ID: 924620174

View in Genome Browser
Species Human (GRCh38)
Location 1:245653507-245653529
Sequence ATTCTGACAACCTGTGACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924620171_924620174 13 Left 924620171 1:245653471-245653493 CCTCACAAGCTCTGCTAAATGCC 0: 1
1: 0
2: 0
3: 13
4: 129
Right 924620174 1:245653507-245653529 ATTCTGACAACCTGTGACATAGG 0: 1
1: 0
2: 0
3: 16
4: 173
924620173_924620174 -8 Left 924620173 1:245653492-245653514 CCTTATGGATATTTCATTCTGAC 0: 1
1: 0
2: 1
3: 18
4: 194
Right 924620174 1:245653507-245653529 ATTCTGACAACCTGTGACATAGG 0: 1
1: 0
2: 0
3: 16
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924620174 Original CRISPR ATTCTGACAACCTGTGACAT AGG Intronic
900412149 1:2517509-2517531 ACCCTGACAGCCTGTGACACGGG + Intronic
903701918 1:25255475-25255497 ATTTTTACAACCAGTGAAATGGG + Intronic
906116413 1:43359957-43359979 GTTCTGATAACCTGTGGCAACGG - Exonic
907652537 1:56309545-56309567 ATCCTGAAAACCTGTGGCTTTGG + Intergenic
908122933 1:61002882-61002904 ATTCTGACAACATATAACAAAGG + Intronic
909340532 1:74526466-74526488 GTTCTTATAACCTGTGACTTTGG + Intronic
910864670 1:91777249-91777271 ATTGTGACAGCCTGTGACACTGG - Intronic
910978804 1:92937950-92937972 ATTCTGTGAAGCTGTGACCTGGG - Intronic
911151775 1:94603268-94603290 ATTCTCACATCCTGTGAAGTAGG - Intergenic
911446585 1:98001140-98001162 AATTTCACAACCTGTGAAATAGG - Intergenic
912657318 1:111498731-111498753 ATCCTGACAATCTGTGAGGTAGG - Intronic
912736504 1:112153691-112153713 AGTCTGTCAGCCTGAGACATGGG + Intergenic
913825935 1:123153186-123153208 ATTCTGACATCTTGTGGCCTTGG + Intergenic
913854693 1:123669275-123669297 ATTCTGACATCTTGTGGCCTTGG + Intergenic
913893971 1:124372929-124372951 ATTCTGACATCTTGTGGCCTTGG + Intergenic
913915923 1:124766680-124766702 ATTCTGACATCTTGTGGCCTTGG + Intergenic
915615171 1:157032162-157032184 TTTCTGTCTACCTCTGACATAGG - Intronic
918702224 1:187619700-187619722 ATTCTGACAAACTAAGCCATAGG + Intergenic
920123378 1:203675157-203675179 GTTCTTAAAACCTGTGACATGGG + Intronic
921623340 1:217350787-217350809 AATTTGACATTCTGTGACATTGG + Intergenic
924603889 1:245515797-245515819 ATTCTGAAAGCCAGTGGCATGGG + Intronic
924620174 1:245653507-245653529 ATTCTGACAACCTGTGACATAGG + Intronic
1064214255 10:13386339-13386361 ATCCTGCCCACCTGTGAGATGGG - Intergenic
1064800973 10:19071458-19071480 ATTCTGTCAGCCTTTGACATAGG - Intronic
1066460017 10:35604993-35605015 ATTCTGAATTCCTGTGTCATTGG - Intergenic
1066982301 10:42428697-42428719 ATTGTCACAACCTGGGTCATGGG + Intergenic
1070313560 10:75291225-75291247 ATTCTGAGAAACTGTAACACAGG - Intergenic
1072001890 10:91204203-91204225 ATTCTGACAAGCTTTGCAATAGG + Intronic
1074463087 10:113656428-113656450 GTCCTGACAACCTGTGCCAGAGG - Intronic
1075345886 10:121681755-121681777 ATTCTGAGAACCAGAGACACTGG - Intergenic
1076857665 10:133125213-133125235 ATTCTGACAACCTCTGCCTTTGG + Intronic
1078493109 11:11787707-11787729 ATCCTCACAACCTGTGATGTAGG - Intergenic
1079857125 11:25619503-25619525 GTTCTGACAACCTTTTCCATTGG - Intergenic
1079910602 11:26305328-26305350 ATTCAAACAACTTCTGACATTGG + Intergenic
1080361841 11:31523837-31523859 TTTCTGACAGTCTGTTACATTGG + Intronic
1081223999 11:40498686-40498708 ATTCTGAAAACTTGTTTCATGGG - Intronic
1084902966 11:72323762-72323784 ATTAGGACAACTTGTGAGATAGG + Intronic
1090834378 11:130443413-130443435 CTTCTGCCTACCTGTGAAATTGG - Intergenic
1090837142 11:130461980-130462002 AGCCTGAAAACCTCTGACATGGG + Intronic
1090934228 11:131327520-131327542 ATTCTGACAACCTAGGTCCTAGG + Intergenic
1091813349 12:3418006-3418028 ATCCTCACAACCTGTGAAGTAGG - Intronic
1101841609 12:108331516-108331538 ATTCTGTCTAACAGTGACATTGG - Intronic
1101867898 12:108535836-108535858 ATACTTACAAACTGTGACTTGGG + Intronic
1107826145 13:44330650-44330672 ATTCTCACAACCTGTGAGGCAGG + Intergenic
1110100985 13:71601825-71601847 ATTCTGGCAACCCATAACATGGG - Intronic
1110848631 13:80218622-80218644 ATGCTGACCACCTGTGATATAGG + Intergenic
1111776519 13:92670189-92670211 ATTCTGACAACTTTACACATTGG - Intronic
1112099518 13:96171618-96171640 ATTCTGAGAACCTCTGCCACAGG - Intronic
1113217262 13:108056776-108056798 ATTCTAATCATCTGTGACATAGG + Intergenic
1116750606 14:48878794-48878816 ATTTTAACTACTTGTGACATTGG - Intergenic
1118410164 14:65470188-65470210 ACTCTGAGAACCTGCCACATTGG + Intronic
1118768612 14:68926966-68926988 ATTATGATACCCTGTGACTTTGG + Intronic
1119053082 14:71389954-71389976 ATCTTGACAACATGTGACAAAGG - Intronic
1122802023 14:104235915-104235937 TCTCTCACAGCCTGTGACATGGG - Intergenic
1123663690 15:22589164-22589186 CTTCTGACAAAATGTGAAATGGG - Intergenic
1124233160 15:27964478-27964500 ATTCTGCCATCCAGTGACACAGG - Intronic
1124565926 15:30813895-30813917 CTTCTGACAAAATGTGAAATGGG + Intergenic
1124970340 15:34483617-34483639 ATTCTGACAACTTTACACATAGG - Intergenic
1130019439 15:80215611-80215633 AATCTAAAAAGCTGTGACATTGG - Intergenic
1139162402 16:64527192-64527214 ATTCTGTCAGCCTGTGAGAATGG - Intergenic
1141108062 16:81249845-81249867 ATTTTGCCAATCTGTGGCATAGG + Intronic
1141131879 16:81443090-81443112 CTTCTCACACCCTATGACATAGG - Intergenic
1143299564 17:5899611-5899633 GTCCTGACAACCTGTGAGCTGGG + Intronic
1148728661 17:49816221-49816243 ATTCTGAGAACCTGTAGCCTAGG + Intronic
1149542161 17:57475675-57475697 GTTCTGACACCCTGAGACATGGG - Intronic
1150020230 17:61604403-61604425 TTTCTGTCAACGTGTCACATCGG - Intergenic
1150986640 17:70205453-70205475 ATTCTGACATTCTGTGATCTCGG - Intergenic
1152469747 17:80484111-80484133 ATTGTGCCTAACTGTGACATGGG - Intergenic
1154106120 18:11524649-11524671 ATTTTGACCAACTGTGGCATTGG - Intergenic
1154957794 18:21276362-21276384 ATTCACACAACCTGGGAAATGGG + Intronic
1155681796 18:28495874-28495896 ATTCTGGCAATCTTTGGCATGGG + Intergenic
1156359778 18:36374406-36374428 ATTCTGATAACCAGTGCAATTGG - Intronic
1160358342 18:78247559-78247581 ATTCTGAAAGCCTATGATATAGG + Intergenic
1163332663 19:16651022-16651044 ATTGTGACAGCCAGTCACATGGG + Intronic
1202639990 1_KI270706v1_random:73800-73822 ATGCTCACAACCTGTGTGATGGG - Intergenic
925672127 2:6322172-6322194 ATTCTTACAACCCATGAAATTGG - Intergenic
927237955 2:20894493-20894515 AATCTGACAACCTTTGCCTTTGG + Intergenic
929858334 2:45654034-45654056 ACTCTGAAAACCTGTGATTTTGG + Intronic
935730616 2:106062288-106062310 AGTCTGACAATGTGTGACAATGG + Intergenic
938550275 2:132374045-132374067 ATTCTGACAACCTCTGACTATGG - Intergenic
938600505 2:132833884-132833906 ATTCTGCGAAACAGTGACATTGG + Intronic
941207753 2:162595201-162595223 ATTCTGGCACCCTGTGAAAAAGG - Intronic
944445484 2:199784419-199784441 TTGCTGCCAACCTGTGCCATGGG + Intronic
945252006 2:207771610-207771632 ATTCTTCCAACCTGTGCCAATGG - Intergenic
945579250 2:211572346-211572368 ACGCTAACAATCTGTGACATTGG + Intronic
945620018 2:212124452-212124474 TTTCTGACAAGCTGTGAACTAGG - Intronic
945837574 2:214850911-214850933 ATTCTTACAATCTGTGTCAGTGG + Intergenic
946251456 2:218416247-218416269 TTTTTCATAACCTGTGACATAGG + Intergenic
946598364 2:221331901-221331923 TTTATAACAACATGTGACATCGG + Intergenic
946638933 2:221762492-221762514 ATTCCCACAATCTGTGAAATGGG + Intergenic
1169382118 20:5116959-5116981 ATTCCTACAGCCTGTGACTTTGG + Intronic
1169543436 20:6626855-6626877 ATTCTTACAACCTCTGAAACTGG + Intergenic
1171063607 20:21991384-21991406 ATTGTTGCAAACTGTGACATTGG - Intergenic
1171232267 20:23496874-23496896 ACTCTGACCACCTGTGAGCTGGG - Intergenic
1171492490 20:25531182-25531204 ACTCTGACCACCTGTGAGCTGGG - Intronic
1173562122 20:44013391-44013413 ATTCTCACAAGTTGAGACATAGG + Intronic
1175713327 20:61238871-61238893 ACTCTGATAACCTGAGAGATTGG + Intergenic
1176648323 21:9371392-9371414 ATGCTCACAACCTGTGTGATGGG - Intergenic
1183178229 22:36239774-36239796 GTTCTGACTGCCTGAGACATGGG - Exonic
1183482343 22:38072005-38072027 TTTCTGACAACCTGTAACTCTGG + Intronic
1183805130 22:40202846-40202868 ATGCTGACAAGCTGTAACTTTGG - Intronic
949161458 3:888101-888123 TTTCTGTCAAGCTGTGAAATTGG + Intergenic
949503586 3:4705313-4705335 ATGCTGACAACGGGTGACAATGG - Intronic
949729150 3:7087802-7087824 ATTCTCACTACCTTTGAGATAGG - Intronic
949873634 3:8609742-8609764 ATAATGACAATATGTGACATTGG + Intergenic
950016712 3:9759643-9759665 ATTCACACAACCTGTGAGCTGGG - Intronic
953682365 3:45049374-45049396 ATGCTGGCAATCTGTGAGATAGG - Intergenic
953769117 3:45765371-45765393 CTTCTCACAACCTGGGACCTGGG - Intronic
955560680 3:60186405-60186427 ATTCAGTCAACCTTTGACAAGGG - Intronic
957576870 3:82018869-82018891 ATTCTGACAACATGTGCCCAAGG - Intergenic
957900397 3:86481632-86481654 TGGCTGACAACCAGTGACATGGG - Intergenic
960493051 3:118340700-118340722 ATTCTGACAACTTGTGTCAAGGG - Intergenic
960559025 3:119062052-119062074 ATTCTAATAACCTGTGAAGTAGG - Intronic
962130308 3:132666047-132666069 ATGCTGACAAGATGTGGCATTGG + Exonic
965382583 3:168008195-168008217 ATTCTGCCAGTCTGTGACTTTGG - Intergenic
966062512 3:175776316-175776338 ATTCTTTCAACCTGTAACATTGG + Intronic
966124263 3:176556998-176557020 GTTTTGACAAAATGTGACATAGG - Intergenic
967123744 3:186406608-186406630 TTTCTAACAACATGTGACCTGGG + Intergenic
1202738561 3_GL000221v1_random:33592-33614 ATGCTCACAACCTGTGTGATGGG + Intergenic
970682668 4:18528545-18528567 ATGCTCACTACCTGGGACATGGG - Intergenic
972031807 4:34469492-34469514 ATTCTGACAGATTCTGACATGGG + Intergenic
974798903 4:66789613-66789635 ATTCTGAGAACCAGTGTCAATGG - Intergenic
975519284 4:75281386-75281408 ATACTGACAACCTGCGATAAAGG + Intergenic
1202767350 4_GL000008v2_random:159659-159681 ATGCTCACAACCTGTGTGATGGG - Intergenic
985854611 5:2415342-2415364 ATGCTTACAAGCTGTCACATGGG - Intergenic
987830000 5:23083991-23084013 GGTCTGATAACCTGTGAAATGGG + Intergenic
988206563 5:28143923-28143945 ATTATGAAAAGCTTTGACATAGG + Intergenic
989432505 5:41372240-41372262 TTTCTGAAAAACTGTGGCATAGG - Intronic
990037791 5:51343441-51343463 ATTCTGAAGACCAGTAACATGGG - Intergenic
991999301 5:72419378-72419400 CTTCTGAGAACCTGTGATCTAGG + Intergenic
993354306 5:86887013-86887035 ATTCTGAAAACCTGCCACAGAGG - Intergenic
993543355 5:89180148-89180170 ATTCTGGCAACCAGTGAAGTTGG + Intergenic
993719289 5:91306246-91306268 ACTCTGATAACCTATGACAAAGG + Intergenic
994112593 5:96023585-96023607 ATGCTAAAAACCTGTGAAATGGG + Intergenic
994557487 5:101322145-101322167 TTTCTCACTACCTGTGCCATAGG + Intergenic
995257733 5:110066310-110066332 ATACTGACAAACTGTATCATTGG + Intergenic
996587265 5:125103510-125103532 TCTCTGACAACTTTTGACATGGG - Intergenic
997626384 5:135333996-135334018 CTTCTGACAGTCTGTGACTTAGG - Exonic
998182972 5:139958155-139958177 AGTCTTACAGCCTGTGAAATAGG + Intronic
1004586185 6:17002985-17003007 CTTCTGAGAGCCTGTGACCTGGG - Intergenic
1009446039 6:63743306-63743328 ATTCAGACAACCTCTGACTTAGG + Intronic
1016641201 6:146351541-146351563 TTTTTGATCACCTGTGACATAGG + Intronic
1016653214 6:146486976-146486998 AGTCTGATAAGCTGAGACATGGG - Intergenic
1018230419 6:161669998-161670020 AGTCTGGCATCCAGTGACATAGG + Intronic
1020387790 7:7626647-7626669 ACTCTGACCACCTGTGAGCTGGG - Intergenic
1020771801 7:12404354-12404376 CTTCTGAAAACCTGTCACAGAGG - Intergenic
1021025990 7:15667417-15667439 ATGGTGACAATCTGTGACAGAGG - Intronic
1022341264 7:29470477-29470499 ATTTTGAAAACCTGTTTCATAGG + Intronic
1024969618 7:55056493-55056515 ATTCTAACAATATGTGAAATGGG - Intronic
1025257413 7:57394003-57394025 CTTGTAACACCCTGTGACATTGG + Intergenic
1027215417 7:76180296-76180318 ATTCTGAGAAACTGGGACTTAGG + Intergenic
1027704107 7:81508121-81508143 TTTCTGATAACATATGACATTGG + Intergenic
1029503948 7:100950702-100950724 ACTCTGACAAATTGTGAAATGGG + Intronic
1030298159 7:107949378-107949400 ATTCTGTCAGCATGTGTCATTGG - Intronic
1030463314 7:109868117-109868139 ATGCTCACTACCTGGGACATGGG + Intergenic
1032646957 7:133835304-133835326 ATTCTGACAACATGTGCCCAAGG + Intronic
1032995391 7:137440319-137440341 ATTATGAGAAAATGTGACATTGG + Intronic
1033505262 7:141993620-141993642 ATTCTGAAAGCCTGTGAACTTGG + Intronic
1035053900 7:156020987-156021009 TATCTGACAACCTTAGACATAGG + Intergenic
1035332705 7:158106736-158106758 CTTCTGTGAACCTGTGACCTGGG - Intronic
1037489627 8:19385890-19385912 ATTCTGCCCACCTGTCACAAAGG + Intronic
1040892056 8:52327420-52327442 ATTCTGACTACCTGTGATGAAGG + Intronic
1043394139 8:79820241-79820263 ACACTGATAAGCTGTGACATCGG - Intergenic
1044122889 8:88419536-88419558 ATTCTGACAATCTGAGACAATGG + Intergenic
1044140990 8:88652183-88652205 GTTCTGACAAACTGTGACACAGG + Intergenic
1044485671 8:92750663-92750685 CATCTGAAAACCTGAGACATGGG + Intergenic
1044806663 8:96015449-96015471 ATTGCAACAACCTGTGAAATAGG - Intergenic
1046339408 8:112832634-112832656 ATTCTGACAACAAGTGAGCTTGG + Intronic
1049288621 8:141790187-141790209 ATTCTAACAGCCTCTGACAGTGG - Intergenic
1051286177 9:15499282-15499304 ACTCTTACAAGCTTTGACATTGG - Intronic
1052127458 9:24795182-24795204 ACACAGACAACCTGTGAAATGGG + Intergenic
1052171082 9:25397319-25397341 ATTCTGAGAACCTGTGGCCAAGG - Intergenic
1052336859 9:27329250-27329272 GTTCTGACCACCTGTGACGAGGG - Exonic
1053330022 9:37196392-37196414 ATTTGAACAACCTGTGACAAAGG - Intronic
1055067382 9:72132346-72132368 ATTATTATATCCTGTGACATGGG - Intronic
1055884801 9:81048856-81048878 ATTTTAACAACCTTTGACATTGG + Intergenic
1057756038 9:97836657-97836679 ATTCTGACTACCTGGGTAATGGG - Intergenic
1061101246 9:128494204-128494226 ATTCAGACAACCTGTAAAATAGG - Intronic
1203707293 Un_KI270742v1:64039-64061 ATGCTCACAACCTGTGTGATGGG + Intergenic
1203548104 Un_KI270743v1:144531-144553 ATGCTCACAACCTGTGTGATGGG - Intergenic
1186037032 X:5434975-5434997 ATTCTGACAGACTGTGCTATGGG + Intergenic
1186706660 X:12146847-12146869 ATTCTGAGAACCTGTAAGATAGG + Intronic
1188597320 X:31917254-31917276 ATTCTGGGAAACTGTGACTTAGG + Intronic
1191114167 X:56834484-56834506 ATTCTGAAAGCCTGAGACACTGG + Intergenic
1191937462 X:66440700-66440722 ATTCTAGCAACCTGTGACCTTGG + Intergenic
1193962416 X:87941985-87942007 ATTCTGTCAACCTGCAATATTGG - Intergenic
1195232543 X:102865272-102865294 ATGCTGACATCCTATCACATAGG + Intergenic
1195952074 X:110285644-110285666 ATCCTAACCACCTGTGAGATTGG - Intronic
1196607512 X:117672799-117672821 ACTCTGACACCATGTGACCTTGG + Intergenic
1201676580 Y:16592509-16592531 ATTCTTGCAACCTGGGTCATTGG + Intergenic