ID: 924623931

View in Genome Browser
Species Human (GRCh38)
Location 1:245685135-245685157
Sequence CTGGTCAGGCAGGGCCTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 578
Summary {0: 1, 1: 0, 2: 4, 3: 52, 4: 521}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924623919_924623931 29 Left 924623919 1:245685083-245685105 CCAGAGTTCCACGGCACAGGGTG 0: 1
1: 0
2: 0
3: 16
4: 108
Right 924623931 1:245685135-245685157 CTGGTCAGGCAGGGCCTGGATGG 0: 1
1: 0
2: 4
3: 52
4: 521
924623920_924623931 21 Left 924623920 1:245685091-245685113 CCACGGCACAGGGTGCCAAACAT 0: 1
1: 0
2: 0
3: 4
4: 63
Right 924623931 1:245685135-245685157 CTGGTCAGGCAGGGCCTGGATGG 0: 1
1: 0
2: 4
3: 52
4: 521
924623922_924623931 6 Left 924623922 1:245685106-245685128 CCAAACATTGGTGAGCCAGCAGC 0: 1
1: 0
2: 0
3: 12
4: 79
Right 924623931 1:245685135-245685157 CTGGTCAGGCAGGGCCTGGATGG 0: 1
1: 0
2: 4
3: 52
4: 521
924623924_924623931 -9 Left 924623924 1:245685121-245685143 CCAGCAGCCCTTAGCTGGTCAGG 0: 1
1: 0
2: 1
3: 12
4: 161
Right 924623931 1:245685135-245685157 CTGGTCAGGCAGGGCCTGGATGG 0: 1
1: 0
2: 4
3: 52
4: 521

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924623931 Original CRISPR CTGGTCAGGCAGGGCCTGGA TGG Intronic
900383134 1:2395322-2395344 CTGGTCTGGCAGGAGCAGGAGGG - Intronic
900501281 1:3005928-3005950 CTGGGCAGGCAGGGCAGGGGAGG + Intergenic
900594268 1:3473350-3473372 CTGGCCATGCAGAGCCTGGAAGG + Intronic
901053684 1:6438587-6438609 CTGTGCATGCAGGGCCTGGCCGG - Intronic
901819334 1:11816681-11816703 GTGAGGAGGCAGGGCCTGGAGGG + Intronic
901826395 1:11864569-11864591 CTGGTGAGGCTGGACATGGAGGG - Intergenic
901883110 1:12205383-12205405 CAGATCAGACAGGGCCTGGTAGG + Intronic
902232420 1:15036364-15036386 CTGGGCAGGCAGGGCAGGGGAGG - Intronic
902406154 1:16184731-16184753 CTGGTCATGCAGAGCCTTGGTGG - Intergenic
902447374 1:16475922-16475944 GTGGCGCGGCAGGGCCTGGAGGG - Intergenic
902467226 1:16625872-16625894 GTGGCACGGCAGGGCCTGGAGGG - Intergenic
902480620 1:16709744-16709766 CTGTGCATGCAGGGCCTGGCTGG + Intergenic
902507357 1:16946872-16946894 GTGGCGCGGCAGGGCCTGGAGGG + Exonic
902553591 1:17233741-17233763 ATGGTCAGCCAGGGCTTGGGGGG - Intronic
902727733 1:18348404-18348426 CTGCTCTGGCGGGGCCTGGGAGG - Intronic
902802298 1:18838091-18838113 GTGGCCAGACAGGGCCTGGATGG + Intergenic
902882828 1:19384188-19384210 CAGGTCTGGCAGGGTCTTGAAGG - Intronic
902941010 1:19800050-19800072 CTGGCGAGTCAGAGCCTGGAAGG - Intergenic
903223415 1:21881354-21881376 CTGTTCAGGCAGAGCCCAGAAGG + Exonic
903280241 1:22245988-22246010 CTGGCCAGTCTGGGGCTGGAGGG + Intergenic
905033751 1:34904356-34904378 ATGGTCAGCCAGGGCCGGGATGG - Exonic
905267511 1:36765002-36765024 TTGCTCAGCCAGGCCCTGGAGGG - Intergenic
905359792 1:37411340-37411362 CTGGTCAGGGTGGGTGTGGAGGG - Intergenic
905400476 1:37699040-37699062 CTGCTCAGGCAGCGCCTTGTTGG + Intronic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
907324248 1:53626478-53626500 CAGGTCAGGGAGGGCCTCCACGG - Intronic
907403895 1:54241955-54241977 CTGGGCAGGCAGGGCAGGGGTGG + Intronic
908007183 1:59739004-59739026 CTGGTCAGGTACTGCCTTGAAGG + Intronic
911401190 1:97377754-97377776 CTGGTCAGGCAGGGCAAGACAGG + Intronic
912373853 1:109194369-109194391 CTGGTCAGGAAGGGCCTTGAGGG - Intronic
912955987 1:114154281-114154303 ACGGTCAGGCAGGGTCTGGGAGG + Intergenic
915004956 1:152627283-152627305 CTGGTCAAGAAAGTCCTGGAGGG + Intergenic
915091090 1:153426947-153426969 CTGCTGAGCCAGGGCCTGGGTGG + Intergenic
915276168 1:154789680-154789702 CAGGACAGGCAGGGCCTTGGGGG + Intronic
915318017 1:155040634-155040656 CTGCACAGGCAGAGCCTGGGGGG + Intronic
915589247 1:156861230-156861252 CTGGTCAGGCAGGACGAGCACGG + Intronic
915625026 1:157109169-157109191 CTGGTCAGGGAGAGCCAGGAAGG + Intergenic
916336291 1:163674343-163674365 CTAGTCTGGCAAGGCCTGGGAGG - Intergenic
917517762 1:175722149-175722171 ATGGCCAGGGAGGGCCCGGAGGG - Intronic
917843680 1:179002938-179002960 TCGGTCAGGGAGGGCCTGCAGGG - Intergenic
919860671 1:201737723-201737745 CTCAGCAGGGAGGGCCTGGAAGG - Intronic
919971201 1:202580407-202580429 CTGGTCAGGGAGGGCCAAGGAGG + Intronic
920290894 1:204922362-204922384 CTGGTCAGGCAGGAGGTGGCAGG - Intronic
921670299 1:217917459-217917481 CTGCTCAGACAGGCCCTGGCGGG + Intergenic
922724736 1:227917585-227917607 AGGGGCAGGCAGGGTCTGGAAGG + Intergenic
923010857 1:230086374-230086396 CTGGTGAGGTAGGGCAAGGAGGG + Intronic
923573801 1:235140390-235140412 CGGGGCCGGCAGGGCCTGCAGGG - Intronic
923616870 1:235545442-235545464 CAGGGCAGGCAGGGCCTTGGAGG + Intergenic
923878242 1:238074694-238074716 CCTGTTAGGGAGGGCCTGGAAGG - Intergenic
924623931 1:245685135-245685157 CTGGTCAGGCAGGGCCTGGATGG + Intronic
1062873886 10:930971-930993 GGGGTCGGGCAGGGCCTGGGCGG - Intronic
1062982573 10:1737387-1737409 CTGGTCAGGGAGGGCGGGGAAGG + Exonic
1065089534 10:22218125-22218147 CTGTTGAGGCAGGGACTGGTAGG - Intergenic
1066478668 10:35773665-35773687 CTGATCAGGGAGGTCCTGCAAGG + Intergenic
1067038919 10:42938378-42938400 GGGGCCAGGGAGGGCCTGGAAGG - Intergenic
1067472101 10:46544936-46544958 CTTGTCAGGCAGGGCAGGGCTGG - Intergenic
1069636067 10:69925750-69925772 CTGGACCGGGAGGGCCGGGAGGG - Intronic
1069749781 10:70737660-70737682 CTGGCCTGGCAGGTCCTTGATGG + Intronic
1069824536 10:71246977-71246999 GTGATCAGACAGGTCCTGGACGG - Intronic
1069909928 10:71752716-71752738 GTGGTCAGCCTGGGCCAGGATGG - Intronic
1070606053 10:77899198-77899220 CCAGTCTGGGAGGGCCTGGATGG - Intronic
1071531470 10:86392768-86392790 ATGGTCCGGCAGGGCTGGGATGG + Intergenic
1071671628 10:87614360-87614382 CTGGCCAGGCAGAGCCCTGAGGG + Intergenic
1071816277 10:89235189-89235211 CTGGTCAGGCAGCTCCTCCAAGG + Intronic
1072736206 10:97881378-97881400 GTGGTCAGGGAGGGCCTCGGGGG - Intronic
1073060889 10:100732911-100732933 CAGGTCAGGCTGGGGCTGGCTGG - Intergenic
1073414372 10:103368598-103368620 CCGGTAAGGCAGGGGCTGGCAGG + Intronic
1073509562 10:104034706-104034728 CTGGTCCCCCAGGGCCTCGAGGG - Exonic
1074309408 10:112309175-112309197 CAGGGCAGGCAGGGCATGGTTGG + Intergenic
1075078910 10:119369828-119369850 CTGGACAGGCAGTCGCTGGAAGG - Intronic
1075210643 10:120488097-120488119 TTATTCAGGAAGGGCCTGGATGG + Intronic
1075661841 10:124202695-124202717 CTGGAGAGGCAGGGTCTGCATGG + Intergenic
1076687768 10:132205810-132205832 CTGCACAGGCGGGGCCTGGCTGG + Intergenic
1076729203 10:132429813-132429835 CTGGGCAGGCAGGGGCAGGGTGG + Intergenic
1076923544 10:133468108-133468130 AGAGCCAGGCAGGGCCTGGAAGG - Intergenic
1077186390 11:1237178-1237200 CTTGGCAGGCAGGGTCTGGTGGG + Intronic
1077416254 11:2425670-2425692 CAGGTGTGGCAGGGCCTGGTGGG - Intergenic
1078059100 11:8031994-8032016 CTGCTCGGGAAGGGGCTGGAGGG + Intronic
1078090361 11:8261240-8261262 CTGGACAGGCTGGGGATGGAGGG + Intronic
1078335069 11:10456765-10456787 CTTGTCAGGCCTGGCCTGGCAGG + Intronic
1079982032 11:27161355-27161377 CTGGTCAGGGAGGCACTGCAGGG - Intergenic
1080635275 11:34118266-34118288 CTGGGGAGGCAGGGCCTCCATGG - Exonic
1080742687 11:35080858-35080880 CAGGTCAGGGAGGGCCGTGAGGG - Intergenic
1081596719 11:44464323-44464345 CTGGTCATCCAGGAGCTGGAAGG + Intergenic
1081784026 11:45733728-45733750 AGGGTCATGCAGGGCCTGGGAGG - Intergenic
1082278603 11:50246836-50246858 CTGGAGGGGCAGGGCCTGGCAGG - Intergenic
1083338976 11:61946296-61946318 CAGCTGAGGCAGGGCCTAGAAGG + Intergenic
1083741347 11:64713104-64713126 CTGGGCAGCCAGGGCCTGCGCGG - Exonic
1084029251 11:66471433-66471455 GTGGGCAGGTAGGACCTGGAAGG - Intronic
1084108492 11:66997191-66997213 GAGGTCAGGCAGGGCGTGGTGGG + Intergenic
1084192747 11:67506228-67506250 GTGGGCAGCCTGGGCCTGGAGGG - Intronic
1084651394 11:70491409-70491431 ACCGGCAGGCAGGGCCTGGAGGG + Intronic
1084942061 11:72618213-72618235 CAGAGCAGGCAGTGCCTGGATGG - Intronic
1084977538 11:72810860-72810882 CAGATCAAGCAGGGCCTTGAAGG + Intergenic
1085239007 11:75036400-75036422 CTGGTAAGGCAGGGCCTCCTGGG + Intergenic
1085445310 11:76597426-76597448 CTGGGCAGGGAGGGCCTGGGAGG - Intergenic
1085455141 11:76661296-76661318 CAGGTGGGTCAGGGCCTGGAAGG + Exonic
1086173805 11:83866002-83866024 GTGGTCAGGGAGGTCATGGAAGG - Intronic
1088738987 11:112751484-112751506 CAGGCCAGGCCAGGCCTGGAAGG - Intergenic
1089762504 11:120738643-120738665 CAGGGCAAGCAGGGCCTGAAGGG + Intronic
1090719507 11:129458910-129458932 CAGGTCAGCCACGGCCAGGAGGG + Intergenic
1091079898 11:132656638-132656660 CTGGTCATGCATGCTCTGGAGGG - Intronic
1091143720 11:133258820-133258842 CTGGGCAGGCAGGGGCAGGCTGG - Intronic
1091777091 12:3191619-3191641 CAGGGCAGGCAGGGCCAGCAGGG - Intronic
1092102848 12:5900663-5900685 GTGGTCAGGCTGTGCCAGGATGG - Intronic
1094486007 12:30926595-30926617 CTGGGCAGGCGGGGACTAGAGGG + Intronic
1095909270 12:47409372-47409394 CAGATCATGGAGGGCCTGGAAGG - Intergenic
1095955899 12:47805792-47805814 CTGGTCTGGCCTGGCCTGGCTGG - Intronic
1096072016 12:48780678-48780700 CTGGCCAGGCATGGGCTGGGTGG - Intronic
1096220526 12:49826037-49826059 CTGGTATAGCAGGGCCTGGGAGG + Intronic
1096513910 12:52146102-52146124 CTGGGAAGGCAAGGCTTGGAGGG + Intergenic
1096771738 12:53939680-53939702 CGGGGCAGGCAGGGCGGGGAGGG - Intronic
1096846396 12:54409411-54409433 TGGGTAAGGCCGGGCCTGGAGGG - Intronic
1098651617 12:72977568-72977590 CTGGTCAGGCAGGTTATGGGAGG + Intergenic
1099471717 12:83058443-83058465 CTGGTCTCTCAGGGCCAGGAAGG - Intronic
1100721880 12:97368035-97368057 CTGGTTTGGCTGGGGCTGGATGG + Intergenic
1101176239 12:102154819-102154841 CAGGACTGGGAGGGCCTGGAAGG - Intronic
1102458566 12:113086434-113086456 CAGGTCACACAGGGTCTGGAAGG + Intronic
1102459893 12:113093706-113093728 CGTGTGAGGCAGGGCGTGGAGGG - Intronic
1103212959 12:119179677-119179699 CTGGTAAGTCAGGGGCAGGAGGG + Exonic
1103324392 12:120110822-120110844 CTGCTCAGCCTGGGCCTGCAGGG + Intronic
1103743322 12:123105970-123105992 CAGGACAGGCAGGGCCAGGAAGG - Intronic
1103898448 12:124289962-124289984 CAGCTCAGACAGGGCCTGTAAGG + Intronic
1104044150 12:125149937-125149959 CTGGGGAGGTAGGCCCTGGACGG + Intergenic
1104749066 12:131227042-131227064 CAGCTCAGGCAGGTCCTAGAAGG + Intergenic
1106289112 13:28344178-28344200 CTGGCCAGGCAGGGTCTCGTAGG - Intronic
1106346066 13:28879439-28879461 GTGGTAGGGCAGGGCCTGGTGGG + Intronic
1106444328 13:29811578-29811600 CTGGTGAGGAATGGCATGGAGGG - Intronic
1108703707 13:52965977-52965999 CAGGTCAGGCAGGGCCTCATAGG - Intergenic
1112778050 13:102866696-102866718 CTGATCAGTCAGGTCCAGGATGG - Exonic
1113586520 13:111469706-111469728 GTGGTCAGGACGAGCCTGGAAGG - Intergenic
1114203246 14:20542697-20542719 CTGGTGAGGCAGTGTTTGGAAGG - Intergenic
1114455525 14:22851055-22851077 CTGGGCAGCCAGGGCCTGGAAGG + Intergenic
1115341341 14:32295958-32295980 CTGGTCAAGCAGTATCTGGAAGG + Intergenic
1117050132 14:51851538-51851560 TTGATCAGGCAGGGTCTTGATGG - Intronic
1117611160 14:57484728-57484750 CAGGTCATGCAGGGCCTGACAGG + Intronic
1118866754 14:69710475-69710497 CAGCTCAGGCATGGCCTGCAAGG - Intronic
1119064613 14:71512735-71512757 CAGGATAGGGAGGGCCTGGAAGG - Intronic
1119215926 14:72869010-72869032 CTGGTCATGAAGGGCCTTGATGG - Intronic
1119718926 14:76878135-76878157 CAGGTCAGGTGGGGCCTTGAGGG + Intergenic
1121731513 14:96190443-96190465 CTTGTCAGGCAGGGACTGCAGGG + Intergenic
1122273100 14:100577243-100577265 CAGGTCAGCCAGGGCCTGTGGGG + Intronic
1122476957 14:102016974-102016996 CATGTCAGGCAAGGCCCGGAGGG - Exonic
1122664542 14:103319382-103319404 CAGGTTAGGGAGAGCCTGGAAGG - Intergenic
1122690161 14:103528473-103528495 CGGGGGAGGCAGGGCCTGGGCGG + Intergenic
1123016684 14:105379032-105379054 ATGGTCGGGAAGGGCCTGGGTGG + Intronic
1123016698 14:105379089-105379111 GTGGTCTGGAAAGGCCTGGATGG + Intronic
1123036413 14:105473762-105473784 GTGGTCAGGCACGCCCTGGTTGG + Intronic
1123412947 15:20074210-20074232 CAGGACACGCAGGGCCTGGATGG - Intergenic
1123414262 15:20083521-20083543 GTGGTAGGGCAGGGCCTGGCTGG - Intergenic
1123522289 15:21081323-21081345 CAGGACACGCAGGGCCTGGATGG - Intergenic
1123523604 15:21090632-21090654 GTGGTAGGGCAGGGCCTGGCTGG - Intergenic
1123998215 15:25733598-25733620 CAGGGCTGTCAGGGCCTGGATGG - Intronic
1125597836 15:40899032-40899054 CTGGTCAGTCACTGCCTGGGTGG + Intronic
1125709657 15:41774608-41774630 CTGGTGAGGCTGGGCCCGAACGG + Exonic
1126099657 15:45111687-45111709 CGGGCCTGGCAGGGCCTGGAGGG - Intronic
1126103874 15:45135350-45135372 CGGGCCTGGCAGGGCCTGGAGGG + Intronic
1126952249 15:53893963-53893985 CTGGTGGGGCAGGCACTGGAGGG + Intergenic
1127816251 15:62611645-62611667 CTGGGTAGTGAGGGCCTGGAAGG - Intronic
1128280928 15:66393652-66393674 CTGGTCAGGTAGGGCCTTGTAGG - Intronic
1129771192 15:78204514-78204536 CTGTCCAGGCAGGGGCTGGGTGG + Intronic
1129771609 15:78206587-78206609 ATGGCGAGGCAGGGCCTGGGTGG - Intronic
1130275283 15:82472979-82473001 CTGGACAGGCGTGGCCAGGAAGG + Intergenic
1130415771 15:83693387-83693409 CTGGCCAGGCTGGAGCTGGAGGG + Intronic
1130467643 15:84200374-84200396 CTGGACAGGCGTGGCCAGGAAGG + Intergenic
1130496622 15:84473168-84473190 CTGGACAGGCGTGGCCAGGAAGG - Intergenic
1130589935 15:85204972-85204994 CTGGACAGGCGTGGCCAGGAAGG + Intergenic
1131099086 15:89673912-89673934 CTGGTCAAGCAGAGTCTTGAAGG - Intronic
1131386317 15:92011063-92011085 CTGGTCATGTAGAGCCTTGAAGG - Intronic
1132321619 15:100929744-100929766 CAGGGCAGGCAGGGCCTTGCAGG + Intronic
1132333354 15:101027497-101027519 CTGGTGAGGGAGGGTCAGGATGG + Intronic
1132392683 15:101450452-101450474 CTGGGCATACAGGGCCTGGGAGG - Intronic
1132625126 16:887965-887987 CTGGTCAGGCAGCTCCCTGAGGG + Intronic
1132673053 16:1109637-1109659 CTGGGCACGCAGGGCCAGGTAGG + Intergenic
1132804562 16:1769545-1769567 CTGCCCAGGCAGAGCCTGGGGGG - Exonic
1133779241 16:8924456-8924478 CTCTACAGGCAGTGCCTGGAAGG + Intronic
1134036155 16:11032830-11032852 CAGGTCATGAAGGGCCTTGAAGG + Intronic
1134666411 16:16022150-16022172 CAGGTCAGGCAGGGCGTGGGTGG + Intronic
1134819910 16:17238627-17238649 CTGGTCATGCAGGACCTTGTAGG - Intronic
1136056730 16:27695311-27695333 CAGGTCATGCAGGGCCTTGCAGG - Intronic
1136428343 16:30183723-30183745 CAGGTGAGGCTGGGCCTGGGAGG + Exonic
1136570826 16:31095537-31095559 CTGGTGAGGCAGGACCCGGGAGG - Intronic
1138010436 16:53373835-53373857 CGGGTCCGACAGGGCATGGAAGG + Intergenic
1138378613 16:56584538-56584560 CAGGTCATGTAGGGCCTGAATGG + Intergenic
1138465351 16:57186173-57186195 CTGGCCAGTCTGCGCCTGGAGGG + Intronic
1139607908 16:68033012-68033034 CTGATCATGCAGGGCCTTGTGGG + Intronic
1139990827 16:70938289-70938311 CTGGTCAGGGGGGGCCAGCAGGG + Intronic
1140476792 16:75242978-75243000 CAGGACACGCAGGGCCTGGACGG - Exonic
1141239755 16:82254589-82254611 CTGGGCAGGGAGGCCCTGGCTGG - Intergenic
1141902645 16:87002712-87002734 CTGGTCATGGGGGCCCTGGAGGG - Intergenic
1141920409 16:87132083-87132105 TTGCTCAGGCAGGACCTGCAGGG - Intronic
1142024952 16:87807382-87807404 CCAGCCATGCAGGGCCTGGAAGG + Intergenic
1142034277 16:87854088-87854110 CTGGGCAGGCAGGGTCAGGCTGG - Intronic
1142181834 16:88674935-88674957 CTGGGCGGGCAGGGGCTGGGAGG - Intergenic
1142197094 16:88743999-88744021 CGGGGCAGGGAGGCCCTGGAAGG - Intronic
1142298568 16:89243007-89243029 ATGGTCAGGAAGGTCCTGGAGGG - Intergenic
1142351464 16:89582710-89582732 CTGGCCAGGCCGGCCCTGGTTGG + Intronic
1142713692 17:1736746-1736768 CTGCTCAGGGAGGCCCAGGAGGG + Intronic
1142741672 17:1935160-1935182 TTGGTCAGTGACGGCCTGGACGG - Exonic
1143971815 17:10801389-10801411 CAGATCTGGCAGGGCCTCGAGGG - Intergenic
1144628505 17:16857758-16857780 CTGGTCTGGAGAGGCCTGGAGGG + Intergenic
1144654785 17:17028624-17028646 CTGGTCTGGAGAGGCCTGGAGGG - Intergenic
1144738757 17:17569484-17569506 GTGGCCACGCAGGGCTTGGAAGG + Intronic
1144781245 17:17809668-17809690 ATGGGCAGCCAGGGGCTGGAGGG + Intronic
1144837995 17:18167582-18167604 GTAGTCAGGCAGGACCTGCAGGG - Exonic
1145056786 17:19708199-19708221 CGGCACAGGCAGGGCCAGGATGG + Intronic
1145102341 17:20087587-20087609 CTGGTGGGGCAGGGCCAGGGAGG + Intronic
1145160093 17:20568329-20568351 CTGGTCTGGAGAGGCCTGGAGGG + Intergenic
1146272738 17:31495034-31495056 ATGGACAGGCAGGCCCTGGCTGG - Intronic
1146373797 17:32281189-32281211 CAGGGCAGGCAGGCCCTGGTGGG + Intronic
1147158320 17:38556612-38556634 CTGGGCAGGGAGGGCCTTCATGG + Intronic
1147307485 17:39573880-39573902 CTGGCCAGGCAGGGCGGGGATGG + Intergenic
1147363196 17:39944199-39944221 CAGGACAGGCAGGTGCTGGAAGG - Exonic
1147564447 17:41527828-41527850 CTTGTCCCGCAGGTCCTGGATGG + Exonic
1148330694 17:46812258-46812280 AGGGACAGGGAGGGCCTGGATGG + Intronic
1148451512 17:47781119-47781141 CTAGTAAGGGAGGGCCTGAAGGG - Intergenic
1149525928 17:57355704-57355726 GGGGGCAGGCAGGGCCTGGCGGG + Intronic
1149650006 17:58270905-58270927 CTGGGCTGGCAGGGCATCGATGG + Intronic
1149816634 17:59731651-59731673 TGGGTCAGTCAGGGCCTGTAAGG + Intronic
1151349055 17:73520738-73520760 AGCTTCAGGCAGGGCCTGGAGGG + Intronic
1151455241 17:74222000-74222022 CCACTGAGGCAGGGCCTGGAAGG - Intronic
1151595701 17:75077049-75077071 CTGCTCAGACACAGCCTGGAGGG - Intergenic
1151967693 17:77439964-77439986 CTGAGCAGGCAGGGCCTGTGAGG + Intronic
1152013642 17:77735735-77735757 CAGGGCAGGCTGGGCCTGGCAGG - Intergenic
1152145107 17:78563747-78563769 CGGAACAGGCAGGGGCTGGAAGG + Intronic
1152190513 17:78884879-78884901 CTGGTCACACAGGGCTTGAAGGG + Intronic
1152248768 17:79200591-79200613 CTGTTCAGGGAGGGCCTTGGTGG + Intronic
1152280845 17:79384133-79384155 CAGGTCAGGCAGGTCCAGGCAGG + Intronic
1152418038 17:80175720-80175742 CTGAACAGGCAGGGCCTGGCTGG + Intronic
1152542279 17:80982320-80982342 CTGACCAGGCTGGGACTGGAAGG + Intergenic
1152872814 17:82767072-82767094 CTCATCAGGCAGGGCTTGGTGGG + Intronic
1153225715 18:2898247-2898269 CTGGTCACCCAGTGCCTGGGAGG - Intronic
1153942043 18:9986799-9986821 CTGGTCAGGGAGCGTCTGGATGG + Intergenic
1154304816 18:13222978-13223000 CTGGCCTGGGAGGGCCTGGGTGG + Intronic
1156587501 18:38447543-38447565 CTTGTCAGGCAGGGCATTGCTGG - Intergenic
1157675527 18:49565797-49565819 CTGGTCAACCACTGCCTGGAGGG + Intronic
1157710344 18:49845898-49845920 CTGCTCAGCAAGGGCCAGGAGGG - Intronic
1158623911 18:59055729-59055751 CAGGTCAGGCTGTGCCTGGATGG + Intergenic
1158960249 18:62582237-62582259 CGGGTTAGGCATGGCCAGGAGGG + Intronic
1160026226 18:75218831-75218853 GTGGTCAGGTAGGGTCTGGGAGG - Intronic
1160565932 18:79786580-79786602 CTGCTGGGGCAGGGCCAGGACGG + Intergenic
1160668016 19:342363-342385 CGGGTCAGGGAAGGCCTGGGGGG + Intronic
1160676335 19:393339-393361 CAGGTCATTCAGGGCCTGGTGGG + Intergenic
1160826267 19:1081978-1082000 GTGGCCAGGCAGAGCCTGGAAGG + Intronic
1160843073 19:1155071-1155093 CTCGCCAGGTAGGGCCTGGTGGG - Intronic
1160944090 19:1633163-1633185 CTGGGCAGGGAGGGCCTGCTTGG + Intronic
1161301596 19:3545370-3545392 CAGGTCGTGCAGGGCCTGGTGGG - Intronic
1161323755 19:3653203-3653225 CTGGGCAGGCAGGGCCAGGGAGG - Intronic
1161361996 19:3855682-3855704 CTGGTCATGGCGGGCCTGGTGGG + Intronic
1161421641 19:4179131-4179153 CTGGTCAGCCAGAACGTGGACGG - Exonic
1161534724 19:4811963-4811985 CAGGTTAAGCAGGGCCTGGTGGG - Intergenic
1161621412 19:5299225-5299247 CAGGTCATGCAGGGCCTTGTGGG - Intronic
1161634238 19:5377234-5377256 CAGGTCATGCAGGGCCTTGTGGG + Intergenic
1161650382 19:5480608-5480630 CAGGTCGTGCAGGGCCTGGTAGG + Intergenic
1161745458 19:6056902-6056924 TTGGCCAGGCAGGGCCAGGCTGG - Intronic
1162015468 19:7844521-7844543 CTGGGCAGGGAGGGGCTGGGAGG - Intronic
1162029294 19:7910430-7910452 CTGCACAGGCAGGGACAGGAGGG - Intronic
1162042842 19:7980783-7980805 CTGGGCAGGCTGGGGGTGGATGG + Intronic
1162378147 19:10316953-10316975 CCGGACAGGCCGGGCCTTGAAGG + Exonic
1162572036 19:11479681-11479703 GTGGCCAGGCAGGGCGTGGCAGG + Intronic
1162762115 19:12894929-12894951 CTGGTCACACAGGGCCTTGTGGG - Intronic
1162909063 19:13839876-13839898 CTGGTCAGGCGGCGCTTGGCCGG - Intergenic
1163530736 19:17847596-17847618 CTGGACCGGGAAGGCCTGGAGGG + Intronic
1163783094 19:19260812-19260834 ATGGTCAAGCTGGACCTGGAAGG - Exonic
1164519646 19:28968838-28968860 CTGGTCATGCAAGGCATTGATGG + Intergenic
1165161923 19:33821284-33821306 CTAGCCAGGCTGGGGCTGGAAGG - Intergenic
1165245051 19:34493917-34493939 CTGGCCTGGCAGGGGATGGAGGG - Intronic
1165356643 19:35308398-35308420 GTGGTCAGGCAGGGCCTGAGGGG + Intronic
1165932667 19:39370006-39370028 CTGGGGAGGCAGGGCCAGGCTGG + Exonic
1166199907 19:41230870-41230892 CTGGTCAGGCAGGCCATGGTAGG + Intronic
1166317472 19:41997219-41997241 CTGGGCAGGCGGGCCCTGGAGGG + Intronic
1167118406 19:47501529-47501551 CTGGACATGCAGCTCCTGGAGGG - Intronic
1167245253 19:48369258-48369280 CAGGCCAGGGAGGGCATGGAAGG + Intronic
1167325087 19:48819479-48819501 CAGATCAGGCAGGGCCTTGAAGG - Intronic
1167467339 19:49657305-49657327 CTGGTCACCCAGGGGATGGAGGG - Intronic
1167608939 19:50496871-50496893 CTGGCCTGGCCTGGCCTGGAGGG + Intergenic
1167611264 19:50508667-50508689 CTGGGCAGGCAGGACATGGGAGG + Intronic
1168544937 19:57242419-57242441 CTGCTGAGACATGGCCTGGAAGG + Intronic
1202714659 1_KI270714v1_random:35652-35674 CTGTGCATGCAGGGCCTGGCTGG + Intergenic
925344500 2:3161067-3161089 GTCCTCAGGCAGGGCCTGAAAGG + Intergenic
926146044 2:10397657-10397679 TAGCTCAGGCAGGGCCAGGAAGG - Intronic
927211306 2:20640702-20640724 CTGGCCAGGAAGGCCATGGATGG + Intronic
928405387 2:31010710-31010732 CTGATCAGGCAGGGCCTTGGGGG - Intronic
928440788 2:31290228-31290250 CAGGTCATGCAGGGCCTTAAAGG - Intergenic
932512176 2:72303851-72303873 GTGGTCAGGCAGGGGCAGGATGG + Intronic
932760893 2:74438589-74438611 CAGATCATGCAGGGCCTTGAAGG - Intronic
935209389 2:100925390-100925412 CCGGTAAGGCTGGGCCTGGCTGG - Intronic
935331810 2:101982845-101982867 CTGGTGAGGGTGGGCCTGGCAGG + Intergenic
935827766 2:106968664-106968686 CTGGTTAGTTGGGGCCTGGAGGG - Intergenic
937205048 2:120231026-120231048 CCGGTCAGCCAGGGCCTTGAAGG - Intergenic
937853454 2:126656207-126656229 CTGGCCAGGCCGGGCCAGGCCGG - Exonic
937885474 2:126896826-126896848 CTGGAAAGGCAAGGCCTGGAAGG - Intergenic
937901899 2:127025729-127025751 ATGCTCAGGCAGGACCCGGATGG - Intergenic
938378546 2:130823986-130824008 CTGGGCAGGCGGGGACTGCAGGG - Intergenic
940683556 2:156818299-156818321 CTAGCCAAGCAAGGCCTGGAAGG - Intergenic
942455682 2:176136766-176136788 CCGGCGAGGGAGGGCCTGGAAGG + Intergenic
942613172 2:177762855-177762877 TTGGTCAGGCGGGTCCTTGAAGG + Intronic
945251619 2:207769666-207769688 CTGGCCAGGCCGGGACTGCATGG + Intergenic
945658844 2:212659452-212659474 CTGGTCAGGCAGGGACAGAGAGG + Intergenic
946326044 2:218985201-218985223 CGGGTCCGGCAGGGCCTGGCGGG + Exonic
946333979 2:219025532-219025554 CAGGTCAGGCAGGGCTTCTAAGG + Intronic
946448605 2:219760978-219761000 CTGGTCAGGCTGTGGCTGGAGGG + Intergenic
947671648 2:231940761-231940783 CGGGTCATGCAGGACCAGGATGG - Intergenic
947757076 2:232574251-232574273 CTGGTTTGCCAGGGCCTGGGAGG + Intronic
948247302 2:236497266-236497288 CTGATCAGGAAAGTCCTGGACGG - Exonic
948373110 2:237503261-237503283 CTGCCAAGGCAGGGCCTGGAGGG + Intronic
948461780 2:238133111-238133133 TGGGGCAGGCAGGGCCGGGAAGG + Exonic
948622723 2:239246514-239246536 CTGCTCAGCCAGCGCCTGGCCGG - Intronic
948789197 2:240368686-240368708 CAAGACAGGCAGAGCCTGGAGGG + Intergenic
948814432 2:240502633-240502655 CTGGGCAGCCAGGGCCAGGGTGG - Intronic
948876354 2:240831840-240831862 CTGGAAGGTCAGGGCCTGGAGGG + Intergenic
948912174 2:241010217-241010239 CAGGGCAGGGTGGGCCTGGAGGG - Intronic
949030468 2:241794514-241794536 CTGATCAGGCAGGGCCATCAGGG - Intronic
1168856855 20:1014671-1014693 CTGGTTGGACAGGGGCTGGAGGG + Intergenic
1168996718 20:2138648-2138670 CTGGGGAGGCAGGTCCAGGAGGG + Intronic
1169091270 20:2862702-2862724 CTGCTCAGGGTTGGCCTGGATGG + Exonic
1169209029 20:3755437-3755459 CTCCTCCAGCAGGGCCTGGATGG - Intronic
1169251551 20:4064772-4064794 CGGGCCAGCCAGGGCCTGGGAGG + Intergenic
1171784401 20:29449111-29449133 CTGGGCTGGCACGGCCTGGCTGG + Intergenic
1172481527 20:35274644-35274666 CTGGTGAGGAAGGGCCTGGCTGG - Exonic
1173685944 20:44923719-44923741 CTGGGCTGGCAGGGGATGGAGGG + Intronic
1174052152 20:47774361-47774383 CTGGTGAGGCGGGGTCTGGGAGG + Intronic
1174284707 20:49464528-49464550 CTTTTCAGGCAGGGAGTGGAGGG - Intronic
1174412198 20:50343541-50343563 CTGGTCCTGCAGACCCTGGAGGG - Intergenic
1175082269 20:56430677-56430699 ATGGTCAGGCTGGGCGTGCAGGG - Intronic
1175114714 20:56673933-56673955 TTGGTCAGGCAGCGCCTTGCGGG + Intergenic
1175312365 20:58020615-58020637 CTGGACAGCCAGGGACTGGGGGG - Intergenic
1175939942 20:62533291-62533313 CTGGACAGGCTGGACGTGGAGGG - Intergenic
1176029687 20:63005964-63005986 CCGGACAGGAAAGGCCTGGAGGG - Exonic
1176053983 20:63134877-63134899 CAGGGGAGGCAGGGCCTAGAGGG + Intergenic
1176058502 20:63161401-63161423 CTGGGGAGTCAGGGGCTGGAAGG - Intergenic
1176376719 21:6090397-6090419 AGGGCCAGGCAGGGACTGGAGGG + Intergenic
1176545684 21:8197031-8197053 CTACTCAGGCAGGGACTGCAGGG - Intergenic
1176564635 21:8380076-8380098 CTACTCAGGCAGGGACTGCAGGG - Intergenic
1176899036 21:14417473-14417495 CTGGCCACTCAGGTCCTGGAGGG - Intergenic
1177598459 21:23279010-23279032 TTGGTAAGGCAGAGCCTAGATGG - Intergenic
1177828701 21:26112550-26112572 GTCATCAGGCAGGGCCTGGCAGG - Intronic
1178301724 21:31458860-31458882 CTAGCCAGGCAGAGCTTGGAAGG + Intronic
1179024590 21:37668962-37668984 CTGGATTGGGAGGGCCTGGAAGG - Intronic
1179746756 21:43447847-43447869 AGGGCCAGGCAGGGACTGGAGGG - Intergenic
1179924447 21:44526615-44526637 GTGTCCAGGCAGGGCCTGGTGGG + Intronic
1179958892 21:44757443-44757465 GTGTTCAGGCAGGGCCTGATGGG + Intergenic
1180010839 21:45050103-45050125 CAGGACAAGCAGGGCCTGGGTGG - Intergenic
1180025371 21:45158154-45158176 CTGGCCAGACAGGGCCAGGCTGG - Intronic
1180048226 21:45319516-45319538 CTGGTCAGGCAGTGCCCACACGG - Intergenic
1180255498 21:46624587-46624609 CTGAACACGCAGGGCCTGGCAGG - Intergenic
1180875003 22:19171118-19171140 AGGGCCAGGCAGGGCCTGAAGGG + Intergenic
1181392429 22:22593464-22593486 CAGGGCAGGGAGGGGCTGGAAGG + Intergenic
1181543006 22:23583987-23584009 AGGGTCAGGCAGGGCCTGAAAGG - Intergenic
1181632640 22:24159323-24159345 CTGGTCAGGCACTGCCTGCAGGG - Intronic
1181786491 22:25231083-25231105 CTGGCCAGGCAGGTCCTTGCAGG + Intronic
1182482010 22:30615230-30615252 CAGGACAGGCAGGGGCTTGAGGG - Intronic
1182512475 22:30828909-30828931 CTGGACTGGAAGGGCCTGGAGGG + Intronic
1182518087 22:30870244-30870266 CTGGGAAGGCTGGGCCAGGATGG + Intronic
1182545857 22:31076047-31076069 CGGGTAGGGCAGGGCCTGGCTGG + Intronic
1183293504 22:37017127-37017149 ATGGCCAGGCAGGGACTGGAGGG + Intronic
1183951832 22:41356815-41356837 CTGGGAGGGCAGGGCCTGGCGGG + Intronic
1184118498 22:42435738-42435760 CTGGACAGGGAGCGCCTTGAGGG - Intergenic
1184283146 22:43450277-43450299 GTGGCCAGGCAGGACCGGGAGGG - Intronic
1184483331 22:44760907-44760929 CTTGTCAGGGAGGGTCGGGAGGG + Intronic
1184644048 22:45886486-45886508 CTCGGGAGGGAGGGCCTGGAAGG + Intergenic
1184652738 22:45926531-45926553 CTGGTCAGTCTCGCCCTGGAAGG - Intronic
1184928514 22:47661591-47661613 CTGCTCAGAGAGGGACTGGATGG + Intergenic
1185039895 22:48498338-48498360 CTGAAGAGGCAGGGGCTGGAGGG + Intronic
1185043569 22:48517840-48517862 CTGGGCAGGCACGGCCGGGTGGG + Intronic
1185047107 22:48534097-48534119 CAGGTGAGGCAGGGCCAGGCAGG + Intronic
1185184697 22:49391975-49391997 CTGGCCAGGCCGGGCATGAATGG + Intergenic
1185213877 22:49587511-49587533 CTGGGGAGGGCGGGCCTGGAGGG - Intronic
1185373347 22:50470842-50470864 CTGGAAAGGCAGGCCATGGAGGG + Intronic
1203250555 22_KI270733v1_random:113268-113290 CTACTCAGGCAGGGACTGCAGGG - Intergenic
949903341 3:8838073-8838095 CTGGTTTGGCTGGGACTGGATGG - Intronic
950022003 3:9793636-9793658 CTGACCAGGAAGGGCCTGAATGG - Intronic
950628385 3:14265142-14265164 CAGTTCAGGCAGGGCTTAGAGGG - Intergenic
950708362 3:14797802-14797824 CTGGTCATGCAGAGCCAGGCAGG - Intergenic
951072559 3:18349419-18349441 CTGGGCAGACAGAGTCTGGATGG + Exonic
952484788 3:33799038-33799060 CTGGTCAGGCCGGGACGGGGCGG - Intronic
952637483 3:35549491-35549513 CTGGTAAGACAGGGCCTGAGAGG + Intergenic
953577255 3:44122888-44122910 CTGGTCTGGCAGTCCCTGGGTGG + Intergenic
953578054 3:44128909-44128931 CAGGTCAGGGAGGGCATGCAGGG - Intergenic
953928994 3:46996678-46996700 GTGGTCAGGCAGTCTCTGGATGG + Intronic
953979607 3:47407043-47407065 ATGGACAGGCAGGGCCGGGTGGG + Intronic
954334826 3:49910099-49910121 CAGGTGAGGGAGGGCCTTGAGGG - Exonic
954417350 3:50399791-50399813 CTGGCCAGGTGGGGCCTGGCTGG + Intronic
954560765 3:51554684-51554706 CAGGACTGGGAGGGCCTGGAAGG - Intronic
954763020 3:52890811-52890833 CTGGTGAGGAAGGGTCTGCAGGG - Intronic
954876611 3:53806500-53806522 CTGTTCAGCCAAGGGCTGGAAGG - Intronic
956454629 3:69408639-69408661 CTGGGCAGGCAGGGCTTGGTAGG + Intronic
956606333 3:71076490-71076512 ATGGGCAGGCAGGACCGGGAAGG + Intronic
959689431 3:109182632-109182654 CAGATCATGCAGGGCCTTGAAGG - Intergenic
960049874 3:113229066-113229088 CTGGACTGGGAGGGCCGGGAAGG + Intronic
960953581 3:123015435-123015457 CTGGTCAGGCCTCACCTGGAGGG + Intronic
961774133 3:129271962-129271984 CAGGTCTGGCAGGTCCTGTAGGG + Intronic
962281734 3:134057305-134057327 GTGGCCAGGGAGGGCCAGGAAGG + Intergenic
962284244 3:134073431-134073453 CTGGTCAGGGAGGGTCAGCATGG + Intronic
962349462 3:134646107-134646129 ATGGCCATGCAGGGCATGGAAGG - Intronic
962970893 3:140400910-140400932 CTGGTCAGGCAAGGCAGGGAGGG - Intronic
966891313 3:184409485-184409507 CTGGACAGGCAGGCCCGGGGCGG + Intronic
968189875 3:196660023-196660045 CAGGCCCGGCAGGGCGTGGAGGG - Exonic
969137895 4:5045187-5045209 CCGCTCAGGCAGAGCCTGGCAGG - Intergenic
969226494 4:5801866-5801888 ATGGGGAGGCAGGGACTGGATGG + Intronic
969642083 4:8405011-8405033 CTGCTCAGGCAGGGCCTGGCAGG + Intronic
970005885 4:11410332-11410354 AGGGTCAGGGAGGGCCTCGAAGG + Intronic
970572654 4:17398198-17398220 CTGGGCAGGCAGGGGCTGGTAGG + Intergenic
971244669 4:24917225-24917247 CTGGGCAGGGAGGGCTTGGCAGG - Intronic
972698173 4:41468287-41468309 CAGGGCAGGCAGGGCAGGGAAGG - Intronic
977397315 4:96486770-96486792 CTGTTCAGGGAGGGGATGGAAGG + Intergenic
978923719 4:114217397-114217419 CTGGTGAGGAAAGGGCTGGAGGG - Intergenic
980127480 4:128787787-128787809 CTGGTCTGGCAGGGCCTGGGTGG - Intergenic
981714724 4:147741542-147741564 ATTTTCAGGCAGGGACTGGATGG + Intronic
981858986 4:149331683-149331705 TAGGGCAGGCAGGGCGTGGAGGG - Intergenic
982122881 4:152159191-152159213 CTGCTCAGGCTTGGCCTGGCAGG - Intergenic
983547581 4:168979471-168979493 CTGATCAGGCGGGGGCTGGGTGG - Intronic
984940754 4:184930182-184930204 GTGGTCAAGCAGGCCCTGGTTGG + Intergenic
984946890 4:184975815-184975837 CAGGTCAGCCAGGCCCCGGAGGG + Intergenic
985540355 5:484731-484753 CTGGCAAGGAAGGGCCCGGAAGG - Intronic
985658714 5:1145049-1145071 ACGGCCAGGCCGGGCCTGGAGGG + Intergenic
985682022 5:1260775-1260797 TTGGTCATGCAGAGTCTGGATGG - Intronic
986317588 5:6600914-6600936 CTGGACAGGTGGAGCCTGGAAGG - Intronic
986547748 5:8917684-8917706 CTAGTCATGCAGGGCCTCAAAGG + Intergenic
989100403 5:37817962-37817984 CAGGTCAGGTAGGGCCTTTAGGG - Intronic
989547687 5:42693659-42693681 TAGGGAAGGCAGGGCCTGGAAGG - Intronic
990263129 5:54046846-54046868 TTGGTCAGGAAGGGAGTGGATGG + Intronic
991577750 5:68122539-68122561 CTGGTCGGGGTGGGGCTGGATGG - Intergenic
992997829 5:82349784-82349806 CTGGGTTGGCAGGGCCTGAAAGG + Intronic
995036858 5:107544025-107544047 CTTGTCAGGTGGGCCCTGGAGGG + Intronic
996550671 5:124726758-124726780 CAGGTCATGCAGGGCCTTGTAGG - Intronic
996638935 5:125729832-125729854 CTCGCCAGGCAGGGCCAAGATGG + Intergenic
998167534 5:139852768-139852790 CTGGTGAGGCAGTGCCTAGCAGG + Intronic
998202300 5:140134783-140134805 CTGGTAAGGGAGTGACTGGAAGG - Intergenic
998875138 5:146591417-146591439 CTTGTCAGGCAGGGCGCTGAGGG + Intronic
998894156 5:146780410-146780432 CTCGTACCGCAGGGCCTGGATGG - Intronic
999139137 5:149345838-149345860 GAGGTCATGCATGGCCTGGAAGG + Intronic
999188061 5:149727560-149727582 GGGGCCAGGCTGGGCCTGGAAGG + Intergenic
1000117663 5:158168660-158168682 CTTGTCTGGCTGGCCCTGGAAGG + Intergenic
1000173376 5:158726369-158726391 AAGGTCAGGCAGGGCTGGGAGGG + Intronic
1001264928 5:170267355-170267377 CAGCTCAGGCAGGGCCTCGCAGG - Intronic
1001420873 5:171586276-171586298 CTGAGCGGGCAGGGCATGGAGGG + Intergenic
1001541846 5:172545288-172545310 CCTCTCAGGCAGGGACTGGAAGG - Intergenic
1001543991 5:172558725-172558747 CTGGGAAGGCAGGGCTCGGAAGG + Intergenic
1001584836 5:172826823-172826845 CTGGAGAGGTAGGGGCTGGATGG - Intergenic
1002098976 5:176848072-176848094 CTGGTCAGTAGGGGCCTGGAGGG - Intronic
1002693402 5:181066630-181066652 CAGGCCAGGGAGGGCCTTGAAGG - Intergenic
1002693698 5:181070283-181070305 CAGGTCAGGGCGGGCCTTGAAGG - Intergenic
1002774220 6:315018-315040 CTGGTCAGGGAGTGGCTGGGTGG + Intronic
1002795223 6:466303-466325 CTGGTCAGGTTGTTCCTGGAAGG - Intergenic
1002915554 6:1525421-1525443 CAGTTCAGGCAGGCCCAGGAAGG - Intergenic
1003565568 6:7219489-7219511 GTGGTCAGGCAGTGGCTGGCGGG + Intronic
1003979828 6:11379124-11379146 CAGGCCAGGCAGGCCCTGGGTGG + Intronic
1005963696 6:30711666-30711688 CTGGAGAATCAGGGCCTGGAAGG - Exonic
1006681055 6:35797098-35797120 CTGGACTGGCAGGGGCTGGGAGG - Intronic
1007103979 6:39270873-39270895 CTGGACAGGCAGGGCCTCTGGGG - Intergenic
1007180084 6:39923459-39923481 CTGGTCAGGGAGGTACAGGATGG - Intronic
1007242049 6:40433117-40433139 CTGGTCACTCAGCGCCTGGAAGG + Exonic
1007756512 6:44103058-44103080 CTGGTAAGGCAAGGCAGGGATGG - Intergenic
1007954316 6:45902390-45902412 CTTTTCTGGCAGGGCCTGGACGG + Exonic
1008555365 6:52668681-52668703 CTGCTCAGGCAGGGCCTCACGGG - Intergenic
1009027557 6:58018153-58018175 AGGGTCAGGCAGGGACTTGAAGG + Intergenic
1011663916 6:89617186-89617208 ATGGTTCAGCAGGGCCTGGAGGG + Intronic
1015374277 6:132492084-132492106 CAGGTCAGGTAGGGCCTTGCAGG - Intronic
1017025318 6:150176231-150176253 CTGGGCAGGCCAGCCCTGGAAGG + Intronic
1017871842 6:158493550-158493572 CTGGGGAGGCAAGGCCAGGAGGG - Intronic
1018107977 6:160507114-160507136 GTGTTCAGGCAGGGCCAGGGTGG + Intergenic
1018123515 6:160659707-160659729 ATGTTCAGGCAGGGCCAGGGTGG + Intronic
1018146868 6:160899992-160900014 ATGTTCAGGCAGGGCCAGGGTGG - Intergenic
1018371152 6:163169734-163169756 CTGGGCAGGCTGGGCGGGGAGGG + Intronic
1018808221 6:167277547-167277569 CAGGTCAGGCAGAGAGTGGACGG + Intronic
1018890525 6:167978306-167978328 CGGGTCAGGCGGGACCAGGAAGG + Intergenic
1019299463 7:296131-296153 GTGGTGAGGCAGTGCCGGGAGGG - Intergenic
1019316724 7:390389-390411 GTGGCCAGGGAGGGCCTGGCCGG + Intergenic
1019550310 7:1599153-1599175 CAGGTCAGGCTCAGCCTGGAGGG - Intergenic
1019558773 7:1645581-1645603 CGGGGCAGGCAGGGGCTGCAGGG + Intergenic
1019738084 7:2660253-2660275 CTGGGCAGGGGGAGCCTGGAAGG - Intronic
1021805547 7:24350998-24351020 CTTGTAAGGCTGGGCCTGCAAGG - Intergenic
1021874190 7:25033098-25033120 CAGGTCATGCAGGGCCTGATGGG + Intergenic
1022096747 7:27145941-27145963 CCGGTAAGCCAGGGCCTGGAGGG + Intronic
1022143153 7:27510903-27510925 CTGGTCAGGCAAGGGATGGCGGG - Intergenic
1022364542 7:29698840-29698862 CTGGTCAGTCAGGGCTTTCATGG + Intergenic
1022652987 7:32294063-32294085 CTGGGCAGGCAGGGCTCGGTGGG - Intronic
1023255727 7:38310664-38310686 CTGCCCAGGGAGGGCCTGGATGG - Intergenic
1023409072 7:39870107-39870129 GTGGTTACCCAGGGCCTGGAAGG + Intergenic
1023608124 7:41947844-41947866 CTGGTCAGCCTGGGCCTGCCTGG + Intergenic
1023852515 7:44158304-44158326 CTGGTCAGGCAGGGCTGCCAGGG + Intronic
1024063219 7:45714068-45714090 CTGGTCTGGCTGGTCCTGGCTGG - Exonic
1024157006 7:46636258-46636280 CTGACCTGGCAGGGGCTGGAAGG + Intergenic
1025093501 7:56081339-56081361 CTGGAGGGGCAGGGCCTGGCAGG - Intronic
1025141754 7:56472438-56472460 CAGGTGAGGCCTGGCCTGGATGG + Intergenic
1025216513 7:57060873-57060895 CTGGAGGGGCAGGGCCTGGCAGG - Intergenic
1025247540 7:57328614-57328636 GATGTCAGGCAGGGCCTGGCGGG + Intergenic
1025260728 7:57415885-57415907 CTGCTCTGGCTGGGACTGGAAGG + Intergenic
1025627264 7:63233323-63233345 CTGGAGGGGCAGGGCCTGGCAGG - Intergenic
1025654867 7:63509857-63509879 CTGGAGGGGCAGGGCCTGGCAGG + Intergenic
1026118779 7:67518615-67518637 CAACTCAGGGAGGGCCTGGATGG - Intergenic
1026255478 7:68707596-68707618 CTGGACAGGCAGGTGGTGGAGGG - Intergenic
1029360975 7:100088604-100088626 CAGATCAGGCAGGGCCTTGCAGG + Intergenic
1029701464 7:102249073-102249095 CTGGGCCGCAAGGGCCTGGACGG + Exonic
1032012592 7:128356671-128356693 CTGGTGAGGCAGGCGCTGGCTGG + Intronic
1032187830 7:129742542-129742564 CTGGTGGGGGAGGGGCTGGAGGG + Intronic
1034517036 7:151589172-151589194 CAGGTAAGGCAGTGCCTGGGTGG - Intronic
1034739104 7:153456852-153456874 CTGGACAGACAAGGCCAGGAAGG - Intergenic
1035025551 7:155822863-155822885 TTGATCAGAGAGGGCCTGGAGGG + Intergenic
1035252244 7:157605080-157605102 TTGCTCAGGCTGGGCCTGGCAGG + Intronic
1035354669 7:158270015-158270037 CAGGTCAGGCAGAGAGTGGACGG - Intronic
1035453900 7:158996878-158996900 CTGGGCCGGCAGGTCCTGGCGGG - Intergenic
1036226225 8:6960099-6960121 TGGCTCAGACAGGGCCTGGAGGG + Intergenic
1036506258 8:9359375-9359397 CTTGTCAGGAAGGGCCAGGCTGG + Intergenic
1036605505 8:10302321-10302343 CTGGCAAAGCAGGGCCTGCAAGG - Intronic
1036655841 8:10676753-10676775 GTGGGGAGGCAGGGCCTTGAGGG - Intronic
1037462960 8:19131548-19131570 CAGGTCAGGCAGGGCCTTGTTGG + Intergenic
1037754840 8:21704024-21704046 CTTGTCATGCAGGGCCTTGCAGG - Intronic
1037926197 8:22845909-22845931 GTGGTCAGCCAGGCCCTGGATGG + Intronic
1038575624 8:28701547-28701569 CGGATCAGGCGCGGCCTGGAAGG + Exonic
1039566889 8:38558249-38558271 CGGGTCAGGGAGGGGGTGGAGGG + Intergenic
1041530341 8:58858566-58858588 CTTTGCAGGCAAGGCCTGGAAGG + Intronic
1042960023 8:74293746-74293768 ATGGTCAGTCTGGTCCTGGAAGG - Intronic
1045212055 8:100108685-100108707 CTGGTCGGGTAGGCACTGGAGGG - Intronic
1045320728 8:101080053-101080075 CTGGACTGGAAGGGCCAGGAGGG - Intergenic
1045931552 8:107633097-107633119 CTGGAGAAGCAGGCCCTGGAGGG + Intergenic
1047367266 8:124222838-124222860 CTGCTCAGAAAGGGCTTGGAAGG - Intergenic
1049034247 8:140062101-140062123 GTGGTCAGGCGGGTCCTGGAAGG - Intronic
1049170719 8:141159104-141159126 CTGGTCAGCCAGGGCTGGGCTGG + Intronic
1049254088 8:141604782-141604804 ATGGTCAGGCTGGGCCAGCAAGG - Intergenic
1049374156 8:142281135-142281157 CAGCTCAGTCAGGGCATGGAGGG + Intronic
1049397054 8:142405763-142405785 CTGTCCAGGCAGGGGCTGCAGGG - Intergenic
1049397800 8:142409671-142409693 CTGCAGAGGCAGGGCCAGGAGGG - Intergenic
1049469435 8:142768878-142768900 CTGCTCATTCAGGGCCTGGGAGG + Intronic
1049547255 8:143238814-143238836 ATGATCAGGCAGGGCCTGAGTGG - Intergenic
1049564304 8:143330306-143330328 CTGGCCAGGGAGGTCCTGCAGGG + Intronic
1049601552 8:143510027-143510049 TGGGGCAGGCAGGGCCTGGCGGG + Intronic
1049710805 8:144062527-144062549 CTGGCCAGGCAGAGGCTGTATGG - Intronic
1049737991 8:144220215-144220237 CTGCTGAGTCAGCGCCTGGAGGG + Intronic
1049777391 8:144413086-144413108 CAGGTGGGGCGGGGCCTGGAAGG - Intronic
1052040333 9:23731373-23731395 TGGCTCAGGCAGGGCATGGATGG - Intronic
1052707287 9:32008949-32008971 CAGGTCAGGCAGACCCTGGGTGG + Intergenic
1052745828 9:32440374-32440396 CTGGTGAGGGCGGGGCTGGATGG - Intronic
1054451612 9:65406320-65406342 CTCGGCACGCAGGGCCTGAAGGG + Intergenic
1054765827 9:69041699-69041721 CTGGTAAGGACTGGCCTGGATGG - Intronic
1056262392 9:84862066-84862088 CTGGCCAGATGGGGCCTGGAGGG + Intronic
1056928874 9:90858165-90858187 CTGCTGGGGCATGGCCTGGAAGG - Intronic
1057203485 9:93156517-93156539 CTGGGCAGGCCGGGGCTGGTGGG + Intergenic
1057230095 9:93316868-93316890 CTCGGCAGTCAGGGGCTGGAGGG - Intronic
1057389092 9:94628012-94628034 CTGATCATGCAGGGGCAGGAAGG + Intronic
1057949672 9:99359659-99359681 CAGGGCAGGCAGTGCTTGGATGG + Intergenic
1058189724 9:101898496-101898518 CTTGTCAAGGAGGGCCTTGAGGG + Intergenic
1058527419 9:105873816-105873838 GTGGGGAGTCAGGGCCTGGAGGG + Intergenic
1058985229 9:110203702-110203724 TTGGTAAGTCAGGGACTGGAAGG + Intronic
1059348245 9:113646795-113646817 CAGATCACGCAGGGCCTTGAAGG - Intergenic
1060540952 9:124429682-124429704 TTGATCAGCCAGGGCCTGGCTGG - Intergenic
1060558266 9:124521387-124521409 CTGGCCAGCCAAGGCCTGGAGGG - Exonic
1061242776 9:129383958-129383980 CTGGGCCAGCAGGGCCTGGCGGG - Intergenic
1061582323 9:131545704-131545726 CTGGCGAGGCAGGTACTGGAGGG + Intergenic
1061702824 9:132428870-132428892 ATGGTCAGAGAGGGCCTGGTGGG - Intronic
1061909050 9:133713201-133713223 GTGATCAGGCAGGGTCTGCAGGG + Intronic
1062180253 9:135187563-135187585 CGGGTGAGGCAGGGTCTGGGTGG + Intergenic
1062235873 9:135507269-135507291 CTGGCCAAGCTGGGGCTGGACGG - Intergenic
1062423401 9:136494910-136494932 GCGGTCGGGCAGGGGCTGGAGGG - Exonic
1062427400 9:136512327-136512349 CTGGTCAGGGAGGGCCTGCCTGG - Intronic
1062457402 9:136646136-136646158 CTTGTCAGCCAGAGCCTGGGTGG + Intergenic
1062513749 9:136921863-136921885 AAGGTCAGCCAGGGCCTCGAGGG - Intronic
1062579047 9:137221596-137221618 CGGGGCAGGCAGGGGCTGGGTGG + Intergenic
1203466957 Un_GL000220v1:96540-96562 CTACTCAGGCAGGGACTGCAGGG - Intergenic
1185462976 X:340811-340833 CTGGAAGGGCAGGGCCTCGATGG + Exonic
1185922294 X:4107216-4107238 GTGATCAGTCAGAGCCTGGAAGG - Intergenic
1186858670 X:13649624-13649646 CGGGTCAGGCAGTCCCTGGCTGG - Intergenic
1187248494 X:17575270-17575292 CAGGTCATGCAGGGCCTTGCAGG - Intronic
1188978989 X:36709371-36709393 CTTGTCAGGAAGGACCTTGAAGG + Intergenic
1189755213 X:44264401-44264423 CTGGTGGGGCAGGCCCTGCAGGG - Intronic
1190232153 X:48590500-48590522 GAGGTCAGGGAGGGCCCGGAGGG + Intronic
1192832628 X:74766892-74766914 GTGGTCAGGCAGGGGCAGGGTGG + Intronic
1194254758 X:91622452-91622474 CTGGTGAGGTAGGCACTGGAGGG + Intergenic
1195156539 X:102128721-102128743 CTGGTAAGGTGGGACCTGGAAGG - Intergenic
1195793956 X:108622749-108622771 TTGGTCCAGGAGGGCCTGGAAGG - Exonic
1195884359 X:109624433-109624455 CTTGTCTGGAAGGCCCTGGAAGG - Exonic
1198426962 X:136530027-136530049 CGGGTCAGGGAGGGCCTTGTAGG + Intergenic
1199792950 X:151171940-151171962 CAGGAGGGGCAGGGCCTGGATGG + Intergenic
1200224397 X:154409242-154409264 CCGGCCAGGAAGGGCCTGGCTGG + Intronic
1200247014 X:154531775-154531797 GGGCTCAGGCAGGGTCTGGAGGG + Exonic
1200573543 Y:4862055-4862077 CTGGTGAGGTAGGCACTGGAGGG + Intergenic
1200742385 Y:6868208-6868230 CTGAACAGGCTGGGGCTGGAAGG + Exonic