ID: 924624055

View in Genome Browser
Species Human (GRCh38)
Location 1:245685683-245685705
Sequence GGGCGACAGCCGGCCCGCAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 107}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924624048_924624055 -3 Left 924624048 1:245685663-245685685 CCAGCCCTGCAGAAGACCCGGGG 0: 1
1: 0
2: 1
3: 20
4: 255
Right 924624055 1:245685683-245685705 GGGCGACAGCCGGCCCGCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 107
924624050_924624055 -7 Left 924624050 1:245685667-245685689 CCCTGCAGAAGACCCGGGGCGAC 0: 1
1: 0
2: 0
3: 7
4: 45
Right 924624055 1:245685683-245685705 GGGCGACAGCCGGCCCGCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 107
924624043_924624055 18 Left 924624043 1:245685642-245685664 CCAGACTTTGTCCCTATCGTGCC 0: 1
1: 0
2: 1
3: 2
4: 60
Right 924624055 1:245685683-245685705 GGGCGACAGCCGGCCCGCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 107
924624051_924624055 -8 Left 924624051 1:245685668-245685690 CCTGCAGAAGACCCGGGGCGACA 0: 1
1: 0
2: 0
3: 4
4: 49
Right 924624055 1:245685683-245685705 GGGCGACAGCCGGCCCGCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 107
924624044_924624055 7 Left 924624044 1:245685653-245685675 CCCTATCGTGCCAGCCCTGCAGA 0: 1
1: 0
2: 0
3: 4
4: 98
Right 924624055 1:245685683-245685705 GGGCGACAGCCGGCCCGCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 107
924624045_924624055 6 Left 924624045 1:245685654-245685676 CCTATCGTGCCAGCCCTGCAGAA 0: 1
1: 0
2: 1
3: 11
4: 110
Right 924624055 1:245685683-245685705 GGGCGACAGCCGGCCCGCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 107
924624042_924624055 19 Left 924624042 1:245685641-245685663 CCCAGACTTTGTCCCTATCGTGC 0: 1
1: 0
2: 0
3: 4
4: 55
Right 924624055 1:245685683-245685705 GGGCGACAGCCGGCCCGCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 107
924624039_924624055 22 Left 924624039 1:245685638-245685660 CCCCCCAGACTTTGTCCCTATCG 0: 1
1: 0
2: 0
3: 11
4: 137
Right 924624055 1:245685683-245685705 GGGCGACAGCCGGCCCGCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 107
924624040_924624055 21 Left 924624040 1:245685639-245685661 CCCCCAGACTTTGTCCCTATCGT 0: 1
1: 0
2: 0
3: 8
4: 95
Right 924624055 1:245685683-245685705 GGGCGACAGCCGGCCCGCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 107
924624041_924624055 20 Left 924624041 1:245685640-245685662 CCCCAGACTTTGTCCCTATCGTG 0: 1
1: 0
2: 1
3: 4
4: 85
Right 924624055 1:245685683-245685705 GGGCGACAGCCGGCCCGCAGAGG 0: 1
1: 0
2: 0
3: 7
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924624055 Original CRISPR GGGCGACAGCCGGCCCGCAG AGG Exonic
900437061 1:2635779-2635801 GGACGACAGCCGGGCCTCTGGGG + Intergenic
901084891 1:6604293-6604315 GGGCAACAGGCGGCCCGCCTGGG - Intronic
901201073 1:7467720-7467742 GGGCCACAGCCGCCTGGCAGCGG - Intronic
902775274 1:18670704-18670726 GGGTGCCAGCCAGCCGGCAGGGG + Intronic
903883854 1:26530061-26530083 GGGCGCCCGCCGGACTGCAGCGG - Intronic
904679871 1:32221933-32221955 GGGCCTCCGCCGGCCTGCAGCGG - Exonic
908826916 1:68141959-68141981 CTGCGACAGTCGGCCCGGAGTGG - Intronic
911321074 1:96414762-96414784 GGGCTACAGCCTGCCCTCAGTGG + Intergenic
914980345 1:152409770-152409792 GGGAGACAGACAGCCCACAGTGG - Exonic
917937422 1:179882508-179882530 GGGCGACGGGCGGCGGGCAGAGG + Exonic
918326794 1:183417960-183417982 GGGCCAGACCCGGCTCGCAGGGG - Intronic
921457971 1:215394826-215394848 CGGCCTCAGCCAGCCCGCAGAGG + Intergenic
922460293 1:225810280-225810302 GGGCTGCGGTCGGCCCGCAGGGG + Intronic
923089586 1:230729598-230729620 GGGTGACAGCCTGCCTTCAGTGG + Intergenic
924289580 1:242524289-242524311 GGGCGGCCGCCGGCGAGCAGCGG + Exonic
924385537 1:243495621-243495643 TGGGGACAGCAGGGCCGCAGGGG + Intronic
924624055 1:245685683-245685705 GGGCGACAGCCGGCCCGCAGAGG + Exonic
1064393272 10:14959600-14959622 GGGCTACGGCCGGGGCGCAGGGG - Intronic
1067715996 10:48691463-48691485 GGTTGCCAGCCGGCCAGCAGGGG - Intronic
1069780617 10:70953143-70953165 GGAGGACAACCGGCCCTCAGCGG - Intergenic
1069849568 10:71396526-71396548 GGCCGCCAGCCGTCCCGCAGAGG - Intergenic
1072248916 10:93566695-93566717 CGGCGCCTGGCGGCCCGCAGCGG - Exonic
1073498201 10:103912953-103912975 GGCAGACAGCCGGCCCTCTGTGG - Intronic
1075037426 10:119080837-119080859 GGGCGGCAGCAGGGCCGCCGCGG - Intergenic
1076395677 10:130136200-130136222 GGGAGCCAGGAGGCCCGCAGCGG + Intergenic
1077111461 11:863989-864011 GGGCCACAGCTGGGCTGCAGAGG - Intronic
1077319803 11:1936090-1936112 CGGCCACAGCGGGCCCCCAGGGG + Intronic
1077329738 11:1978957-1978979 GGGCCACAGCCTTCCCGCATGGG - Intronic
1077483611 11:2828099-2828121 GGGCCACAGCCGGGACTCAGAGG + Intronic
1081679623 11:44992542-44992564 GGGAGACAGCTGGCCCTCTGGGG + Intergenic
1083227771 11:61295347-61295369 GGGCGAAACCCCGCCCCCAGGGG - Exonic
1083948665 11:65941372-65941394 GGGTGACAGCCTGCCTGGAGTGG + Intergenic
1091266563 11:134276382-134276404 GGTCGACAGCCGGCTGGCACAGG - Intronic
1202812716 11_KI270721v1_random:34136-34158 GGGCCACAGCCTTCCCGCATGGG - Intergenic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1099202077 12:79689924-79689946 GGGCGGCCCCCGGCCCGCGGCGG - Exonic
1101253843 12:102958451-102958473 GGCCGACGGCCAGCCCTCAGGGG + Exonic
1106108961 13:26760532-26760554 CGGGGACAGGCGGCCCGCGGGGG + Intronic
1113384966 13:109840278-109840300 CGCTGACAGCCGGCACGCAGCGG - Intergenic
1117699098 14:58395904-58395926 GGGCGCGGGCCGGCCGGCAGGGG - Exonic
1122145807 14:99688285-99688307 GGGTGGCCGCCTGCCCGCAGTGG - Intronic
1122300209 14:100727143-100727165 GGGCGCGAGCCGGGCCGCCGGGG - Intronic
1122470899 14:101965120-101965142 GGGCCGCAGACGCCCCGCAGAGG + Intronic
1122799689 14:104223380-104223402 GGGCGGCAGGCTGCCTGCAGAGG - Intergenic
1122924866 14:104894881-104894903 GGCCCACAGCTGGCCCGCTGTGG - Exonic
1122985265 14:105208896-105208918 GGGCCACAGCTGGCACCCAGGGG - Intergenic
1125501395 15:40242063-40242085 GGTAGACAGCAGGCCAGCAGCGG + Intronic
1127988742 15:64095834-64095856 GGGCGGCACCCGGCCAGCTGAGG - Intronic
1128780248 15:70354433-70354455 GGCCCACAGCGGGGCCGCAGGGG - Intergenic
1132398732 15:101491706-101491728 GAGGGACATCCGGCCAGCAGGGG - Intronic
1132678271 16:1129618-1129640 GGGCGGCAGCCCGCACGGAGCGG - Intergenic
1136912814 16:34158931-34158953 GGTGGAGAGCCGGCTCGCAGCGG - Intergenic
1137574649 16:49590817-49590839 GGGCTCCAGCCGGCCCGGTGAGG + Intronic
1141089714 16:81121812-81121834 TGGCCACAGCCAGCCCTCAGGGG - Intergenic
1142020303 16:87778039-87778061 GGGCAGCAGCCGGCCGGCAGGGG + Intergenic
1142031054 16:87838845-87838867 GGGCGAGGGCCGGCCCGGTGGGG - Intronic
1143712926 17:8746125-8746147 GCGCGGCAGACGGCCAGCAGGGG - Intergenic
1144770617 17:17757451-17757473 GGGGGACAGCCTGGCTGCAGCGG + Intronic
1148830068 17:50425693-50425715 TGGCGCCAGCGGGCCCGCAGGGG + Intergenic
1148972201 17:51493378-51493400 GGGCTACAGCTGGCCCTCAAAGG - Intergenic
1151713703 17:75820705-75820727 GATGCACAGCCGGCCCGCAGTGG - Intronic
1151733632 17:75925361-75925383 GCGGGACTGCCGGCCCTCAGAGG + Exonic
1152895599 17:82909430-82909452 GGGTGTCACCCGGCCCGCTGTGG + Intronic
1152895632 17:82909566-82909588 GGGTGTCACCCGGCCCGCTGTGG + Intronic
1152895648 17:82909632-82909654 GGGTGTCACCCGGCCCGCTGTGG + Intronic
1152895664 17:82909698-82909720 GGGTGTCACCCGGCCCGCTGTGG + Intronic
1158953881 18:62522662-62522684 GGGCGGCAGCTGGCAAGCAGAGG + Intergenic
1162799003 19:13100955-13100977 GGGCCACAGCAGGCCCCCAGGGG - Exonic
1163993212 19:21018748-21018770 GGGCAACAGGTGGCCAGCAGTGG + Intergenic
1164004664 19:21137419-21137441 GGGCAACAGGTGGCCAGCAGTGG - Intergenic
1164030028 19:21395498-21395520 GGGCAACAGGTGGCCAGCAGTGG + Intergenic
1165333509 19:35154374-35154396 GGGCGACTCCGGGCACGCAGGGG - Intergenic
926035113 2:9630497-9630519 GGGCGAGCGCCGACCCGCAGCGG + Exonic
932611408 2:73202843-73202865 GGGAGGCCGCCGGCGCGCAGGGG - Exonic
937221716 2:120346016-120346038 GGGCTGCCGCCGGCTCGCAGGGG - Intergenic
948127673 2:235576707-235576729 GGGCGACAGTCCTCCCTCAGAGG - Intronic
1171810857 20:29743500-29743522 GGCGGAGAGCCGGCTCGCAGAGG + Intergenic
1175121912 20:56722339-56722361 GGGAGACAGAGGGGCCGCAGTGG + Intergenic
1175199993 20:57270359-57270381 GGGCCCCAGCTGGCCTGCAGGGG - Intergenic
1175771350 20:61626566-61626588 GGGCGCCAGCCAGCTCACAGAGG - Intronic
1176239529 20:64069546-64069568 GGGCCCCTGCCTGCCCGCAGAGG + Intronic
1178708198 21:34890786-34890808 GCGCGCCCGCCCGCCCGCAGGGG + Intronic
1180979834 22:19873293-19873315 GGGCCACAGCGGGGCAGCAGGGG - Intergenic
1181043168 22:20202468-20202490 GCGCGACACCCCGCACGCAGGGG + Intergenic
1182289663 22:29267869-29267891 GCGCGCCAGCCGGTCGGCAGGGG - Exonic
1184411889 22:44330854-44330876 AGGCGACAGCGGTTCCGCAGGGG + Intergenic
1185116724 22:48942138-48942160 GGGAGACAGCTGGACTGCAGTGG + Intergenic
950448131 3:13049962-13049984 GGGCCACAGCAGGCCTGCAAGGG - Intronic
953720401 3:45349980-45350002 GGACGCCAGCCAGCCCACAGGGG + Intergenic
966787829 3:183636432-183636454 TCGCGACACCCGGCCCGCTGCGG + Intronic
971757566 4:30721998-30722020 CGGCGAGAGCCGGCGCGCCGGGG + Exonic
997500794 5:134371728-134371750 GGCCCACAGCCGGCCCTCTGAGG - Intronic
998405322 5:141870933-141870955 GGGCCAGAGCCTGCCCTCAGTGG - Intronic
999155095 5:149452162-149452184 GGGCGACAGCCTGCAGCCAGAGG - Intergenic
1001545319 5:172567471-172567493 GGGCGGAAGCCAGCCCACAGAGG - Intergenic
1002131945 5:177087177-177087199 GGGCGTCCGCCGGGCGGCAGGGG + Intronic
1002527060 5:179820774-179820796 GCGCGAGAGCCGCCCTGCAGAGG - Exonic
1002549253 5:179974819-179974841 GGGAGAGAGCAGGCACGCAGCGG + Intronic
1002798700 6:499756-499778 GGGGTACAGCCTGCCAGCAGGGG - Intronic
1003290756 6:4776526-4776548 GAGCGCGAGCCGGCCCGCCGGGG + Exonic
1012466371 6:99521056-99521078 CGGCGGCCGCCGGCCCGCAATGG + Intronic
1017672273 6:156778826-156778848 GGGCTACAGCCGGCCCGGCGCGG + Exonic
1018150248 6:160931067-160931089 GGGCGGCCGCGGGCCCGCTGCGG - Intergenic
1025864937 7:65372651-65372673 GGGCAACAGGTGGCCAGCAGTGG + Intergenic
1029227939 7:99041635-99041657 GGTGGGCAGCCGGCCAGCAGGGG - Intronic
1034342810 7:150368964-150368986 GGGCCACCGCGGGCCCGCGGGGG + Intronic
1034392751 7:150799871-150799893 AGGCGTCGGGCGGCCCGCAGGGG - Intronic
1038828481 8:31032935-31032957 GGCCGCCAACCGGCCGGCAGTGG - Exonic
1049686821 8:143942421-143942443 GGCTGCGAGCCGGCCCGCAGGGG - Intronic
1049782070 8:144433707-144433729 TGGCCACAGCCGTCCCCCAGGGG + Exonic
1049845448 8:144798763-144798785 TGGCGACCGCCGCGCCGCAGGGG + Intergenic
1053388129 9:37711505-37711527 GGGTGACAGCTGCCCGGCAGTGG + Intronic
1060966001 9:127712671-127712693 GGGTGGCAGCAGGCCCACAGTGG - Intronic
1199635406 X:149807946-149807968 AGGGTACAGCCGGCCAGCAGAGG - Intergenic
1200018404 X:153182128-153182150 AGGGTACAGCCGGCCAGCAGAGG - Intronic