ID: 924619655

View in Genome Browser
Species Human (GRCh38)
Location 1:245649612-245649634
Sequence GCTCACTTACGGAGGGTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 68}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924619644_924619655 8 Left 924619644 1:245649581-245649603 CCTGCCCTTGAGGTTTCCTCTTA 0: 1
1: 0
2: 4
3: 52
4: 248
Right 924619655 1:245649612-245649634 GCTCACTTACGGAGGGTGGCGGG 0: 1
1: 0
2: 1
3: 5
4: 68
924619645_924619655 4 Left 924619645 1:245649585-245649607 CCCTTGAGGTTTCCTCTTACTCC 0: 1
1: 0
2: 2
3: 16
4: 220
Right 924619655 1:245649612-245649634 GCTCACTTACGGAGGGTGGCGGG 0: 1
1: 0
2: 1
3: 5
4: 68
924619642_924619655 28 Left 924619642 1:245649561-245649583 CCTTAGAGAAGTGGAAGTTTCCT 0: 1
1: 0
2: 0
3: 10
4: 195
Right 924619655 1:245649612-245649634 GCTCACTTACGGAGGGTGGCGGG 0: 1
1: 0
2: 1
3: 5
4: 68
924619646_924619655 3 Left 924619646 1:245649586-245649608 CCTTGAGGTTTCCTCTTACTCCT 0: 1
1: 0
2: 0
3: 44
4: 398
Right 924619655 1:245649612-245649634 GCTCACTTACGGAGGGTGGCGGG 0: 1
1: 0
2: 1
3: 5
4: 68
924619647_924619655 -8 Left 924619647 1:245649597-245649619 CCTCTTACTCCTCCTGCTCACTT 0: 1
1: 1
2: 4
3: 75
4: 781
Right 924619655 1:245649612-245649634 GCTCACTTACGGAGGGTGGCGGG 0: 1
1: 0
2: 1
3: 5
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924619655 Original CRISPR GCTCACTTACGGAGGGTGGC GGG Intronic
902087608 1:13875274-13875296 GCTAACTCACGGGGGGTGGCGGG + Intergenic
903440607 1:23385289-23385311 GCTCACCCAAGGAGGGTGGCGGG - Intronic
903858695 1:26352635-26352657 GCTCACTTAGAGTGGGGGGCAGG - Intronic
905918794 1:41705172-41705194 GCTCACTCACGGAGCCTGGATGG + Intronic
915246425 1:154558868-154558890 GGTCACATGTGGAGGGTGGCAGG - Intronic
920291409 1:204925866-204925888 GCCCACTTAGGGAGCTTGGCAGG + Intronic
923291474 1:232550331-232550353 TCTGACTTGCGGTGGGTGGCTGG - Intronic
924302659 1:242655299-242655321 TCTCAATTACAGAGGATGGCAGG - Intergenic
924619655 1:245649612-245649634 GCTCACTTACGGAGGGTGGCGGG + Intronic
1073064587 10:100750534-100750556 GCTGACTTCCTGAGGGTGCCTGG - Intronic
1083948943 11:65943190-65943212 GCTCACTTAGGGAGGGAGTGTGG + Intergenic
1085755700 11:79199651-79199673 GCTCACTTAAGCAGGGTGGCTGG + Intronic
1100867613 12:98873895-98873917 GCTCACATATGGTGGGTGGGGGG + Intronic
1103156171 12:118686687-118686709 GCTCCCCAACTGAGGGTGGCAGG - Intergenic
1114645075 14:24251163-24251185 GCTCTCTGAAGGAGGGAGGCAGG + Intronic
1118492654 14:66276673-66276695 GCTCACTTAAGGCAGTTGGCGGG - Intergenic
1121043734 14:90773055-90773077 GCTCAGCTAAGGAGCGTGGCAGG + Intronic
1122409828 14:101520203-101520225 ACTCAGTTACGGTGGGTGACTGG - Intergenic
1123586105 15:21762008-21762030 TCTCACATACAGAAGGTGGCTGG - Intergenic
1123622746 15:22204598-22204620 TCTCACATACAGAAGGTGGCTGG - Intergenic
1125790985 15:42365534-42365556 TCTCACTTGCTGATGGTGGCTGG + Intronic
1127273500 15:57422289-57422311 TCTGACTTCCTGAGGGTGGCAGG - Intronic
1134099340 16:11440683-11440705 GCTCCCTTGCCGAGGGAGGCCGG - Intronic
1134551530 16:15141088-15141110 GCTCAGGGATGGAGGGTGGCAGG - Intergenic
1136605616 16:31331407-31331429 AGTCTCTTAGGGAGGGTGGCCGG + Intronic
1139513976 16:67442687-67442709 GCTCACTTATGGTGGGGGGAGGG - Intronic
1155345492 18:24853080-24853102 GCTCACCTTGGGAGGGGGGCGGG + Intergenic
1157431402 18:47630046-47630068 CCTCGCTTACAGAGGGTTGCTGG - Intergenic
927844230 2:26463234-26463256 GCTCACTGATGCAGGGTGGAAGG + Intronic
941413131 2:165185585-165185607 GCTGACACACTGAGGGTGGCAGG + Intronic
942922643 2:181395143-181395165 GAACATTTACGGAGGGTGGCAGG - Intergenic
947175622 2:227364387-227364409 GCTCATTTAATGGGGGTGGCGGG - Intronic
948908002 2:240988984-240989006 GCACACATGGGGAGGGTGGCTGG + Intronic
1175721084 20:61287753-61287775 CCTCACTTAGGGGGAGTGGCTGG - Intronic
1175969542 20:62677502-62677524 GCTCACTTCCTTAGGGTGGCAGG + Intronic
1180036103 21:45251040-45251062 GCTGACTTACCCATGGTGGCCGG + Intergenic
1184317769 22:43710471-43710493 GCTCACTTTTGGAGGATGCCAGG + Intronic
953989917 3:47475980-47476002 GCGCACGTGCGGAGGGCGGCGGG - Exonic
953998131 3:47536286-47536308 TCTCACTTCTGGTGGGTGGCTGG - Intergenic
964718528 3:159748550-159748572 GCACAGTGAAGGAGGGTGGCAGG - Intronic
964866813 3:161271213-161271235 GCTCACTCACAGAGTGTTGCAGG - Intergenic
967554030 3:190833753-190833775 GCACACACACGCAGGGTGGCAGG - Intergenic
968436492 4:593070-593092 GCTCACTGGAGGAGCGTGGCGGG + Intergenic
968764146 4:2459381-2459403 GTTGAGTCACGGAGGGTGGCGGG - Intronic
968785774 4:2621341-2621363 GATCACCTACTGAGGGAGGCTGG - Intronic
969377035 4:6769582-6769604 GCTCACTCCCCGAGGGTGGGTGG + Intergenic
971998811 4:34001834-34001856 GCTCACTTAAGAAGGCTGGGGGG - Intergenic
972888435 4:43522779-43522801 GGTGACTTTTGGAGGGTGGCAGG - Intergenic
981847925 4:149191085-149191107 GCTCACAGACGGATGGTGGGGGG + Intergenic
984350613 4:178587670-178587692 GCTCAATTAGGAAGAGTGGCTGG + Intergenic
984719874 4:182959563-182959585 GATCAGATACGGAGGGTGGGAGG + Intergenic
988891123 5:35618124-35618146 GCGCACTCAGGGAAGGTGGCGGG + Intronic
990556446 5:56941421-56941443 GCCCACTTCCAGAGGGTAGCAGG + Intronic
991636522 5:68711332-68711354 GCTCAGCTACGGCAGGTGGCAGG + Intergenic
997780362 5:136651984-136652006 GCACACTTAAGGGGTGTGGCTGG - Intergenic
998406324 5:141876601-141876623 TCTGACTTACAGAGGGTAGCTGG + Intronic
999400103 5:151257856-151257878 ACTCACTTACATAGGGTGGTGGG - Intronic
1001749719 5:174119437-174119459 GCTTACTTAAGGAATGTGGCAGG - Intronic
1002927765 6:1614725-1614747 GCGCGCTGAGGGAGGGTGGCAGG + Intergenic
1004653403 6:17634286-17634308 GCTAACTTACAGGGAGTGGCAGG - Intronic
1015390967 6:132681315-132681337 GCTCACTCACGGCGGTTGCCAGG - Intergenic
1026734475 7:72940977-72940999 GCTCACCTGGGCAGGGTGGCAGG - Exonic
1026784807 7:73295885-73295907 GCTCACCTGGGCAGGGTGGCAGG - Intergenic
1027109269 7:75424043-75424065 GCTCACCTGGGCAGGGTGGCAGG + Exonic
1029276608 7:99408808-99408830 CCTCACTTCCGGTGGGTGGCAGG - Exonic
1030167469 7:106569677-106569699 GCTAACTTAAAGAGAGTGGCGGG - Intergenic
1039819793 8:41125480-41125502 GCTCACTTAGGTAGGGTTGGAGG - Intergenic
1042075813 8:64993479-64993501 CCTCTCTTAAGGAGGCTGGCTGG + Intergenic
1047665040 8:127082319-127082341 CCTCACTTATGGAAGGTGGGAGG - Intergenic
1053097669 9:35342598-35342620 GCACACATCCAGAGGGTGGCTGG - Intronic
1054806491 9:69400873-69400895 GCTCACTTATGCAGTGTGGATGG + Intergenic
1056992676 9:91425077-91425099 GCCCAAATACGGAGTGTGGCAGG + Intergenic
1057199788 9:93133946-93133968 GCCCACTTGCCGGGGGTGGCTGG + Intronic
1057664580 9:97034905-97034927 CCTCCCTTATGGAGGGTGGTAGG - Intronic
1058835182 9:108854146-108854168 GCTCCCATATTGAGGGTGGCAGG + Intergenic