ID: 924617458

View in Genome Browser
Species Human (GRCh38)
Location 1:245624402-245624424
Sequence AAATGCTGGTGGGGGTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 0, 2: 3, 3: 71, 4: 480}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924617458_924617467 19 Left 924617458 1:245624402-245624424 CCTCCATACCCCCACCAGCATTT 0: 1
1: 0
2: 3
3: 71
4: 480
Right 924617467 1:245624444-245624466 GTTTTGCCTGTTTACATAGTAGG 0: 1
1: 0
2: 2
3: 14
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924617458 Original CRISPR AAATGCTGGTGGGGGTATGG AGG (reversed) Intronic
901751364 1:11412168-11412190 AAAGGATGGTGGGGGTGGGGGGG - Intergenic
903334888 1:22618299-22618321 CAACGCTGGTGGGAGCATGGAGG + Intergenic
903648701 1:24910307-24910329 AAATGTGGGAGGGGGTAAGGGGG + Intronic
905142084 1:35855289-35855311 AACTGCTGGTGGGGAAATGATGG + Exonic
905335766 1:37243666-37243688 AGATGCTGGTGGGGTTGGGGAGG + Intergenic
905349931 1:37338542-37338564 AATTGCTGGTGGGGAAATGGGGG - Intergenic
905633810 1:39535499-39535521 AAGTGTTGGTGAGGGTATAGAGG + Intergenic
905638611 1:39573529-39573551 AAAGGCTGGGCTGGGTATGGTGG + Intronic
906184865 1:43854189-43854211 TATTCCTGGTAGGGGTATGGGGG - Intronic
906517148 1:46446415-46446437 AAATAATGGGGGGGGTATGTTGG - Intergenic
907373758 1:54019277-54019299 AAATGCTGGTCGGGGGGTGAGGG + Intergenic
908510064 1:64844386-64844408 AAGTGCTGGTGGTGGCTTGGAGG - Intronic
908616198 1:65925543-65925565 AGATGTTGTTGGAGGTATGGAGG - Intronic
908800009 1:67870376-67870398 AAATACGGGTGGGGGGAGGGGGG - Intergenic
909062365 1:70893859-70893881 AAATGTTGAATGGGGTATGGAGG - Intronic
909181598 1:72430747-72430769 AAATGATGGTGAGGATGTGGAGG + Intergenic
909242319 1:73230041-73230063 AAATGCTGGTGAGGATGTGGAGG + Intergenic
909582955 1:77258702-77258724 AAATGGGGGAGGGGGTATGGTGG + Intergenic
909919913 1:81368167-81368189 AGATGCTGGTGAGGTTGTGGAGG - Intronic
910160589 1:84268154-84268176 ATATTTTGGTGGGGGTAGGGGGG - Intergenic
910642464 1:89478770-89478792 AGATGCTGGTGAGGTTGTGGAGG + Intergenic
911091208 1:94018813-94018835 CAAGGTTGGTGGGGGTAGGGAGG - Intronic
912608083 1:111013486-111013508 AGATGCTGGTGAGGCTGTGGAGG + Intergenic
913398619 1:118402479-118402501 AAATGTTGGTGAGGATATGGTGG + Intergenic
914772223 1:150697977-150697999 AAAGGCTGGTAGGAGGATGGGGG - Intergenic
915288499 1:154867836-154867858 AATTGGGGGTGGGGGTATCGTGG + Intronic
915954577 1:160211293-160211315 AAAAGATGGTGGGGGGAAGGAGG + Intronic
916079467 1:161223432-161223454 AGAGGGTGGTGGGGGTTTGGGGG + Intronic
916300835 1:163272119-163272141 ACATTCTTGTGGGTGTATGGTGG + Intronic
916491905 1:165309385-165309407 AAGTCCTGGTGGGGGGCTGGAGG + Intronic
916822214 1:168410472-168410494 AGGTGCTTGTGGGGGTTTGGAGG + Intergenic
917470496 1:175322325-175322347 AAATGCTGGTTGGGCTTTTGAGG + Exonic
917896679 1:179496818-179496840 AAATGCCTACGGGGGTATGGGGG - Intronic
918067550 1:181111627-181111649 AAATTCTAGTGGGGGTGGGGAGG - Intergenic
918461910 1:184785252-184785274 AAATGGTGGTGGAGGTAGAGCGG + Intergenic
918673935 1:187258107-187258129 GAAGGCTAGTGGGGGTTTGGAGG - Intergenic
919771594 1:201163728-201163750 AAATGCTGGTGAGGATGTGAAGG + Intronic
920221565 1:204406900-204406922 AAGGGCTGGTGGGGGATTGGGGG - Intronic
921002885 1:211062808-211062830 AAATTCTGGTGAGGATGTGGAGG + Intronic
922369278 1:224893161-224893183 AAATTTTGGGGGCGGTATGGAGG - Intergenic
922742270 1:228020650-228020672 AAATGGTGGAGGGGGTGTGCAGG + Intronic
923954109 1:238995438-238995460 AAATGCTAGGTCGGGTATGGTGG - Intergenic
924537092 1:244944890-244944912 AAATGTTGGTGGGGATGTGGAGG + Intergenic
924617458 1:245624402-245624424 AAATGCTGGTGGGGGTATGGAGG - Intronic
1062775725 10:145584-145606 CCATTCTGGTGGGGGTAAGGTGG + Intronic
1063972745 10:11392903-11392925 AAGAGCTGGAGGGGGCATGGCGG + Intergenic
1064225968 10:13485446-13485468 ATATGCTGGTGGGGATTTGGGGG + Intronic
1065292289 10:24242728-24242750 ACATGCTGGTGAGGCTGTGGAGG - Intronic
1065410307 10:25419623-25419645 AAATGTAGGTTAGGGTATGGAGG - Intronic
1065554003 10:26895795-26895817 AAATGCTGGCGAGGATGTGGAGG + Intergenic
1065599276 10:27352514-27352536 AAATGCTGGCGAGGATGTGGAGG - Intergenic
1065980878 10:30895854-30895876 AAATGTTGGTGAGGATATGGAGG + Intronic
1068215327 10:53975423-53975445 AGATGCTGGTGAGGTTATGGGGG - Intronic
1068274252 10:54772617-54772639 AGATGCTGGTGAGGTTGTGGAGG + Intronic
1068615313 10:59108227-59108249 TAATGTTGCTGGGGATATGGGGG + Intergenic
1068659442 10:59608662-59608684 AAATGCTGGTGAGAATGTGGAGG + Intergenic
1068998071 10:63230838-63230860 AAATGCTAGTGGGAGAAAGGAGG + Intronic
1069164490 10:65135229-65135251 AAGTATTGGTGGGGATATGGAGG + Intergenic
1069917369 10:71795911-71795933 GAAGGGTGGTGGGGGTGTGGTGG - Exonic
1070233956 10:74603888-74603910 AAATGCTGGTGAGGATGTGGAGG - Intronic
1070339425 10:75483232-75483254 AAATGATGGGTGGGGTGTGGTGG - Intronic
1070350959 10:75591963-75591985 AGATGGTGGGGGTGGTATGGAGG + Intronic
1070437440 10:76407002-76407024 AAATGTTTGTGGGTGGATGGAGG - Intronic
1071507637 10:86242327-86242349 AGTTGCTGATGAGGGTATGGAGG + Intronic
1072881574 10:99234003-99234025 GAAAGCTGGTGGGGGAAAGGGGG + Intronic
1073674028 10:105624806-105624828 TTATGGAGGTGGGGGTATGGTGG + Intergenic
1073904966 10:108267879-108267901 AAATGCTAGTGAGGATGTGGAGG - Intergenic
1074135444 10:110622037-110622059 AAATGTTGGTGAGGGTACAGAGG - Intergenic
1074301538 10:112237769-112237791 AAATTCTGGTGAGGATGTGGAGG - Intergenic
1074553572 10:114468049-114468071 AACTGCATGTGGGGTTATGGTGG - Intronic
1075257252 10:120934995-120935017 AAATGCTGGAGATGGTGTGGTGG - Intergenic
1075831099 10:125411873-125411895 AAAAGCTGGTGAGGATTTGGAGG - Intergenic
1076462397 10:130656037-130656059 ACATGCAGGTGGGGGTGGGGCGG + Intergenic
1076462406 10:130656060-130656082 ACATGCAGGTGGGGGTGGGGCGG + Intergenic
1076462415 10:130656083-130656105 ACATGCAGGTGGGGGTGGGGCGG + Intergenic
1076462471 10:130656221-130656243 ACATGCAGGTGGGGGTGGGGCGG + Intergenic
1076487097 10:130829898-130829920 AAATGCTGGTGAGGATCTAGAGG + Intergenic
1076687338 10:132204058-132204080 AGATGCTGCTGGGGGTGTTGTGG + Intronic
1078738101 11:14040019-14040041 AAGTACTGGTGAGGATATGGAGG + Intronic
1079422244 11:20304356-20304378 TAAGGGAGGTGGGGGTATGGTGG + Intergenic
1080099992 11:28448780-28448802 AAATGGTGGTGGTGGGGTGGGGG - Intergenic
1080398680 11:31914018-31914040 AGATGCTGGTGGGGTTGTGGAGG - Intronic
1080408376 11:32000330-32000352 AAAAGATGGTGGTGGTTTGGGGG + Intronic
1080557407 11:33430094-33430116 AAATCCTGGTGGAGGGAGGGAGG - Intergenic
1080706500 11:34700257-34700279 AAATGCTGGCGAGGATGTGGAGG - Intergenic
1081009099 11:37785606-37785628 AGATGCTGGTGAGGTTGTGGAGG + Intergenic
1081133293 11:39406829-39406851 AATTTATGGTAGGGGTATGGTGG + Intergenic
1081572956 11:44302838-44302860 AAATGCGTGTGGGGGTGAGGAGG + Intronic
1081573789 11:44307154-44307176 AAATGTGGGTGGGGGTTGGGAGG + Intronic
1082106114 11:48223579-48223601 ATGTGCTGGTGGGGATATGAAGG + Intergenic
1082863275 11:57874999-57875021 AAATGCTGATGGGCATAAGGAGG + Intergenic
1083302714 11:61747296-61747318 AAATGCAGGTGCGGGTTTAGTGG + Intergenic
1084210262 11:67617941-67617963 AAATGCTCGTGAGGATGTGGAGG - Intergenic
1084285445 11:68128136-68128158 ACAAGCTGGTGTGGGGATGGGGG - Intergenic
1084656560 11:70523067-70523089 CAATGCTGGTGTGGGTGTGGAGG + Intronic
1085147868 11:74219236-74219258 AAATGCTGGTGAGGATGTGGAGG + Intronic
1085503380 11:77041561-77041583 AAAGGCTGGTGGGAACATGGAGG + Exonic
1086401856 11:86467319-86467341 AAATGCTGATGGAGGTTTGGTGG + Intronic
1088227711 11:107639853-107639875 AAATGGTGGTGGGCTTATGGTGG - Intronic
1088726284 11:112638318-112638340 AAAAGCTGGTGAGGATGTGGAGG - Intergenic
1088872410 11:113902223-113902245 AAATGATTGTGGGGGTCTAGGGG - Intergenic
1088953468 11:114594025-114594047 GAAGGGTGGTGGGGGCATGGAGG + Intronic
1090350498 11:126104862-126104884 AGAAGCTGGTGGGGGTTGGGGGG - Intergenic
1091572785 12:1703998-1704020 AAAAACTGGTGGGGGCATAGCGG - Intronic
1091631966 12:2168829-2168851 AGATGCTGGTGGTGGTGTGATGG + Intronic
1092376789 12:7962395-7962417 GAATGGTGGTGGGGGTGGGGCGG - Intergenic
1092668479 12:10834246-10834268 AAATGCTTGTGAGGATGTGGAGG - Intronic
1092971545 12:13700454-13700476 TAAGGGTAGTGGGGGTATGGGGG - Intronic
1093252733 12:16827532-16827554 AGATGCTGGTGAGGTTGTGGAGG + Intergenic
1093760793 12:22907158-22907180 AGAGGCTGGTGAGGGTACGGAGG + Intergenic
1093831636 12:23767985-23768007 AATAGCAGGTGGGGGTAGGGAGG + Intronic
1094129266 12:27057577-27057599 ACATTCTGGTGGAGGTATAGTGG - Intronic
1095606468 12:44073375-44073397 AAATGCTTGATGGGGTATTGGGG - Intronic
1096478879 12:51924826-51924848 TAATGTTGGTGAGGATATGGAGG - Intergenic
1097343594 12:58467005-58467027 AACTGCTTGTAGGGGTCTGGAGG + Intergenic
1098295344 12:68998592-68998614 AAATAATGGTGGGGGAAGGGGGG - Intergenic
1098582411 12:72115688-72115710 AAATGCTAGTGAGGATGTGGAGG - Intronic
1098763605 12:74456559-74456581 AAGTGGGGGTGGGGGTGTGGGGG - Intergenic
1099302322 12:80912860-80912882 AAATGCTTATGCAGGTATGGAGG - Intronic
1099530787 12:83778061-83778083 AAGTGGTGGTGGGGGTAGAGAGG - Intergenic
1100291862 12:93223174-93223196 AAATAAAGGTGGGGGTTTGGGGG + Intergenic
1100362153 12:93888963-93888985 AAATGCTGCTGGAGGAGTGGTGG + Intronic
1101120330 12:101572702-101572724 AAATGTTGGTGAGGGTGTGTAGG + Intronic
1101548062 12:105735496-105735518 AAAAGATGGTGGGGGTGGGGGGG + Intergenic
1103195124 12:119037179-119037201 AAATGGTGATGGGGGTTTGGGGG + Intronic
1104446383 12:128836945-128836967 AAATGCTGGTGAGAATGTGGAGG + Intergenic
1104804848 12:131579197-131579219 AAATGCTGCTGAGAATATGGAGG + Intergenic
1105047697 12:133019568-133019590 AGATGCTGGTGAGGATATGGAGG + Exonic
1105778880 13:23689288-23689310 AAATGGTGGTGGCGGTGTTGGGG - Intergenic
1105911899 13:24876564-24876586 AAGTGCTGGTGAGGATATGCAGG - Intronic
1106214806 13:27686539-27686561 AGATGGTGGTGGTGGTATGGTGG + Intergenic
1108856781 13:54802505-54802527 AAATGAGGGTTGGGGTAGGGAGG + Intergenic
1109016103 13:57016284-57016306 AGATGCTGGTGAGGCTGTGGAGG + Intergenic
1109980763 13:69903266-69903288 AAAGGCAAGTGGGGGTGTGGTGG - Intronic
1110200534 13:72844907-72844929 AAATGCTTGTCTGGGAATGGTGG - Intronic
1110759226 13:79212139-79212161 AAATGCTGGTGAGGATGTGGAGG - Intergenic
1112016419 13:95335110-95335132 GAATGCTGTTGGTGGTATTGAGG - Intergenic
1112216516 13:97435490-97435512 AACTGGTGGTGGTGGTGTGGTGG - Intronic
1112365800 13:98754326-98754348 AAATGCTGGAGAGGATATGGAGG + Intergenic
1112618364 13:101028622-101028644 AAATGCTGGCGAGGATGTGGAGG - Intergenic
1112658280 13:101475780-101475802 AAATGCTGATGGGGGGCAGGTGG + Intronic
1112792962 13:103023633-103023655 AATTGCTGGTGAGTATATGGAGG - Intergenic
1114668883 14:24398617-24398639 AGAGGCTGTTGGGGGTAGGGGGG + Intergenic
1115041098 14:28929328-28929350 ACATGGGGGTGGGGGTAGGGTGG + Intergenic
1115722837 14:36181947-36181969 AAATGCTGGGGTGGGGGTGGGGG - Intergenic
1116358783 14:43966176-43966198 AGATGCTGGTGAGGTTGTGGGGG - Intergenic
1116504029 14:45655656-45655678 TAAAGCTGGTGTGGGTGTGGGGG - Intergenic
1116544632 14:46149215-46149237 AGATGCTGGTGAGGTTATGGAGG - Intergenic
1116929904 14:50679834-50679856 AAATGCTGGTGAGGATGTGGAGG - Intergenic
1117112332 14:52471426-52471448 AAAGGTTGGTGGGGGTAAGCTGG - Intronic
1117873995 14:60231887-60231909 AGATGCTGGTGCGGCTGTGGAGG + Intergenic
1119692279 14:76684323-76684345 AAATGTTGGTGAGGATGTGGAGG - Intergenic
1120624004 14:86802305-86802327 AAATGCTGGTAGGGCTATTGTGG + Intergenic
1121850595 14:97218602-97218624 AAAGGCTGGTGGGGGGGTGGGGG + Intergenic
1122800099 14:104225133-104225155 AAATGCAGCTGGGGTGATGGTGG - Intergenic
1123062808 14:105601890-105601912 AGCTTCTGGTGGGGGAATGGGGG - Intergenic
1123428443 15:20192825-20192847 AAATTTGGGTGGTGGTATGGAGG - Intergenic
1123878700 15:24653064-24653086 AGATGCTGGTGAGGCTATGGAGG + Intergenic
1124173219 15:27396496-27396518 AAATGCTGGTGAGGATGTGGTGG + Intronic
1125291185 15:38149099-38149121 AAATGTTGGTGAAGATATGGAGG - Intergenic
1125400047 15:39292414-39292436 AGATGCTGGTGAGGTTGTGGAGG - Intergenic
1125570606 15:40714884-40714906 AAATTCTGGGCCGGGTATGGTGG + Intronic
1126439729 15:48674390-48674412 GAATGGTGGTGGTGGTAAGGGGG - Intergenic
1126524345 15:49634105-49634127 GAATGCTGGTGAGGAAATGGTGG - Intronic
1126687228 15:51258986-51259008 CAATGATGGTGGAGGGATGGGGG - Intronic
1126736539 15:51737241-51737263 GACTGCGGGTGGGGGTTTGGGGG - Intronic
1127121813 15:55778436-55778458 AAAAATTAGTGGGGGTATGGTGG - Intergenic
1127570274 15:60234878-60234900 AGCTGATGGTGGGGGTAGGGAGG - Intergenic
1128054602 15:64690341-64690363 AAATGCTGGGGAGGGAAAGGAGG - Intronic
1128082909 15:64866870-64866892 AAATGCTGATAGGGGTATGTTGG + Exonic
1128672887 15:69587500-69587522 CAATGGTGGTGGGGGAATGGGGG - Intergenic
1129315051 15:74737391-74737413 AAATGCTGGAGAGGATGTGGAGG + Intergenic
1129553353 15:76477253-76477275 AAAGTCTAGTGTGGGTATGGTGG + Intronic
1129923854 15:79344495-79344517 AAATGGAGTTGGGGGTTTGGTGG - Intronic
1130306344 15:82714337-82714359 CAGTGCTGGTGGGGGTGGGGAGG + Intergenic
1130644097 15:85708476-85708498 ACCTGCTGGTGGGGGTGGGGAGG + Intronic
1131807063 15:96133826-96133848 AATTGCTGGTGATGGTTTGGAGG - Intergenic
1133270748 16:4609812-4609834 AGCTGCTGGTGGCGGCATGGGGG + Exonic
1133731930 16:8585434-8585456 AAATCCTGGTGGGGGTGTATGGG - Intronic
1135504488 16:23024542-23024564 AAATGCTGGTGAGGATGTGGAGG - Intergenic
1135656810 16:24257010-24257032 ATATTCTGGTGGGTGTTTGGAGG + Intronic
1136277680 16:29188539-29188561 AAATGGTGATGGGGATATGCTGG - Intergenic
1137238479 16:46634426-46634448 AAATGCTGGTGAGGATACAGAGG + Intergenic
1137962979 16:52903183-52903205 AAATGCTGCCAGGGATATGGAGG + Intergenic
1138666068 16:58569708-58569730 AAAAGGGGGTGGGGGGATGGGGG + Intronic
1142082055 16:88154581-88154603 AAATGGTGATGGGGATATGCTGG - Intergenic
1142498213 17:317618-317640 AAATACTGGAGGGGAGATGGGGG - Intronic
1143346530 17:6253518-6253540 AAATGCTGGGGTAGGTAGGGAGG + Intergenic
1143806928 17:9436518-9436540 AAATACTGGTGAGGGTAAGATGG + Intronic
1144514146 17:15903782-15903804 AAATGCTGATGTGGGGGTGGGGG - Intergenic
1144872404 17:18379295-18379317 AAAAGCTGGTGTGGGAGTGGGGG + Intronic
1145391357 17:22458431-22458453 AAATGCAGGTGAGGCTGTGGAGG + Intergenic
1146311676 17:31773658-31773680 AAATGCTGGTGAGGGTGTGCTGG + Intergenic
1147383948 17:40071075-40071097 AAAGGCTGGTGGGGGAAAGAGGG - Intronic
1148067358 17:44881902-44881924 AAATGCTCCTGGGTGTGTGGAGG + Intronic
1148334960 17:46834870-46834892 GAATGCTTCTGGGGGTAAGGTGG - Intronic
1150627924 17:66855013-66855035 AAATGTTGGTGAGGATATGAAGG + Intronic
1151256529 17:72881011-72881033 AAGTGTTGGTGAGGATATGGAGG + Intronic
1151748859 17:76025727-76025749 AAAGGCTGGTGTGGGAGTGGGGG - Intronic
1152189590 17:78880269-78880291 AGATGTTGGTGGGTGTATGAAGG - Intronic
1152329100 17:79660645-79660667 AGATGCTGGCGAGGTTATGGAGG + Intergenic
1152715035 17:81895336-81895358 AAATGTTGGGGGGGGCACGGTGG - Intronic
1203170223 17_GL000205v2_random:141558-141580 AGATGCTGGTGAGGCTGTGGAGG - Intergenic
1153359275 18:4175061-4175083 AGATGCTGGTGAGGCTGTGGAGG - Intronic
1154129662 18:11725915-11725937 AAATGCTGGTGAGGATGTGGAGG - Intronic
1154194846 18:12258097-12258119 AAAGGCTGGTGGGGGCACAGAGG - Intronic
1155256686 18:24004036-24004058 AAATGCTGGGTGTGGTGTGGTGG - Intronic
1155474448 18:26224152-26224174 AATTGATGGTGGGGGTCTAGTGG + Intergenic
1156374674 18:36502777-36502799 ACATGCATGTGGGGGTAGGGTGG - Intronic
1156850075 18:41715904-41715926 AAATGGTGGTGGTGGTGAGGGGG + Intergenic
1157533213 18:48439666-48439688 AAATGGTGGTGGGGATGTAGGGG + Intergenic
1158117586 18:54013404-54013426 AAATTTTGGGGGTGGTATGGAGG - Intergenic
1158413708 18:57231145-57231167 ACATGCTGGTGGGGGACAGGTGG + Intergenic
1158846933 18:61453947-61453969 AAATGCTGGTGAGGAAGTGGAGG - Intronic
1158868572 18:61661844-61661866 AAATTCTGGTCGGGGGAGGGGGG + Intergenic
1161906861 19:7163248-7163270 GAAAGCTGGTGGGAGGATGGCGG + Intronic
1165666007 19:37629256-37629278 AGATACTGGTGGGGGTGAGGGGG - Intronic
1168406844 19:56114912-56114934 AAGAGCTGGTGGGGGAGTGGAGG - Intronic
925400678 2:3570092-3570114 GAATACTGCTGGGGGTTTGGAGG - Intergenic
926156153 2:10455035-10455057 AAGTGCTGGTGGGAGCCTGGAGG - Intergenic
927427238 2:22995212-22995234 AAACGCTGGTGGTGGTGGGGAGG - Intergenic
927592511 2:24368837-24368859 AAAAGCTGGTGGTGGTATCCTGG + Intergenic
928603923 2:32926843-32926865 GAATGCTGATGGGGGTGGGGAGG - Intergenic
928757200 2:34541640-34541662 AGATGCTGGTGAGGCTGTGGAGG - Intergenic
929464419 2:42131913-42131935 AAATGCTGAAGGAGGAATGGAGG + Intergenic
929713862 2:44291644-44291666 AAGCGCTGCTGGGGGTAAGGTGG - Intronic
930617931 2:53613438-53613460 AAATGCTGATGAGGATATGGAGG - Intronic
930968321 2:57359978-57360000 AAATACTGGTGAGGTTGTGGAGG - Intergenic
931750590 2:65326543-65326565 AGCTGCTGGTGGGGCTTTGGGGG + Intronic
932223751 2:70022535-70022557 AAAAGTTAGTGGGGGCATGGTGG + Intergenic
932617898 2:73247259-73247281 CCATGCTGTTGGGGGTGTGGGGG + Intronic
932646922 2:73512027-73512049 AAATGCTGATGAGGATGTGGAGG - Intronic
933968231 2:87448079-87448101 GAATGCTTATGGGGGTGTGGAGG + Intergenic
934066798 2:88348843-88348865 AACTACTGGTGGGGGGAGGGAGG + Intergenic
934756829 2:96830196-96830218 AAGAGCTGGTGGGGCTGTGGAGG + Intronic
934948265 2:98557878-98557900 AAATCCTGGTGGGGCGATAGTGG - Intronic
935523755 2:104141567-104141589 AAATGCTGGGGGGTGGAGGGGGG + Intergenic
935531975 2:104244901-104244923 AAATTCTGGTGAGGATGTGGAGG + Intergenic
935829221 2:106982735-106982757 AAATGCTAATGAGAGTATGGAGG - Intergenic
936325566 2:111502425-111502447 GAATGCTTATGGGGGTGTGGAGG - Intergenic
936803910 2:116301924-116301946 AAATGCTGGTGAGGATGTGGAGG + Intergenic
938234926 2:129698371-129698393 AGATAGTGGTGGGGGTAGGGTGG + Intergenic
938792087 2:134685646-134685668 AAATGCTGATGGGGGCAAGTGGG - Intronic
938918782 2:135972923-135972945 AAATGCTGGTGAGGATGTGGAGG + Intronic
939021063 2:136958984-136959006 AGGTGCTGGTGGGGCTAGGGAGG + Intronic
939165223 2:138634205-138634227 GAATGGGGGTGGGGGTAGGGAGG - Intergenic
939792327 2:146593445-146593467 AAATGTTGGTGGATGTGTGGGGG + Intergenic
940080955 2:149800789-149800811 AAATGCAGGTGGGGGTGCGGAGG - Intergenic
940625610 2:156171809-156171831 AGATACTGGTGAGGTTATGGAGG + Intergenic
940901930 2:159133600-159133622 AAAGACTTGTGGGGGTTTGGGGG - Intronic
941554116 2:166954420-166954442 AGATGCTGGTGAGGTTGTGGAGG + Intronic
943331025 2:186559293-186559315 AAATGGTTCTGGGGGTGTGGTGG + Intergenic
943629394 2:190233868-190233890 AAATGTTGGGCTGGGTATGGTGG + Intronic
944565312 2:200984595-200984617 AAAAGCTTGGTGGGGTATGGTGG + Intronic
947180660 2:227408446-227408468 AAATGGTGGTGGTGGGTTGGGGG + Intergenic
947478585 2:230475177-230475199 AGATGCTGGTGAGGTTGTGGAGG - Intronic
1168889189 20:1283118-1283140 AAAGGCTGGTGGGGCCAGGGAGG - Intronic
1169023399 20:2347630-2347652 AAATGCATGTAGGGGTAGGGAGG + Intergenic
1169677958 20:8176027-8176049 AAATGCTGGCAAGGGTGTGGAGG + Intronic
1170401130 20:15984915-15984937 AACTGCTGTTGGGGGGAAGGGGG + Intronic
1170841031 20:19924561-19924583 GAATGAAGGTGGGGGTATGAAGG - Intronic
1172117077 20:32579494-32579516 AAATGCTGCTGGGAGGATTGGGG - Intronic
1172153394 20:32806492-32806514 AAATGGCGGAGGGGGTGTGGTGG + Intronic
1172926257 20:38538768-38538790 AAATGTTGGTGAGGATGTGGAGG + Intronic
1173197470 20:40927841-40927863 AAAAGCAAGTGGGGGTGTGGAGG - Intergenic
1175631685 20:60544382-60544404 AAATGCTGGTGAGGATGTGGGGG - Intergenic
1176103733 20:63376057-63376079 CAGGGCTGGTGGGGGTGTGGGGG - Intronic
1176326214 21:5503354-5503376 AGATGCTGGTGAGGCTGTGGAGG - Intergenic
1176401543 21:6317597-6317619 AGATGCTGGTGAGGCTGTGGAGG + Intergenic
1176435614 21:6671507-6671529 AGATGCTGGTGAGGCTGTGGAGG - Intergenic
1176459876 21:6998577-6998599 AGATGCTGGTGAGGCTGTGGAGG - Intergenic
1176483437 21:7380355-7380377 AGATGCTGGTGAGGCTGTGGAGG - Intergenic
1177761660 21:25408565-25408587 AAATGGTGGTGAGGGGTTGGGGG + Intergenic
1177967116 21:27741522-27741544 AAATGCAGGTGAGGATAAGGGGG - Intergenic
1178059342 21:28834792-28834814 ATCTGGTGGTGGGGGCATGGTGG + Intergenic
1178432153 21:32526175-32526197 AGATGCTGATGGGGGTCTGGAGG - Intergenic
1179196319 21:39166254-39166276 AGATGCTGGTGAGGATGTGGAGG - Intergenic
1179647445 21:42784474-42784496 AAATCCTGGTGGGAGGGTGGGGG + Intergenic
1180104476 21:45608939-45608961 TCATCCTGGTGGGGGTGTGGTGG + Intergenic
1180597284 22:16986489-16986511 AAAGGCTGATGGGTGTAAGGTGG - Intronic
1181896818 22:26116951-26116973 AGATACTGGTGAGGCTATGGAGG + Intergenic
1182378653 22:29868368-29868390 AGAGGCTGGTGGGGGTGGGGAGG + Intergenic
1182863637 22:33583131-33583153 ACAAGCTGGTGGGTGCATGGTGG - Intronic
1184165339 22:42724056-42724078 AAAGGCTGCTGGGGCTTTGGGGG - Intergenic
1184304204 22:43584433-43584455 AAGTGGTGGTGGGGGTGGGGAGG - Intronic
1185161939 22:49235457-49235479 CAAAGCTTGTGGGGGTGTGGAGG - Intergenic
1185367585 22:50443997-50444019 GACTGCTGGGGTGGGTATGGCGG - Exonic
949760958 3:7470129-7470151 AAATGCTAGTGGGAGTTAGGGGG - Intronic
950134478 3:10571088-10571110 AACTGGTGGTGGGGGAAAGGTGG + Intronic
950812405 3:15661311-15661333 AAATGCTAGTGTGGATGTGGAGG - Intergenic
951760527 3:26142743-26142765 AAATGCTGGCGAGGATGTGGAGG + Intergenic
952200318 3:31119695-31119717 CAATGTTTGTGAGGGTATGGAGG - Intergenic
952393545 3:32901822-32901844 AAGTGTTGGTGGGGGTGAGGTGG - Intergenic
952543220 3:34389850-34389872 AAATATTGGTATGGGTATGGAGG + Intergenic
953532304 3:43749629-43749651 AAATGGTGGGGGGGGGGTGGGGG - Intergenic
953720220 3:45348621-45348643 AAATGATGTTGTGGGTATGCTGG - Intergenic
954453235 3:50582963-50582985 ATATGCTGGTGGTGGTGGGGAGG - Exonic
954656774 3:52198631-52198653 AAATGAGGGTAGGGGTATGAGGG - Intronic
955165839 3:56510310-56510332 AAATGCTGGCAGGGATGTGGAGG + Intergenic
955644695 3:61124422-61124444 AACGGCTGGTGGTGGGATGGGGG + Intronic
955907716 3:63825136-63825158 AAATTATGGTGGATGTATGGTGG - Intronic
956751030 3:72344070-72344092 AAATGTGGGTAGGTGTATGGGGG - Intergenic
957368591 3:79259573-79259595 GAATGCTAGTGGGGGCATAGGGG - Intronic
957903519 3:86529439-86529461 AAATGCTGGTGAGGATGTGGAGG + Intergenic
958897569 3:99846151-99846173 AAGTGCTGGTGGGGGACGGGGGG - Intronic
958985276 3:100773458-100773480 AAATGTTGGTGAGGATTTGGAGG + Intronic
959102567 3:102029495-102029517 AAATGTTGGTGAGGATATGGAGG + Intergenic
959956228 3:112240976-112240998 GAAAGGTGGTGGGGGGATGGGGG + Intronic
960115724 3:113890190-113890212 AAAAGCTGGTGTGGGTGAGGGGG + Intronic
960227200 3:115182604-115182626 AAATGCTGGTGCGGATGTGGAGG + Intergenic
960320773 3:116232956-116232978 AAAGGCTGGTTGGGGTTGGGGGG - Intronic
961669677 3:128519780-128519802 AAACGGTGGTGGGGGTGGGGAGG + Intergenic
962082302 3:132153343-132153365 AAATGTTGGTGAGGATATCGAGG + Intronic
962502844 3:136012570-136012592 AAACACTGGTGGGGGAAAGGAGG - Intronic
962640307 3:137378779-137378801 AGATGCTGGTGAGGTTGTGGAGG + Intergenic
963190814 3:142471031-142471053 AAGTTCTGGAGGGGGAATGGTGG - Intronic
963424502 3:145109244-145109266 AAAGGCTGGTGAGAATATGGAGG - Intergenic
963662018 3:148138856-148138878 AAATGCTGTTAGGGTTGTGGAGG - Intergenic
964781587 3:160344942-160344964 AAATGCTGGTGAGGATGTGGAGG + Intronic
964908443 3:161747931-161747953 AAAATCTGGTCTGGGTATGGTGG + Intergenic
965165914 3:165194621-165194643 AAGTGCTGGGCGGGGGATGGGGG - Intronic
966122382 3:176536880-176536902 TGCTGTTGGTGGGGGTATGGTGG + Intergenic
966430351 3:179825582-179825604 CAATATTGGTGGGGGTATGCTGG + Intronic
967222460 3:187258888-187258910 ATATTCTGGTGGTGGTAGGGTGG + Intronic
967454723 3:189671389-189671411 AAATGCTGGTGAGGATGTGAAGG + Intronic
967651122 3:191988484-191988506 AAATTCTGGTGAGGCTGTGGAGG - Intergenic
968587161 4:1424741-1424763 AAATGCTGGTGAGGATGTGGAGG - Intergenic
969046316 4:4339236-4339258 GCATGGTGGTAGGGGTATGGGGG - Intergenic
969057901 4:4413598-4413620 ACGTGCTGGTGGGGGTGTGCTGG + Intronic
969683242 4:8655010-8655032 AGATGCTGGTGAGGCTGTGGGGG - Intergenic
970417523 4:15874128-15874150 CAATGCTGGTGGAGGAGTGGTGG + Intergenic
970649927 4:18166278-18166300 AAATGCTGGTGAGCGTGTGCAGG + Intergenic
970819805 4:20198695-20198717 AAATTTTGGGGGCGGTATGGAGG - Intergenic
971353085 4:25870085-25870107 ACATGCTGGTAGCTGTATGGTGG - Intronic
971393032 4:26203701-26203723 AAAGCATGTTGGGGGTATGGTGG - Intronic
971557923 4:28037499-28037521 AAATGCTGATAGTGATATGGAGG - Intergenic
973599589 4:52528874-52528896 AAATTTTGGTGGGGTTAGGGAGG - Intergenic
973762207 4:54128144-54128166 AAATGCTGGTGAGGATGTGGAGG - Intronic
973845760 4:54911515-54911537 AAGTGCCTGTGTGGGTATGGTGG - Intergenic
974160484 4:58132108-58132130 AAATGGTGGTGGGGGAATAAGGG - Intergenic
974257749 4:59483590-59483612 AAGTGCTGGTGAGGTTGTGGAGG + Intergenic
974495784 4:62624746-62624768 AAGCGCTGGTGAGGGTGTGGAGG + Intergenic
974688857 4:65269355-65269377 AAATGCTGGTGAGGATGTGAAGG + Intergenic
974743713 4:66042236-66042258 AGATGGTGGTGGGGGGAGGGAGG + Intergenic
975200237 4:71579002-71579024 AAATGTTGGTGAGGGTGTGGAGG + Intergenic
975507260 4:75151297-75151319 AAATGCTGGTGAGGATATAGGGG - Intergenic
975856984 4:78635020-78635042 AAGTGCTGGTGAGGATGTGGAGG + Intergenic
975958881 4:79876614-79876636 CAATTCTAGTGGGTGTATGGTGG + Intergenic
976464235 4:85349541-85349563 AAATGGTGGTGGGGGGTGGGGGG - Intergenic
976527092 4:86105884-86105906 AAATGCTGGTCAGTGTATGGTGG - Intronic
976953747 4:90867683-90867705 AAAGGCTAGTGGAGGTATTGGGG - Intronic
977025799 4:91817796-91817818 AAATGCTGGTGAGGATGTGGAGG + Intergenic
977522196 4:98098960-98098982 AAATGCTGGTGGCAATGTGGAGG + Intronic
977933460 4:102774413-102774435 AAATGCTGGTGAGGATGTGGAGG + Intergenic
979467935 4:121061661-121061683 AATCGTTGGTGGGGGGATGGTGG - Intronic
979887635 4:126049578-126049600 AAATGCTGGTGAGGTTGTGAAGG + Intergenic
980506062 4:133723768-133723790 AAGTGTTGGTGAGGGTGTGGAGG + Intergenic
980692274 4:136310719-136310741 AGATGCTGGAGAGGATATGGAGG - Intergenic
980788417 4:137585326-137585348 ATATGCTTGTGGGAGGATGGGGG - Intergenic
980851660 4:138389549-138389571 AAATGCTGGCGAGGTTGTGGAGG - Intergenic
981297610 4:143150144-143150166 AAATGCTGGTGAGGATGTGGAGG - Intergenic
982101304 4:151970893-151970915 AAATGCTGGTGAGGATGTGGCGG - Intergenic
983714252 4:170757404-170757426 AAATGCTGGTGAGGATGTGGAGG - Intergenic
983798580 4:171898218-171898240 AAGTGCTGGAGAAGGTATGGAGG + Intronic
984422764 4:179546327-179546349 CATTCCTGGTGGGGGTGTGGTGG - Intergenic
986310911 5:6550615-6550637 AAATGTTGGTGTGGGGCTGGTGG - Intergenic
986401747 5:7388811-7388833 AAATGGGGGTGGGAGTAGGGTGG + Intergenic
986503988 5:8430182-8430204 AAATGGGGGTGGGGGAATGGCGG + Intergenic
986726337 5:10600841-10600863 CCATTCTGGTGGGTGTATGGCGG + Intronic
986884810 5:12220257-12220279 GAATGCTGGTGAGGATATAGAGG - Intergenic
987773767 5:22337921-22337943 AAATGCTTGTGAGGGTGTGGAGG + Intronic
988929353 5:36020968-36020990 AAATGCTGGTGGTGTTTTGATGG + Intergenic
989031756 5:37126571-37126593 AAATGCTTGTGAGAGGATGGCGG - Intronic
991007504 5:61844194-61844216 AAGTGGGGGTGGGGGTAGGGAGG + Intergenic
991045970 5:62223173-62223195 AAATTTGGGTGGTGGTATGGAGG - Intergenic
992245102 5:74812807-74812829 AAATGTTGGTGAGGATGTGGAGG + Intronic
992304140 5:75418361-75418383 AAGTGTTGGTGGGGATATGGAGG + Intronic
992493511 5:77269116-77269138 AAATGCTGGCGAGGATGTGGCGG - Intronic
993114848 5:83708064-83708086 AGATGCTGGTGTGGTTGTGGAGG + Intronic
993276362 5:85864827-85864849 AAAGGCTGGTAAGGGTAGGGAGG + Intergenic
993294112 5:86112013-86112035 AAATGCTGATGAGAATATGGAGG - Intergenic
993933238 5:93968792-93968814 AGAAGCTGGTGGGGGAAGGGTGG + Intronic
994891566 5:105642222-105642244 AAATGCTGGTGAGGATGTAGAGG + Intergenic
997158392 5:131581620-131581642 AAATTTTGGGGGCGGTATGGAGG - Intronic
998064367 5:139145606-139145628 AAATGTGGGTGTGGGTGTGGGGG + Intronic
998897689 5:146817371-146817393 AAATGGTGGTGGTGGGATGGAGG - Intronic
999374730 5:151078998-151079020 AAAAACTGGTGGGGGTATCCAGG + Intronic
1001239910 5:170060742-170060764 AAATGCTGGGGTGGGCGTGGTGG + Intronic
1001852983 5:174985529-174985551 AAATACTGGTAGGGGTGTGAGGG - Intergenic
1004323223 6:14649357-14649379 GAATACTGGTGGGGAAATGGGGG + Intergenic
1004381817 6:15139026-15139048 AGATGCTGGTGCGGTGATGGAGG - Intergenic
1004628173 6:17396154-17396176 AAATACTGGTGAGGATGTGGAGG + Intronic
1005058308 6:21751965-21751987 AAAAACTGGTAGGGGTATGGGGG - Intergenic
1005678526 6:28181397-28181419 AAATGCTGGTGGGGGAACGGGGG + Intergenic
1006588670 6:35138088-35138110 AAACGCTGGTGAGGATGTGGAGG + Intronic
1006776590 6:36597594-36597616 AAAGGGGGGTGGGGGCATGGAGG - Intronic
1006965076 6:37975126-37975148 AAGTGTTGGTGAGGATATGGAGG - Intronic
1007694710 6:43724907-43724929 AGATGGTGGTGGTGGTTTGGAGG + Intergenic
1007996737 6:46315685-46315707 AAATTCTGGTGGGGTCAGGGAGG + Intronic
1008061296 6:46999792-46999814 AGTTACTGGTGGGGGGATGGTGG - Exonic
1008212762 6:48745631-48745653 AGATGCTGATGAGGTTATGGAGG + Intergenic
1008412342 6:51194281-51194303 AAATGCTGGTAAGGATGTGGAGG - Intergenic
1009583365 6:65565450-65565472 AGATGCTGGAGAGGATATGGAGG + Intronic
1009788176 6:68365104-68365126 GTATGCGGGTGGGGGTAGGGGGG - Intergenic
1010189823 6:73183602-73183624 AAATGCTGCAGGGGGCAAGGAGG + Intronic
1010251962 6:73716418-73716440 AAATGCTGATGAGGATGTGGAGG - Intronic
1010545825 6:77154354-77154376 AAATGATGGTGAGGATGTGGAGG - Intergenic
1011053476 6:83179801-83179823 AGCTCCTGGTGGAGGTATGGTGG - Exonic
1011363428 6:86552780-86552802 AAAATCCGGTGGGGGTACGGTGG - Intergenic
1011730449 6:90257361-90257383 AAATGTTGGTGAGGATGTGGAGG - Intronic
1012961280 6:105624648-105624670 AAATGTTGGAGGGGGTGAGGTGG + Intergenic
1013107488 6:107038004-107038026 AAATGCTAGGGTGGGCATGGTGG - Intronic
1013555997 6:111258075-111258097 AAATGCTTGGCGGGGCATGGTGG + Intergenic
1013995641 6:116304617-116304639 AAATTCTGGTTGGGGGATTGTGG + Intronic
1014532900 6:122580728-122580750 AAAAGTTGGTGGGGGGAAGGTGG - Intronic
1014682381 6:124447783-124447805 AAATGCTGGTGAGTTTGTGGAGG + Intronic
1015368111 6:132420193-132420215 AGATGCTGGTGAGGCTATGGAGG - Intergenic
1015967907 6:138713231-138713253 AAATCCTGGCTGGGGCATGGTGG - Intergenic
1016171533 6:141024140-141024162 AAATTCAGGTGTGGGTTTGGAGG + Intergenic
1016623236 6:146136419-146136441 AAATGCTGGTGAGGATGTGAAGG - Intronic
1016762550 6:147754189-147754211 AAATGCTGGTGAGGATGTGGAGG - Intergenic
1017165885 6:151408084-151408106 GGATGCTGGTGGGGTTATTGGGG + Intronic
1017487552 6:154917277-154917299 GCATGGTGGTGGGGGTGTGGGGG - Intronic
1018150476 6:160932603-160932625 AAATTCTAGGTGGGGTATGGTGG + Intergenic
1018336354 6:162794109-162794131 AAGTGTTGGTGAGGATATGGAGG - Intronic
1018707772 6:166475493-166475515 AGATGCTGGACGGGGTGTGGGGG - Intronic
1018974235 6:168552822-168552844 ACAGGCTGGTGGGGGGGTGGGGG - Intronic
1019030516 6:169006460-169006482 TAATGCTGGAGGGTGTAAGGAGG + Intergenic
1019403082 7:867503-867525 TGATGCTGGTGGGGATCTGGTGG + Intronic
1020633317 7:10667115-10667137 AGATGCTGGTGAGGCTGTGGAGG - Intergenic
1020734972 7:11936805-11936827 AGATGCTGGTGTGGATGTGGAGG - Intergenic
1021673418 7:23056372-23056394 AAATGCTGGTGAGGATTTGGTGG + Intergenic
1021974039 7:25994612-25994634 AAGTGTTGGTGAGGATATGGAGG + Intergenic
1022537044 7:31104797-31104819 AAATGCTGTGTGGGGCATGGAGG - Intronic
1023195166 7:37629253-37629275 AAATGCTGGCAGGGATGTGGAGG - Intergenic
1023362720 7:39432557-39432579 TAATCCTGCTGGGGGTATCGGGG + Intronic
1024049717 7:45610802-45610824 AGGTGATGGTGGAGGTATGGAGG + Intronic
1024502572 7:50127815-50127837 AAATGCTGGTGAGGATATGGAGG + Intronic
1027705407 7:81527179-81527201 AAATGCAGGTGAGGATGTGGTGG + Intergenic
1028260039 7:88652663-88652685 AAATGCTGGTGAGGATGTCGAGG + Intergenic
1028514860 7:91666288-91666310 AAGTGTTGGTGAGGGTTTGGAGG + Intergenic
1028965340 7:96795809-96795831 AGGTGCTGGTGGGGGTTTGAGGG + Intergenic
1029714981 7:102320751-102320773 CAGTGCAGGTGGGTGTATGGGGG + Intronic
1032558893 7:132867009-132867031 AAATGATGGTATGTGTATGGTGG - Intronic
1032587086 7:133156820-133156842 AGAGGCTGGTGGGGGTTTGTGGG - Intergenic
1033046008 7:137962635-137962657 GAATGCTGGTGGGGGGTGGGAGG - Intronic
1034089737 7:148352694-148352716 AACTGATGGTAGGAGTATGGGGG + Intronic
1034679509 7:152918016-152918038 AAATGCTGGGGAGGGTGTGGAGG - Intergenic
1034732343 7:153399017-153399039 AAATGGAGGTCAGGGTATGGGGG + Intergenic
1035150367 7:156865815-156865837 TAATTCAGTTGGGGGTATGGGGG + Intronic
1035374502 7:158398641-158398663 AAATGCGGGTGGGGAAAAGGTGG - Intronic
1036185449 8:6619015-6619037 AATTGCTGGTGGGATTCTGGGGG - Intronic
1037025380 8:14029180-14029202 AAATGCTGGTGAGGATGTGGAGG + Intergenic
1037168003 8:15854371-15854393 AAATGGTGGTTGAGGTAAGGGGG - Intergenic
1038760723 8:30383031-30383053 AAGTGCTGCTGGGGATAGGGCGG - Intergenic
1039092839 8:33850783-33850805 AGATGCTGGTGAGGCTGTGGAGG - Intergenic
1039889714 8:41676226-41676248 AAGTGTTGGTGAGGATATGGGGG - Intronic
1040977620 8:53211838-53211860 AGATGCTGGTGAGGTTGTGGGGG - Intergenic
1041555007 8:59143637-59143659 GAATGGTGGTGGGGGCAGGGTGG + Intergenic
1041593733 8:59621606-59621628 AAATGTTGGTGAGGTTGTGGAGG - Intergenic
1041891640 8:62876315-62876337 AGATACTGGTGAGGGTGTGGAGG + Intronic
1042451975 8:68957754-68957776 AGATGCTGGTGAGGTTGTGGAGG - Intergenic
1042637810 8:70897520-70897542 AAATGCTGGTGAAGATGTGGAGG - Intergenic
1043585240 8:81760909-81760931 AAGTGGTGGTGGGGGGATGGGGG + Intergenic
1044407825 8:91850168-91850190 AAAGGGTGGTTGGGGTATGAGGG + Intergenic
1044494393 8:92859613-92859635 AAATGCAGGTAGGGATATGATGG + Intergenic
1044497132 8:92899891-92899913 GAATGCTGGTGAGGATGTGGAGG - Intronic
1044994701 8:97828197-97828219 AAATTTTGGGGGTGGTATGGAGG + Intronic
1045525549 8:102938586-102938608 AAAGGCTGGTGAGGGTAGAGAGG - Intronic
1046346251 8:112931947-112931969 AAATGCTGGTGAGGATGCGGAGG + Intronic
1046398914 8:113677740-113677762 AGATGCTGGTGAGGTTGTGGAGG + Intergenic
1046411496 8:113849226-113849248 AGATGCTGGTGAGGTTGTGGGGG - Intergenic
1047128533 8:121990569-121990591 AAATGCTGTCAAGGGTATGGAGG + Intergenic
1048491993 8:134902465-134902487 AAATCCTTGTTGGGATATGGGGG + Intergenic
1048595584 8:135862519-135862541 TCATGATGGTGAGGGTATGGTGG - Intergenic
1049388722 8:142357397-142357419 AAATGATGGTGGGGCGCTGGTGG + Intronic
1050097403 9:2081130-2081152 AATTGTTGGTTGGGGGATGGAGG + Intronic
1050099058 9:2099210-2099232 AATTGGTGGTGGGTGTATGTTGG + Intronic
1050308106 9:4326596-4326618 AAATGCTGGAGAGCGGATGGTGG + Intronic
1050956045 9:11661537-11661559 AAATGTTGGTGGGTGTGTGAAGG - Intergenic
1051172715 9:14335328-14335350 AAGTGCTGGTGAGGATGTGGAGG - Intronic
1052208605 9:25873134-25873156 AAATGCTGGCGAGGATGTGGAGG - Intergenic
1053261370 9:36668056-36668078 AAATGCAGGTCTGGGCATGGTGG - Intronic
1053411859 9:37920972-37920994 AAATGCTGGTGGGAGGACTGTGG - Intronic
1055485706 9:76754563-76754585 GAATGCTTGTGGAGCTATGGTGG + Intronic
1055557832 9:77493106-77493128 CAGTGGTGGTGTGGGTATGGGGG + Intronic
1055612449 9:78037079-78037101 AAATGCTGGGCTGGGCATGGTGG + Intergenic
1056464818 9:86843267-86843289 AAATGGAGGTGGGAATATGGAGG - Intergenic
1056900616 9:90596062-90596084 AAATTTTGGTGGGGAAATGGAGG + Intergenic
1057379356 9:94554413-94554435 CATTGCTGGTGGTGGAATGGGGG - Intergenic
1057399553 9:94711193-94711215 AAATGCTGGTGAGGATGTGGAGG + Intergenic
1057454398 9:95194487-95194509 AAATGCTGGTGAAGATGTGGAGG - Intronic
1058256450 9:102771508-102771530 AAATGCTGGTGAGAATGTGGTGG - Intergenic
1058584837 9:106495809-106495831 AAATGCTGGTGAGGATACAGAGG + Intergenic
1058672778 9:107374539-107374561 AAAGGCTGGTGGGGGTATCTGGG + Intergenic
1059062415 9:111047174-111047196 AGATGCTGGTGAGGTTGTGGAGG + Intergenic
1059277071 9:113106413-113106435 ACATGTTGGTGGGGGGAGGGTGG - Intergenic
1059279180 9:113118138-113118160 ACATGTTGGTGGGGGGAGGGTGG + Intergenic
1059416997 9:114168468-114168490 ATATGCTGGTGAGGGTTTGTGGG - Exonic
1059470597 9:114502522-114502544 AAATGGTGGTGGGGGAAGGCGGG + Intronic
1060308915 9:122441672-122441694 AAGTGTTGTTGGGGGAATGGAGG + Intergenic
1062146346 9:134991923-134991945 AAGGGGTGGTGGGGGGATGGGGG - Intergenic
1203435911 Un_GL000195v1:137129-137151 AGATGCTGGTGAGGCTGTGGAGG + Intergenic
1186171342 X:6880243-6880265 AAATGCTGGGAGGGGGATGAGGG - Intergenic
1186559479 X:10595650-10595672 AGAGGCTGCTGAGGGTATGGGGG + Intronic
1187045792 X:15646789-15646811 ACAGGCTGGTGGGGGGGTGGCGG - Intronic
1187156047 X:16721145-16721167 AGATGGGGGTGGGGGGATGGGGG + Intronic
1187415037 X:19086129-19086151 AAAGGCTGGTGGGTGTGTGGTGG - Intronic
1188148279 X:26641217-26641239 AGATGCTGGTGAGGTTGTGGAGG - Intergenic
1188261119 X:28025363-28025385 AAATGCTGACGAGGTTATGGAGG + Intergenic
1188263810 X:28045563-28045585 AAATGCTGGCGAGGATGTGGAGG - Intergenic
1188264688 X:28057580-28057602 AAATGTTGGCGCGGGTGTGGAGG + Intergenic
1188475252 X:30585424-30585446 AAATACGGGTGGGGGGAGGGGGG - Intergenic
1188526842 X:31096581-31096603 AGATGCTGGTGAGGCTATAGAGG + Intergenic
1188713034 X:33425426-33425448 AGATGCTGGTGGGGTTGAGGAGG - Intergenic
1188729679 X:33631170-33631192 TAATGCTGCTAGGGGGATGGGGG + Intergenic
1188891838 X:35621194-35621216 AAATGTTGGTGAGGATGTGGAGG + Intergenic
1188919581 X:35956175-35956197 GATTACTGGAGGGGGTATGGTGG + Exonic
1189088890 X:38056601-38056623 AAATGCTGGTGAGAATGTGGAGG - Intronic
1189419247 X:40841902-40841924 AATTGATGGTGGAGGTATGTAGG - Intergenic
1189741689 X:44123962-44123984 TAATGTTGGTGGGGGGAGGGGGG - Intergenic
1190451604 X:50587239-50587261 AAATGTTGATGAGGGTATGGAGG + Intergenic
1190667400 X:52707886-52707908 AAATATTAGTGGGGGTAGGGTGG - Intergenic
1190672018 X:52750522-52750544 AAATATTAGTGGGGGTAGGGTGG + Intergenic
1190702226 X:52997561-52997583 AAGGGCTGGAGGGGGTATGGGGG - Intergenic
1190936813 X:55005158-55005180 GAATGGTGGTGGTGGTGTGGTGG + Intronic
1192182222 X:68923228-68923250 AGATGCTGGGGGTGGGATGGGGG - Intergenic
1192559645 X:72118116-72118138 AAATGTTGGTGCGGATGTGGAGG - Intergenic
1192565467 X:72159746-72159768 AAGTGGTGCTGGGGGGATGGGGG - Intergenic
1192763702 X:74122060-74122082 AAATTTTGGGGGCGGTATGGAGG + Intergenic
1193159379 X:78210731-78210753 AAATGCTGGTGAGGATGCGGAGG - Intergenic
1193264692 X:79454518-79454540 AGATGCTGGTGAGGATGTGGAGG + Intergenic
1193417633 X:81242888-81242910 AAATTCTGGTGAGGATGTGGAGG + Intronic
1193710978 X:84879464-84879486 AGATGCTGGTGAGGTTGTGGAGG - Intergenic
1193742759 X:85238061-85238083 AAATGCTGGTGAGTATGTGGAGG + Intergenic
1193760473 X:85459927-85459949 AAAGGGTGGTGGGGGTTAGGGGG + Intergenic
1193765374 X:85522215-85522237 AAATGCTGGTGAGGATGTGGAGG - Intergenic
1193995197 X:88358155-88358177 AAATGCTGGTGAGGATGTGGAGG + Intergenic
1194904110 X:99552175-99552197 AGATGCTGGTGAGGCTGTGGAGG - Intergenic
1195671955 X:107477336-107477358 AAATGCAGGAGGGGGGCTGGGGG + Intergenic
1195862841 X:109399860-109399882 AATTGCGGGTGGGGGGATGCCGG + Intronic
1196157211 X:112443574-112443596 AAATGTTGGTGAAGATATGGAGG - Intergenic
1197123309 X:122916089-122916111 AGATGCTGGTGAGGCTGTGGAGG - Intergenic
1197397753 X:125948586-125948608 AAATGCTTATGGAGTTATGGGGG + Intergenic
1197626247 X:128805202-128805224 AAAAGCTGGTGGCAGGATGGGGG + Intergenic
1197711022 X:129667590-129667612 AAGTGTTGGTGAGGATATGGAGG - Intergenic
1198570761 X:137953643-137953665 AAATGCTGGAGAGGATGTGGAGG - Intergenic
1199114189 X:143970763-143970785 AAATGCTGGTGAGGATGTGGAGG - Intergenic
1199466249 X:148140978-148141000 AGATGCTGGAGAGGGTATGGAGG + Intergenic
1199817924 X:151415923-151415945 AAATACTGGTGAGGGTATGGGGG - Intergenic
1199954696 X:152734137-152734159 GAATGGTGGTGGGGGTGCGGGGG - Intronic
1200314146 X:155113972-155113994 AAGTGTTGGTGGGAATATGGAGG + Intronic
1200428464 Y:3047991-3048013 AGATGCTGGTGAGGTTGTGGAGG - Intergenic
1201332997 Y:12848114-12848136 AGATGCTGGTGAGGTTGTGGAGG - Intronic
1201393371 Y:13522456-13522478 AAATGCTGGCTGTGGTATGGGGG - Intergenic