ID: 924622551

View in Genome Browser
Species Human (GRCh38)
Location 1:245674734-245674756
Sequence GGCTGAGTTACTGCAAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924622549_924622551 3 Left 924622549 1:245674708-245674730 CCTAGAGCTAATAAGTTGTACAT 0: 1
1: 1
2: 2
3: 8
4: 163
Right 924622551 1:245674734-245674756 GGCTGAGTTACTGCAAAGAAAGG 0: 1
1: 0
2: 1
3: 11
4: 166
924622548_924622551 12 Left 924622548 1:245674699-245674721 CCTTTCTGACCTAGAGCTAATAA 0: 1
1: 0
2: 0
3: 6
4: 252
Right 924622551 1:245674734-245674756 GGCTGAGTTACTGCAAAGAAAGG 0: 1
1: 0
2: 1
3: 11
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924622551 Original CRISPR GGCTGAGTTACTGCAAAGAA AGG Intronic
900583726 1:3422534-3422556 GGCTGACTGACTGCTGAGAAAGG - Intronic
901457784 1:9373273-9373295 GGCTGAGTGACTGGGGAGAAGGG + Intergenic
903380823 1:22895933-22895955 GGCTGAGGTGCTGGAAAGACAGG + Intronic
904754673 1:32761489-32761511 GGCTGAGCTCCTGCCAAGATGGG - Intronic
907419501 1:54337330-54337352 GGGTGGGTTATTGCAAAGCAAGG - Intronic
907952767 1:59199691-59199713 GACTGAGTTCCTTCAAAGCAAGG - Intergenic
917012164 1:170487342-170487364 GGCTGAGTCACTTCCAAAAAGGG - Intergenic
920499893 1:206479462-206479484 GTCTGAGCTCCTGGAAAGAAGGG + Intronic
920678113 1:208052439-208052461 GGTTGAGTGACAGCACAGAAGGG + Exonic
922566889 1:226606863-226606885 TGATGAGTTAATGCAAAGCAGGG - Exonic
922748645 1:228060658-228060680 GGCTGGGCAGCTGCAAAGAAGGG - Exonic
924089512 1:240487825-240487847 GGCACAGTTATTGCAAAGAGGGG + Intergenic
924250927 1:242132348-242132370 TTCTGAATTACAGCAAAGAACGG - Intronic
924622551 1:245674734-245674756 GGCTGAGTTACTGCAAAGAAAGG + Intronic
1065700265 10:28418436-28418458 CCCTGAGTGACTGCAAGGAATGG + Intergenic
1067666976 10:48287415-48287437 GGGTGACTTACTGAAAAGACTGG - Intergenic
1067678293 10:48406420-48406442 GCCTGGGTGACTGCAAAGAAAGG + Intronic
1068853716 10:61774489-61774511 GGCTAAGTTGTTGTAAAGAATGG - Intergenic
1072276373 10:93827328-93827350 GGCTGTGATGCTTCAAAGAAAGG + Intergenic
1074734989 10:116421792-116421814 GGCTGAGAGACTCCTAAGAATGG - Intergenic
1075533277 10:123248535-123248557 GGCTTAGTGTCTGCACAGAAAGG - Intergenic
1083754130 11:64780306-64780328 GGTTGAGAGACTGCAAAGACAGG + Intergenic
1083764116 11:64833968-64833990 GGCTTGGTGTCTGCAAAGAAAGG + Exonic
1085046701 11:73357705-73357727 GCTTGAGTTACTGCAAGCAAAGG + Intronic
1096456361 12:51790558-51790580 AGTAGAGTTACTGCAAAGGAAGG + Intronic
1101770048 12:107741106-107741128 GGCCAAGTCACAGCAAAGAAAGG - Exonic
1102057524 12:109907797-109907819 GGCTGAGATTCTGCAAAGGGCGG + Intronic
1104405623 12:128514035-128514057 GGCGGAATTACTGCACAGCAGGG + Intronic
1106351282 13:28932959-28932981 GGCATAGTTTCTGCACAGAAGGG + Intronic
1107895779 13:44961195-44961217 GACTGAGTTTTTGCAAAGATAGG + Intronic
1107919748 13:45192912-45192934 GGCTGAGTTCCCACAAAGCATGG - Exonic
1108006372 13:45950844-45950866 GGCTGATTTCCTGCAAACAATGG + Intergenic
1108984871 13:56574144-56574166 GTCTAAGTTACTGAAATGAAGGG - Intergenic
1110804351 13:79736876-79736898 GGCTGAATGACAGCAAAAAATGG + Intergenic
1112392206 13:98995837-98995859 GGCTGAGTTAGTGCAAATTGAGG + Intronic
1116302063 14:43195480-43195502 GGCTGGGTTATTATAAAGAAAGG - Intergenic
1117462179 14:55956143-55956165 GGCTGAGTTACAGTTAAGGATGG + Intergenic
1117560572 14:56933775-56933797 GACTGAGGTCCTCCAAAGAAGGG - Intergenic
1124157923 15:27244329-27244351 AGGAGACTTACTGCAAAGAAGGG + Intronic
1124444123 15:29714004-29714026 AGCTGTGTTAATGAAAAGAAGGG + Intronic
1128073161 15:64809970-64809992 GGCTGAGTTAGTGTAGAGCAGGG - Intergenic
1128612264 15:69083687-69083709 GTCTGAGTTACTGCAGAGGAAGG + Intergenic
1128942862 15:71802626-71802648 AGCCGGGTGACTGCAAAGAAAGG + Intronic
1129019473 15:72503546-72503568 TGCTTAGTTACGGGAAAGAATGG - Intronic
1129419054 15:75408579-75408601 AGCTGTGTTACATCAAAGAAGGG + Intronic
1129751300 15:78066464-78066486 GGCTGGGATGCTGGAAAGAAAGG + Intronic
1130937053 15:88479485-88479507 GGCTGTGTTAGGACAAAGAAAGG + Exonic
1131136857 15:89943446-89943468 GGCAGATATACTGCAAAGAAAGG + Intergenic
1131215820 15:90534401-90534423 GGCTGAGCTACTGAGAAAAATGG + Intronic
1131443194 15:92474246-92474268 GGCTGGGTTACTGCAGGGAAGGG + Intronic
1131846845 15:96497326-96497348 GGAAGACTTACTGCAAAGAGGGG + Intergenic
1134332292 16:13262220-13262242 TGCTCAGTTTCTGAAAAGAATGG + Intergenic
1147933995 17:44001190-44001212 GGCTGAGATGCGGCCAAGAAGGG + Intronic
1148108108 17:45130136-45130158 TGCTGAGTGACTGCAGAGAGAGG - Intronic
1148875777 17:50686377-50686399 GGCTGTGATACAGCAAGGAAAGG - Intronic
1149447661 17:56726107-56726129 GGCTGAGTTCTTGCAGAGCAAGG - Intergenic
1150381769 17:64726461-64726483 TGCTGAGTTACTTCACTGAATGG - Intergenic
1150774495 17:68068429-68068451 TGCTGAGTTACTTCACTGAATGG + Intergenic
1155004753 18:21718707-21718729 GGGTGAGTTACTGGCAAGACAGG + Intronic
1157097846 18:44702732-44702754 GTCTCAGTTACTACAAAGACTGG - Intronic
1157149141 18:45197568-45197590 TGCTGAGTCACTGCTGAGAAGGG - Intergenic
1158311883 18:56168047-56168069 GGCTGAGAAAGTGCAGAGAATGG + Intergenic
1160019429 18:75168883-75168905 GGCTGAGTTCCTGAGAAGGAAGG - Intergenic
1168415801 19:56167402-56167424 AGCTGAGTTAGGGGAAAGAAAGG + Intergenic
1168523066 19:57067995-57068017 GGCTGGGCCACTGCAGAGAAAGG + Intergenic
925040490 2:729784-729806 GCCTGAGTCAATGCAAAGACCGG - Intergenic
925267591 2:2577402-2577424 TGCTGTGTTCCTGCAAACAATGG - Intergenic
925614901 2:5735540-5735562 GGCCAAGTGACTGCAATGAAAGG - Intergenic
930953494 2:57174381-57174403 GCCAGGGATACTGCAAAGAAGGG - Intergenic
932518337 2:72378465-72378487 GGCTGTGATCCTTCAAAGAAGGG - Intronic
933230923 2:79806462-79806484 GGAGGAGTTACTGGGAAGAAAGG + Intronic
933715545 2:85357063-85357085 GTCTGAGTGACTGCCAAGGAAGG + Exonic
934012246 2:87835338-87835360 GACTGAGTTGATTCAAAGAACGG - Intergenic
937062882 2:118993256-118993278 TGCTGGGTTACTCCAAAGGAAGG + Exonic
937289086 2:120771138-120771160 GGCTGAGATCCTGCAAAGCCAGG - Intronic
939478249 2:142714359-142714381 GGTAGAGTTTCTGCAAAGACTGG + Intergenic
940852660 2:158703057-158703079 GGCTCAGGTACTGGGAAGAATGG + Intergenic
942509281 2:176679426-176679448 AGCTAAGATACTGAAAAGAATGG - Intergenic
945620212 2:212126806-212126828 GGATGAGTTCCTGCAGAGGAAGG + Intronic
946249316 2:218403061-218403083 GGATGAGTTCCTGCAGCGAATGG + Exonic
946940518 2:224765046-224765068 GGGTGAGTTACTGAGAAAAATGG - Intergenic
948175664 2:235940595-235940617 GTCTGGGTAACCGCAAAGAATGG - Intronic
948313271 2:237005945-237005967 GGCTGAGTTATTTTAAAAAAAGG - Intergenic
1168786738 20:545829-545851 GGCTGAAGCACTGCAAATAAAGG + Intergenic
1169689753 20:8317148-8317170 GGCTGAATGACATCAAAGAATGG + Intronic
1169969240 20:11251192-11251214 GGAAGAGTTTCTGCAAAGATAGG + Intergenic
1173367351 20:42399007-42399029 GACTGAGTTTCTTCACAGAAAGG + Intronic
1173817170 20:45997223-45997245 GGCTGAGCTATTGCAAAAACAGG + Intergenic
1173852044 20:46224883-46224905 GTCTGAGTGACTGTCAAGAAAGG + Intronic
1174039513 20:47688955-47688977 TGCTGAGTCACTGCTAAGCAGGG + Intronic
1174160165 20:48545007-48545029 GGCTGTGTTTCTGCAGGGAAAGG - Intergenic
1175132035 20:56796558-56796580 TTCTGAGATACTGCACAGAAAGG + Intergenic
1175609742 20:60340588-60340610 GGCAGAGGACCTGCAAAGAAAGG + Intergenic
1176071716 20:63230331-63230353 TGCTGGGTTGCAGCAAAGAAGGG + Intergenic
1179009695 21:37546699-37546721 GGTGGAGTTACAGCAAAGAACGG + Intergenic
1179121493 21:38550169-38550191 TGCTGAGTCACAGGAAAGAAGGG + Intronic
1179275448 21:39888243-39888265 TGCTGAGATTCTGCAAAGGAAGG - Intronic
1179538294 21:42066837-42066859 GGCTAAGAGACTGCAAAGAAAGG - Intronic
1180185744 21:46138428-46138450 GGCTGAGTTGCTGGAGAGCACGG - Intronic
1182873446 22:33669087-33669109 GGCTCAGTTGCTGCAAAGCAAGG - Intronic
951049724 3:18080624-18080646 AGCAGAGTTACTTCAATGAAGGG + Intronic
955231536 3:57103281-57103303 GGCTGAGTTTTGGAAAAGAATGG + Intronic
955252534 3:57298647-57298669 GGTTTAGATACTGCAAAGAAAGG - Intronic
955496750 3:59541455-59541477 ACCTGAGTTACTGAATAGAATGG + Intergenic
955701962 3:61690491-61690513 GGAGGAATTACTGCAAAGAGTGG + Intronic
958942556 3:100332058-100332080 GGCAGAGCTGCTGCAGAGAAGGG + Intergenic
959453292 3:106529149-106529171 GGCTCAGTTACTAAATAGAATGG - Intergenic
961226777 3:125256729-125256751 GGATAATTTACTGCATAGAATGG - Intronic
964199401 3:154101150-154101172 GGTTGAGTTACTACGATGAAGGG - Intergenic
965002442 3:162971814-162971836 GTCTCAGTAATTGCAAAGAATGG - Intergenic
967621940 3:191643808-191643830 GACTGAGTTAATTCAAATAACGG - Intergenic
970951238 4:21758060-21758082 TGCATACTTACTGCAAAGAAAGG + Intronic
972695487 4:41441386-41441408 TTCTGAGTTTCTGTAAAGAAAGG + Intronic
975986395 4:80204399-80204421 CACTGAGTTCCTGAAAAGAAGGG + Intergenic
976419673 4:84826826-84826848 GGCTGAGGTACTGCAAATCCAGG + Exonic
979928497 4:126598669-126598691 TGCTGGGTTTCTCCAAAGAAAGG + Intergenic
981118855 4:141024675-141024697 AGCAGAGCTACAGCAAAGAATGG + Intronic
983601995 4:169541452-169541474 GTCAGAGTTACTGATAAGAAAGG + Intronic
983708971 4:170691407-170691429 GGCTGAGTTATTCCACAGAGAGG - Intergenic
983972226 4:173889683-173889705 GGCTGAATGACAGCAAAGATGGG + Intergenic
985885473 5:2674234-2674256 GGCTTAGTGACTGCAACTAAGGG - Intergenic
986049601 5:4076573-4076595 GGTTGAGTTACTGATTAGAATGG + Intergenic
986380498 5:7180751-7180773 GGATGCGTTATTACAAAGAAAGG - Intergenic
989995017 5:50818988-50819010 GGCTGACCTGATGCAAAGAAAGG - Intronic
992534413 5:77684353-77684375 GGCTGGGTGAGTTCAAAGAAAGG - Intergenic
993346900 5:86795383-86795405 AGCAGAGTTACTGCTATGAAAGG - Intergenic
994044443 5:95292065-95292087 TGCAGAGTAACTGTAAAGAAAGG - Intergenic
997847085 5:137296454-137296476 GGATGGGTGACTGCAAAGCATGG + Intronic
998649561 5:144102818-144102840 TGCTGGGTTAATGCAAAGACAGG + Intergenic
999863675 5:155677931-155677953 GGCTGAGTTCCTGCCCACAAAGG + Intergenic
999885830 5:155921517-155921539 GGCTGAGACTCTGGAAAGAAAGG + Intronic
1001653998 5:173335410-173335432 AACTGAGTTACACCAAAGAAAGG - Intergenic
1002610720 5:180416672-180416694 GACTGACTTACTGCTGAGAAAGG - Intergenic
1009274215 6:61654590-61654612 GGCTTAGTTACAGCAAGAAATGG + Intergenic
1011381921 6:86751171-86751193 AGATGAGTTCCTTCAAAGAATGG + Intergenic
1013791615 6:113843801-113843823 GGCTGGCTTACTGGAAAGAAAGG + Intergenic
1013842949 6:114419861-114419883 AGCTGAGTTATAGCAAGGAAAGG - Intergenic
1015787642 6:136934212-136934234 GGCTGTGGGACTGGAAAGAAAGG - Intergenic
1016910713 6:149196028-149196050 GGCTGAGTTACCCCAAAGAAGGG + Intergenic
1022597755 7:31728880-31728902 GGCTGAGTAAGTACAAAGAGGGG + Intergenic
1026136011 7:67661408-67661430 GGATCAGTGACTGCAAAGTAAGG - Intergenic
1028257703 7:88620942-88620964 CACTGAGATACTGCTAAGAAGGG + Intergenic
1031644451 7:124206599-124206621 GCCTGACTTACTCCACAGAAAGG + Intergenic
1035842961 8:2832309-2832331 GGCTGATGTACTGCAAGGCAAGG + Intergenic
1036046053 8:5141912-5141934 GGGTGAGTTAGTGAGAAGAACGG - Intergenic
1036057322 8:5270692-5270714 GTGTGAGATACTTCAAAGAAGGG + Intergenic
1036412754 8:8518070-8518092 GCCTGAGTTATTTCAAAGATGGG + Intergenic
1036691020 8:10944835-10944857 GTCAGAGTTGCTGGAAAGAAGGG - Intronic
1037649626 8:20824700-20824722 CTCTGAGTTACTGCATGGAATGG - Intergenic
1038749752 8:30284500-30284522 GGCTGAAGAACTGCAAGGAAAGG - Intergenic
1042312725 8:67394723-67394745 GACTGAGTTACTGCTGAAAATGG - Intergenic
1043448604 8:80343518-80343540 AGATAATTTACTGCAAAGAAAGG - Intergenic
1043534664 8:81189409-81189431 AGCTCAGTTTCTGAAAAGAAGGG + Intergenic
1044339754 8:91033390-91033412 GGTTGAGTCAGTGAAAAGAAAGG - Intronic
1044400984 8:91771688-91771710 GGCTGAATTTCTGCCAATAAAGG + Intergenic
1046607394 8:116387021-116387043 GACTGGGTTATTGTAAAGAAAGG - Intergenic
1047284822 8:123479031-123479053 GGCTGAGTCATTGCATATAAAGG + Intergenic
1047594647 8:126366117-126366139 GGTTCAGATACTGCAAGGAAAGG + Intergenic
1048899359 8:139022806-139022828 GTCTGAGCTACTACCAAGAATGG + Intergenic
1049268197 8:141680793-141680815 GGCTGACTGACTGCACAGGAAGG - Intergenic
1050666828 9:7947598-7947620 GTCTGAGTTACAGCTAAGCATGG - Intergenic
1051034779 9:12731089-12731111 GTCTGAGTTCCAGGAAAGAAAGG + Intergenic
1052377403 9:27732613-27732635 GACTGAGTGACAGCAAGGAAAGG + Intergenic
1055006964 9:71518600-71518622 GGCTGAATTAATGCAAATATTGG - Intergenic
1055502208 9:76912581-76912603 CTCTGAGTTTCTGTAAAGAAAGG + Intergenic
1057258499 9:93569609-93569631 GGCTGTGTTACAGCCAAGACTGG - Intergenic
1057788955 9:98109975-98109997 GGCTGAGTTTCTGTACAGGAGGG + Exonic
1059310519 9:113385832-113385854 GGCTCAGTCACTGTAAACAATGG - Intergenic
1186695306 X:12024033-12024055 GTCTGAATTAGTACAAAGAAAGG - Intergenic
1188011445 X:25060523-25060545 GGCTGAGTTACTCAAAATGAAGG + Intergenic
1189185596 X:39052235-39052257 GGCTGGGTTGCTGCAAATAGAGG + Intergenic
1192016899 X:67340880-67340902 GGGTAAATAACTGCAAAGAATGG - Intergenic
1193440408 X:81534149-81534171 GACTGAGTTAATGCAAAAAGTGG + Intergenic
1194557429 X:95377828-95377850 GGCTGTGTTAGTGAAAAGACTGG + Intergenic
1197650624 X:129059897-129059919 GGCTGGATTGCTGCAAAGAATGG + Intergenic
1198141342 X:133806977-133806999 GGTTCACTTACAGCAAAGAAAGG + Intronic
1199132237 X:144203203-144203225 GACTGAGTTGATTCAAAGAACGG + Intergenic
1199511206 X:148625154-148625176 GGATTAGCTACTCCAAAGAAGGG + Intronic
1200424553 Y:3006870-3006892 TGCTGAGGTTCTACAAAGAAAGG - Intergenic