTGGGG - Intronic
1015272995 6:131356589-131356611 TCCCTCTGTCACCCAGACTGGGG + Intergenic
1015523726 6:134156195-134156217 TCCTTCTTTCACCCAGACTGGGG - Intergenic
1015540140 6:134305539-134305561 TCGCTCTGTCACCCAGACTTGGG - Intronic
1016911138 6:149200438-149200460 GCCTGCTGTAAGTCTGACTTGGG + Intergenic
1018587851 6:165382780-165382802 TCCTTTTTTAACTCTGACTGTGG - Intronic
1019207334 6:170373372-170373394 ACCCTCTGTCACGCTGACTTGGG + Intronic
1020020082 7:4860942-4860964 TCCTTCAGTAACACTGGGTTTGG + Exonic
1021576072 7:22107555-22107577 TCCTTCTGGCACCGTGACCTTGG - Intergenic
1022128009 7:27376601-27376623 TCACTTTGAAACCCTGACTTGGG + Intergenic
1027197950 7:76044188-76044210 TCATTCTGTCACCCAGACTGGGG + Intronic
1028805199 7:95018255-95018277 TCATTCAGTAACCCTTACTCAGG + Intronic
1028808604 7:95058606-95058628 TCCTTCTGGAAACCTTCCTTTGG - Intronic
1030790051 7:113714098-113714120 TCTTTCTGAAACCGTGAGTTAGG - Intergenic
1033430223 7:141282292-141282314 GGCTTCTGTAACCCTGCCCTTGG + Intronic
1033671443 7:143497443-143497465 TTCTTCTGGAGCCCTGAGTTGGG + Intergenic
1034108757 7:148515591-148515613 TCCTTCTCTACCCCTTTCTTTGG - Intergenic
1035447443 7:158952425-158952447 GCCTTCTCTAACCCAGACCTAGG - Intronic
1037482237 8:19315165-19315187 TCCTTCTGTCACCCAGGCTGTGG + Intronic
1037555072 8:20014260-20014282 TCCTACCGTCACCCTGATTTTGG + Intergenic
1039612980 8:38933610-38933632 TCCCTCTGTAAGTCTGACCTTGG + Intronic
1039852344 8:41379983-41380005 TCCTTTTCTAACCCTGGGTTTGG - Intergenic
1041243424 8:55868999-55869021 TGCCTGTGAAACCCTGACTTGGG + Intergenic
1042523182 8:69736121-69736143 TGCTTCTTTAACTCTGACATTGG + Intronic
1043657459 8:82687280-82687302 TCTTTCTGTACTACTGACTTAGG + Intergenic
1044483204 8:92717535-92717557 TCCTTCTGTGTCCCTCACTCAGG + Intergenic
1046587208 8:116162208-116162230 GCCTTTTGTAACCTGGACTTTGG + Intergenic
1046749609 8:117913188-117913210 TCTTTCTGTCACCCAGGCTTGGG - Intronic
1047057422 8:121181516-121181538 TCCTTCTATAAACCTGTCATAGG + Intergenic
1055260982 9:74433381-74433403 TGCTTCTCCATCCCTGACTTTGG - Intergenic
1056504657 9:87246734-87246756 TCCTTCTGTCATCCTAAATTTGG - Intergenic
1056766053 9:89445449-89445471 TCCTGCTGACACCCTGATTTTGG - Intronic
1059463178 9:114448364-114448386 TCCTGCTGTCACCTTGATTTTGG + Intronic
1062473115 9:136714825-136714847 TCCCTCTGTAGCCCTGCCTGGGG + Intronic
1186044408 X:5519521-5519543 TCCTCCTATATCCCAGACTTGGG + Intergenic
1186684155 X:11907289-11907311 TCCTTCTGTTTCCCTGAATATGG + Intergenic
1187173445 X:16872309-16872331 TCCTTCTCTGACCCTCACTGAGG - Intergenic
1187812688 X:23197101-23197123 CCCTTCTGTAACAATGACTTGGG - Intergenic
1189353957 X:40297688-40297710 TCCATCTGCATCCCTGACTCTGG - Intergenic
1192625588 X:72724352-72724374 TCCTTCTGTAGAGTTGACTTTGG - Intergenic
1194724515 X:97378677-97378699 TCCCTCTGTCACCCAGACTGCGG - Intronic
1197306145 X:124844433-124844455 CCCTTCCGTAACACTGCCTTTGG + Intronic
1197454265 X:126658269-126658291 CCCTTCTGAAACCTTGACTATGG + Intergenic
1199741228 X:150738532-150738554 TCCTGCTGGGACCCTGATTTTGG - Intronic
1200208228 X:154332906-154332928 AGCTTCTCTAACCCTGACCTCGG - Intergenic