ID: 924616728

View in Genome Browser
Species Human (GRCh38)
Location 1:245618055-245618077
Sequence CAGAAGGAAGAGAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4171
Summary {0: 1, 1: 1, 2: 23, 3: 442, 4: 3704}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924616718_924616728 4 Left 924616718 1:245618028-245618050 CCTTTCCTCCCACCAAAGTCAGG 0: 1
1: 0
2: 2
3: 22
4: 277
Right 924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG 0: 1
1: 1
2: 23
3: 442
4: 3704
924616722_924616728 -4 Left 924616722 1:245618036-245618058 CCCACCAAAGTCAGGGTTACAGA 0: 1
1: 0
2: 0
3: 9
4: 133
Right 924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG 0: 1
1: 1
2: 23
3: 442
4: 3704
924616725_924616728 -8 Left 924616725 1:245618040-245618062 CCAAAGTCAGGGTTACAGAAGGA 0: 1
1: 0
2: 0
3: 20
4: 204
Right 924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG 0: 1
1: 1
2: 23
3: 442
4: 3704
924616723_924616728 -5 Left 924616723 1:245618037-245618059 CCACCAAAGTCAGGGTTACAGAA No data
Right 924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG 0: 1
1: 1
2: 23
3: 442
4: 3704
924616721_924616728 -1 Left 924616721 1:245618033-245618055 CCTCCCACCAAAGTCAGGGTTAC 0: 1
1: 0
2: 0
3: 9
4: 91
Right 924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG 0: 1
1: 1
2: 23
3: 442
4: 3704

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924616728 Original CRISPR CAGAAGGAAGAGAAGGAGGC AGG Intronic
Too many off-targets to display for this crispr