ID: 924625599

View in Genome Browser
Species Human (GRCh38)
Location 1:245694678-245694700
Sequence ACGCAGCTGTCAGCCAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 339}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924625593_924625599 19 Left 924625593 1:245694636-245694658 CCGGAAGATGGACTGTGATGGGC 0: 1
1: 0
2: 1
3: 16
4: 174
Right 924625599 1:245694678-245694700 ACGCAGCTGTCAGCCAGGCCTGG 0: 1
1: 0
2: 0
3: 34
4: 339
924625595_924625599 -10 Left 924625595 1:245694665-245694687 CCCCTCTGACTGCACGCAGCTGT 0: 1
1: 0
2: 0
3: 10
4: 155
Right 924625599 1:245694678-245694700 ACGCAGCTGTCAGCCAGGCCTGG 0: 1
1: 0
2: 0
3: 34
4: 339
924625594_924625599 -3 Left 924625594 1:245694658-245694680 CCAGCGACCCCTCTGACTGCACG 0: 1
1: 0
2: 0
3: 2
4: 76
Right 924625599 1:245694678-245694700 ACGCAGCTGTCAGCCAGGCCTGG 0: 1
1: 0
2: 0
3: 34
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924625599 Original CRISPR ACGCAGCTGTCAGCCAGGCC TGG Intronic
900592452 1:3466101-3466123 CCGCAGCTGTCAGCCGGGGCAGG - Intronic
901045478 1:6393347-6393369 GCGCAGGTGTCTGGCAGGCCCGG + Intronic
901148939 1:7087491-7087513 AGGGAGCTGTCAGCCTGGGCTGG + Intronic
901439678 1:9270201-9270223 AAGCACCTGTCAGCAAGGCGAGG - Exonic
901563292 1:10090409-10090431 ACACAGGTCTCAGCCAGGCATGG - Intronic
904028712 1:27520811-27520833 ACACAGCTGTCAGCAGGGCCGGG - Intergenic
904997109 1:34639776-34639798 ATGCGGCTGTCAGCCCGTCCCGG + Intergenic
905797858 1:40825610-40825632 AGGGAGCTCTCAGCCTGGCCTGG - Intronic
906049449 1:42858281-42858303 ACGAAACTGTAAGCCAGACCAGG - Intergenic
908354630 1:63317876-63317898 ACCCAGCGGACAGCCGGGCCTGG + Intergenic
908592015 1:65645817-65645839 ACGAAACTGTAAGCCAGACCAGG + Intergenic
909793040 1:79700286-79700308 ACGAAACTGTAAGCCAGACCAGG + Intergenic
909909896 1:81247207-81247229 ACGAAACTGTAAGCCAGACCAGG - Intergenic
910967420 1:92821873-92821895 AAGCAGTTTTCAGCCAGGCACGG - Intergenic
913091510 1:115479384-115479406 CCGCAGCTGCCATCCAGGCTTGG + Intergenic
915267750 1:154731125-154731147 AACCAGCTCTCAGCCAGGGCTGG - Intronic
915842185 1:159223111-159223133 ATGAAGTTGTCAGCAAGGCCAGG + Intergenic
916809600 1:168293810-168293832 AAGCAGCTCACAGACAGGCCAGG - Intronic
917510198 1:175663273-175663295 ACGCTGGTGCCAGTCAGGCCGGG + Intronic
918347049 1:183615416-183615438 ACGAAACTGTAAGCCAGACCAGG - Intergenic
918714472 1:187769439-187769461 ACGAAACTGTAAGCCAGACCAGG + Intergenic
920207871 1:204306268-204306290 GCTCAGATGGCAGCCAGGCCAGG + Intronic
920569106 1:207002891-207002913 AGGCCACTCTCAGCCAGGCCAGG + Intergenic
920612359 1:207454313-207454335 AAGCAGCTGTGAGCCAGGAGAGG - Exonic
920695238 1:208176821-208176843 AAGCAGCTGACAGGCAGGCTAGG - Intronic
921937812 1:220810831-220810853 ACTCTGAAGTCAGCCAGGCCTGG + Intronic
922154135 1:223028346-223028368 ACGAAACTGTAAGCCAGACCAGG + Intergenic
922171606 1:223160089-223160111 ACACAGCTGAGAGCCAGGCAAGG + Intergenic
922472996 1:225888100-225888122 ACTGAGCTGGCAGCCAGGCCAGG + Intronic
922480998 1:225940070-225940092 ACTGAGCTGGCAGCCAGGCCAGG + Intronic
923108938 1:230875776-230875798 ACCCAGCACTCAGCCAGGCACGG + Intergenic
923214263 1:231834180-231834202 ACGAAACTGTAAGCCAGACCGGG + Intronic
923244689 1:232119946-232119968 ACGAAACTGTAAGCCAGACCGGG - Intergenic
923408687 1:233687375-233687397 ACGAAACTGTAAGCCAGACCGGG + Intergenic
923595414 1:235357574-235357596 ATCCAGGTGTCAGCCAGGTCTGG + Intergenic
923624178 1:235600711-235600733 AAGCAGCTTTCAGCCAGGAGTGG - Intronic
924625599 1:245694678-245694700 ACGCAGCTGTCAGCCAGGCCTGG + Intronic
1063106481 10:2996968-2996990 ACGAAACTGTAAGCCAGACCGGG + Intergenic
1064924688 10:20556722-20556744 ACGGAGCTGAAAGCCAGGGCTGG + Intergenic
1065917020 10:30360871-30360893 AGGCCGCTGTCAGCAAAGCCTGG - Intronic
1066000360 10:31099287-31099309 ACGCAGCTGTCTGTCTGTCCGGG - Intergenic
1066630628 10:37456165-37456187 AAACAGGTATCAGCCAGGCCCGG + Intergenic
1067800378 10:49354250-49354272 ACACAGCTGTCAGATGGGCCTGG - Intergenic
1068058412 10:52037706-52037728 ACGAAACTGTAAGCCAGACCAGG + Intronic
1068360716 10:55972958-55972980 ACAAAACTGTCAGCCAGACCAGG - Intergenic
1069743173 10:70698584-70698606 AGGCAGCTCTCATCCAGGTCTGG - Intronic
1070058137 10:72954761-72954783 ACCCAGATGTCAGGCAGGACTGG + Exonic
1070212790 10:74343896-74343918 AAGCATCTGGCAGCCAGGCATGG - Intronic
1070752583 10:78972925-78972947 ACGCTGAGGCCAGCCAGGCCGGG + Intergenic
1070828885 10:79406768-79406790 TTGCAGCAGTCAGTCAGGCCTGG - Intronic
1071550859 10:86565216-86565238 ACGAAACTGTAAGCCAGACCGGG + Intergenic
1071903042 10:90141160-90141182 ACGCAGCTAACAGACTGGCCTGG + Intergenic
1072755774 10:98019797-98019819 AGGCAGCTGCCTGGCAGGCCAGG - Intronic
1073012633 10:100373321-100373343 TGTCAGCTGCCAGCCAGGCCCGG - Intergenic
1074854270 10:117461886-117461908 GTGAGGCTGTCAGCCAGGCCTGG - Intergenic
1075654088 10:124149908-124149930 GGGCCCCTGTCAGCCAGGCCTGG - Intergenic
1075742337 10:124703523-124703545 AGGCAGCGCTGAGCCAGGCCGGG + Intronic
1076056966 10:127383744-127383766 ACCCTGTTTTCAGCCAGGCCAGG - Intronic
1077202425 11:1317721-1317743 CAGCAGCTGTCAGACTGGCCAGG - Intergenic
1077302705 11:1854625-1854647 ACCCAGCCCTCAGCCAGCCCCGG - Intronic
1078067991 11:8090349-8090371 ACTCAGCTGTCTGCCTGGGCTGG - Intronic
1078190920 11:9091791-9091813 GCGCGGCTGTCAGCCTGGCGGGG + Intronic
1078766656 11:14304788-14304810 AGGCAGCTGTGAGCCAGAGCTGG + Intronic
1079087769 11:17459371-17459393 ACACTGCTGTGTGCCAGGCCTGG - Intronic
1079551934 11:21710564-21710586 CTGAAGCTGTGAGCCAGGCCTGG - Intergenic
1081356745 11:42122344-42122366 ACGAAACTGTAAGCCAGACCAGG - Intergenic
1081534587 11:43987659-43987681 CCACAGCGGTCATCCAGGCCAGG + Intergenic
1081715302 11:45245946-45245968 AGGCAGATGTCAGGAAGGCCAGG - Intronic
1082086529 11:48054892-48054914 AAGCCGCTGGCAGCCAGGCATGG + Intronic
1083300644 11:61738096-61738118 ACAGGGCCGTCAGCCAGGCCTGG - Intronic
1083606076 11:63979617-63979639 AGGGAGCTGCCAGCCAGGCCAGG - Intronic
1083624405 11:64064731-64064753 CCCCAGCAGGCAGCCAGGCCTGG + Intronic
1084524962 11:69691169-69691191 TCTCAGCTGTCGGCCAGGCACGG + Intergenic
1085109830 11:73877588-73877610 AAGAAGCTGACATCCAGGCCAGG + Intronic
1085311608 11:75520283-75520305 ACCCACCTGTGTGCCAGGCCTGG + Intronic
1087789534 11:102391851-102391873 CTGCTGCTGTCTGCCAGGCCAGG - Intergenic
1090402238 11:126456348-126456370 ACCCAGCTGTCACCCAGTACAGG - Exonic
1091603975 12:1935019-1935041 GCCCTGCTGGCAGCCAGGCCCGG + Intergenic
1092756311 12:11766580-11766602 GAGCAGCCGGCAGCCAGGCCGGG + Intronic
1093358371 12:18196697-18196719 ACGAAACTGTAAGCCAGACCAGG - Intronic
1093578751 12:20765145-20765167 ACAAAGCTGTAAGCCAGACCAGG - Intergenic
1095086009 12:38057922-38057944 ATGCAAATATCAGCCAGGCCTGG + Intergenic
1095594646 12:43945344-43945366 TCGCTGTTGTCAGCCAGGGCTGG + Intronic
1096122779 12:49099103-49099125 AATCAGCTGTGAGCCAGGCCTGG - Intronic
1096280176 12:50245936-50245958 AAGGAGCAGGCAGCCAGGCCGGG + Intronic
1096496819 12:52043518-52043540 GGGCACCTGTCTGCCAGGCCTGG + Intronic
1096688681 12:53306263-53306285 ACACAGCTGGCTGCCAGCCCGGG + Exonic
1096692460 12:53329372-53329394 ACGCTGCCGTCAGCATGGCCAGG + Exonic
1097247761 12:57615946-57615968 ACCCTGCTATCAGTCAGGCCTGG + Exonic
1098919837 12:76293198-76293220 ATGAAGCTGTAAGCCAGACCAGG - Intergenic
1100979948 12:100155952-100155974 GGGCAGCTGTCAGCAAAGCCTGG - Intergenic
1101444962 12:104731064-104731086 ATGGAGCTGGCAGCCAGGACTGG - Intronic
1101898593 12:108774232-108774254 AACCACCTGTCAGCAAGGCCTGG + Intergenic
1102177903 12:110889547-110889569 ACGCAGCTTGCAAGCAGGCCAGG + Intronic
1102312139 12:111853828-111853850 ATAAAACTGTCAGCCAGGCCGGG - Intronic
1103626641 12:122225481-122225503 ACACAACTGGCACCCAGGCCAGG - Intronic
1103901853 12:124307501-124307523 AAGCAGGTGTCAGCCAGGCAAGG - Intronic
1104035309 12:125093383-125093405 ATGCAGCTGTGAGACAGGCTGGG - Intronic
1104035597 12:125095207-125095229 AACCAGCTGTCAGCCTGTCCTGG - Intronic
1105337367 13:19486553-19486575 ACACAGCTGTTTGCCTGGCCTGG + Intronic
1105357606 13:19673174-19673196 ACACAGCTGACAGCCAGGTTTGG - Exonic
1106802852 13:33274365-33274387 AGGCAGCTGTCAGCAAGCCCAGG + Intronic
1106943381 13:34800413-34800435 ACGAAACTGTAAGCCAGACCAGG - Intergenic
1107630065 13:42333994-42334016 ATGCACCTCTCAGCCAGGCTGGG + Intergenic
1107783296 13:43927842-43927864 AATCAGCTGCCAGCGAGGCCAGG + Intergenic
1108282137 13:48871103-48871125 ACGAAACTGTAAGCCAGACCAGG + Intergenic
1108487204 13:50939062-50939084 AGGCAGCTGTGGGCCAGGCACGG + Intronic
1108632639 13:52301956-52301978 ACACAGCTGTTTGCCTGGCCTGG + Intergenic
1108654060 13:52510637-52510659 ACACAGCTGTTTGCCTGGCCTGG - Intergenic
1109136385 13:58656600-58656622 AGGCAGAGGGCAGCCAGGCCAGG - Intergenic
1111630378 13:90841213-90841235 ACGAAACTGTAAGCCAGACCAGG - Intergenic
1112506524 13:99979613-99979635 CCGCAGCGGTCAGCCAGGCGCGG + Intergenic
1112997537 13:105592703-105592725 AATCAGCTGTCAGCATGGCCAGG - Intergenic
1113324272 13:109267112-109267134 ACGAAACTGTAAGCCAGACCAGG - Intergenic
1113362257 13:109642457-109642479 ATGAAGCAGTCAGCCCGGCCAGG + Intergenic
1113928353 13:113953293-113953315 AGGAAGGTGTGAGCCAGGCCTGG + Intergenic
1118317670 14:64735580-64735602 TCTCATCTGTCAGCCAGGCTGGG - Intronic
1118786177 14:69046984-69047006 AGGCCTCTGTCAGCCAGGCCTGG + Intergenic
1119042240 14:71285534-71285556 ACTAAGGTGGCAGCCAGGCCAGG + Intergenic
1119262172 14:73244419-73244441 AAGGAGCTGAGAGCCAGGCCTGG - Intronic
1121049623 14:90811998-90812020 TCCCAGCTGTCAGCCTGGCAGGG - Intronic
1121387188 14:93538607-93538629 ATGCTGCTGTCAGTCAAGCCAGG - Intronic
1121951447 14:98174233-98174255 AGACTGCTGTCAGCCTGGCCAGG - Intergenic
1122899811 14:104777789-104777811 AGGAAGCTGTCTTCCAGGCCTGG + Intronic
1125890266 15:43260427-43260449 CCGGAGCTTCCAGCCAGGCCTGG - Exonic
1126912467 15:53430778-53430800 ACGAAACTGTAAGCCAGACCAGG + Intergenic
1128186096 15:65644587-65644609 AGGCAGCAGCCAGCCAGGCCAGG + Intronic
1128572943 15:68748875-68748897 ACTCAACACTCAGCCAGGCCAGG + Intergenic
1128875314 15:71196818-71196840 AAGCAGCTGTCAGAGAGGCAGGG + Intronic
1129467142 15:75730561-75730583 ACGCAGCAGTCGGCCAGACCTGG - Intergenic
1129720089 15:77873158-77873180 ACGCAGCAGTTGGCCAGACCTGG + Intergenic
1132373001 15:101310828-101310850 ACCCAGCTGGCAGCCAGCCATGG + Intronic
1132518745 16:377859-377881 AAGGAGGTGTCAGCCAGGCCGGG + Intronic
1133237165 16:4392724-4392746 CCGCTGCTGGCAGCCAGGGCCGG - Intronic
1134817772 16:17220346-17220368 AGCAAGCTGTCACCCAGGCCAGG + Intronic
1135382307 16:22005270-22005292 ACGCTTCTGTCACCGAGGCCAGG + Intergenic
1136605601 16:31331350-31331372 ACACAGCTGGCAGCCCCGCCGGG - Intronic
1138472096 16:57245668-57245690 CCTCAGCTGTCAGCAAAGCCTGG + Intronic
1142752017 17:1994620-1994642 ATGCTGGAGTCAGCCAGGCCTGG + Intronic
1143181705 17:4987651-4987673 ACGCCGCTGTCAGCCGGCGCTGG - Intronic
1144327192 17:14193642-14193664 ACGCAGATGTCATCTAGCCCAGG - Intronic
1144439292 17:15266945-15266967 AGGCTGCTGTCCGTCAGGCCAGG + Intergenic
1144476080 17:15590505-15590527 ACGCAGATGTCATCTAGCCCAGG - Intronic
1148839253 17:50484226-50484248 ACCCAGCTTCCAGCCAAGCCAGG - Intronic
1149535979 17:57433666-57433688 ACACAGCTGCCACCCATGCCTGG + Intronic
1151599438 17:75097351-75097373 AAGCAGCTGGGAGCCAGGCAAGG + Intronic
1151739751 17:75972347-75972369 AAGGATCTGTCAGCCAGGCGCGG + Intronic
1151837015 17:76588378-76588400 CTGCAGCACTCAGCCAGGCCAGG - Intergenic
1152126573 17:78450762-78450784 ACGCAGCCGACAGACGGGCCAGG + Exonic
1152310738 17:79548238-79548260 ACTCTGCTGTGAGCCAGGCTGGG - Intergenic
1153471578 18:5452132-5452154 ATGCAGATGTCAGCCAGGCGTGG - Intronic
1154493477 18:14938990-14939012 AGGCTGCTGTCATCTAGGCCAGG + Intergenic
1155261732 18:24050051-24050073 AGGCACCAGCCAGCCAGGCCTGG - Intronic
1155961879 18:32002001-32002023 ACGAAACTGTAAGCCAGGCCTGG - Intergenic
1159511737 18:69402956-69402978 ACACAGCTGTCAGCCAAGGGAGG + Intronic
1160510357 18:79450063-79450085 ACGCAGCCGCCAGCGAAGCCAGG - Intronic
1160791352 19:925209-925231 ACGCTGGTGACAGCCGGGCCGGG + Intergenic
1161711970 19:5853842-5853864 ACGAAACTGTAAGCCAGACCGGG - Intergenic
1162015626 19:7845113-7845135 GTGGAGCTGTCAGCCAGGTCAGG + Intronic
1162034395 19:7931491-7931513 ACCCAGCTTTCAGCCTGGTCAGG + Intronic
1162788359 19:13050353-13050375 AAGGAGGTGACAGCCAGGCCGGG - Intronic
1164035571 19:21451095-21451117 TAGCAGATGTCAGCCAGGCGTGG - Intronic
1165324473 19:35106311-35106333 AGGCAGCTGTCGGGCAGGGCAGG - Intergenic
1165784403 19:38452785-38452807 TCGCAGCTGTCAGCCACGGCTGG - Intronic
1166514987 19:43439711-43439733 ACTCAGCTGTCAGCTATTCCAGG - Intergenic
1167640920 19:50680944-50680966 ACGCCACTATCAGCCAGGCGTGG - Intronic
925828884 2:7876602-7876624 ACGAAACTGTAAGCCAGACCAGG + Intergenic
925988609 2:9235673-9235695 CCTCAGCTGTCAGCCACTCCTGG - Intronic
927809700 2:26174076-26174098 CCGGGGCTGGCAGCCAGGCCGGG + Intronic
927864331 2:26579071-26579093 ACACAGATGTCAGACAGACCTGG - Intronic
928162609 2:28941883-28941905 AGGGAGCTCTCAGCCAGGCGTGG - Intronic
928398602 2:30962093-30962115 ACTCTGCTGTCTGCCAGGGCTGG + Intronic
929441629 2:41969744-41969766 ATGCAGCAGTAAGCCAGACCGGG + Intergenic
930099189 2:47589984-47590006 ACGAAACTGTAAGCCAGACCAGG + Intergenic
930280959 2:49368981-49369003 AAGCAGGAGTCAGCCATGCCAGG - Intergenic
930703407 2:54482222-54482244 ATGCAGGTGTCAGCCGGGCATGG + Intronic
932871910 2:75409630-75409652 AGGCTGGAGTCAGCCAGGCCTGG - Intergenic
933013029 2:77090147-77090169 ACGAAACTGTAAGCCAGACCAGG - Intronic
933179832 2:79215785-79215807 ACGAAACTGTAAGCCAGACCGGG + Intronic
934084658 2:88500094-88500116 AGGCAGCTGCCAGCCAGGCAGGG - Intergenic
936008920 2:108912390-108912412 AGGCAGCTGCAAGCCCGGCCAGG - Intronic
936021879 2:109001399-109001421 ACCCATCTGAGAGCCAGGCCTGG - Intergenic
936953649 2:118003083-118003105 ATGCAGCTCTCAGCCACTCCTGG + Intronic
937324078 2:120978622-120978644 ACTGGCCTGTCAGCCAGGCCGGG + Intronic
937337460 2:121070680-121070702 ACCCAGCTGAAGGCCAGGCCTGG - Intergenic
937975544 2:127580298-127580320 CTCCAGCTGTAAGCCAGGCCTGG - Intronic
938392862 2:130918570-130918592 AGGCAGATGTCAGCCACACCTGG + Intronic
941237735 2:162996052-162996074 ACGGAGCTGAAAGGCAGGCCAGG + Intergenic
941340337 2:164297623-164297645 ACGAAACTGTAAGCCAGACCAGG - Intergenic
942396281 2:175553033-175553055 CCTCAGCTGTCAGTCAGTCCTGG + Intergenic
943460245 2:188164822-188164844 ACGAAACTGTAAGCCAGACCGGG + Intergenic
943806584 2:192132190-192132212 ACGAAACTGTAAGCCAGACCAGG - Intronic
943865284 2:192919802-192919824 ACGAAACTGTAAGCCAGACCAGG - Intergenic
944365709 2:198916775-198916797 ACCAAGCTGCCAGCCAAGCCAGG + Intergenic
944381555 2:199116625-199116647 ACACACCTGTAAGCCAGTCCTGG + Intergenic
945000329 2:205343681-205343703 CCACAGCTGTGAGCCAGGCCAGG - Intronic
945554625 2:211263228-211263250 ACGAAACTGTAAGCCAGACCGGG - Intergenic
945709835 2:213281957-213281979 ATGCAGCACTCAGCCAGGCACGG - Intergenic
945768946 2:214015714-214015736 ACTGAGCTCTCAGCCAGGACAGG - Intronic
946209986 2:218139707-218139729 ACGCAGGTATCAGCCTGTCCTGG - Intergenic
946228501 2:218277551-218277573 ACGCAGCTGGCTGCCGGCCCAGG + Intronic
946661478 2:222005098-222005120 AATCAGCTGTCAGAGAGGCCAGG - Intergenic
946893208 2:224298442-224298464 ACGAAACTGTAAGCCAGACCAGG - Intergenic
947237624 2:227959426-227959448 AAGCAGATGTTAGCCAGGCATGG + Intergenic
947743454 2:232495720-232495742 AAGCAGCTGACTTCCAGGCCAGG + Intergenic
947953011 2:234164241-234164263 ACTCAGCTGTGAGCCAGACCTGG + Intergenic
948313813 2:237011309-237011331 GGGCAGCTGTCAGCCAAGCCTGG + Intergenic
948855163 2:240726981-240727003 GGGCTGCTTTCAGCCAGGCCGGG + Intronic
948858865 2:240743314-240743336 CCTCAGCTGTCAGGCAGGACTGG - Intronic
1170431602 20:16281724-16281746 AAGAAGCAGTAAGCCAGGCCTGG + Intronic
1171942469 20:31344791-31344813 GCTCAGCTTTGAGCCAGGCCCGG - Intergenic
1172612126 20:36260146-36260168 AAGCAGCTGTCAGCCTGACAAGG - Intronic
1172760333 20:37316973-37316995 AGCCAGCAGACAGCCAGGCCAGG + Exonic
1175147570 20:56908399-56908421 CCCCACCTGTTAGCCAGGCCTGG + Intergenic
1175890620 20:62314303-62314325 TCGCAGCTGTCAGCCTGGACAGG - Exonic
1176241076 20:64076220-64076242 ATGCTGCTGTGAGCCAGCCCAGG - Intronic
1176736201 21:10548822-10548844 ACACAGCTGTTTGCCTGGCCTGG - Intronic
1178862174 21:36298661-36298683 ATGCAGCTGTCGGCCGGGCATGG + Intergenic
1179509695 21:41864544-41864566 ACGCAGTTGTCAGAGAGACCTGG + Intronic
1181061564 22:20284418-20284440 ACTCAGCTCCCAGCCTGGCCGGG + Intergenic
1181463335 22:23097913-23097935 ATGCAACTGGGAGCCAGGCCTGG - Intronic
1181580737 22:23826817-23826839 ACTCAGCTGTTTCCCAGGCCCGG - Intronic
1181668274 22:24413128-24413150 AGGCAGCTCTCAGCCAAGGCAGG + Intronic
1182034337 22:27186008-27186030 ATGCTGCTGCCAGCCAGGTCTGG + Intergenic
1182253867 22:29023842-29023864 ACCCAGCTATCAGGCAGGCATGG - Intronic
1182510927 22:30819783-30819805 ACCCAGCTGTAAGCCAGGCATGG + Intronic
1182527997 22:30933504-30933526 ACGCAGCTCTCAGACAGTGCTGG - Exonic
1183532944 22:38374032-38374054 ACACAGCTGTTTGCCTGGCCTGG + Intronic
1185211168 22:49571352-49571374 ACCCTGCTTTCAGCCAGGCGCGG - Intronic
949190457 3:1243752-1243774 ACGAAACTGTAAGCCAGACCGGG + Intronic
950536286 3:13580887-13580909 CAGCAGGTGTCAGCCACGCCTGG - Intronic
950570547 3:13797150-13797172 ACGCAGCTCTCAGCCAGGATCGG + Intergenic
951929203 3:27944802-27944824 AAGCAGTGTTCAGCCAGGCCTGG - Intergenic
952816908 3:37453593-37453615 GCCCAGGTGACAGCCAGGCCGGG + Intronic
953077196 3:39581740-39581762 ACGAAACTGTAAGCCAGACCAGG + Intergenic
953841234 3:46391713-46391735 ACGAAACTGTAAGCCAGACCAGG + Intergenic
954072261 3:48151551-48151573 ATGCAGCTGGAAGCCAGGGCAGG + Intergenic
954409254 3:50363194-50363216 ACACAGCTGGCATCCAGGCCGGG + Intronic
954581374 3:51704554-51704576 ACTCAGCTCTCACCCAAGCCAGG - Intergenic
955407941 3:58637305-58637327 ATGCAGGAGTCAGCTAGGCCCGG + Intronic
956891911 3:73622252-73622274 CTGCAGCTGACAGACAGGCCAGG + Intronic
961003595 3:123390188-123390210 ATGCAGCTCACAGCCAAGCCTGG + Intronic
961603417 3:128077104-128077126 ATGCGGCTGTCAGGCCGGCCCGG - Intronic
964225901 3:154401429-154401451 ATGAAGCTGTCAGCAAGGCAAGG - Intronic
964906577 3:161725811-161725833 ACGAAACTGTAAGCCAGACCAGG + Intergenic
964984936 3:162726488-162726510 ACGAAACTGTAAGCCAGACCCGG + Intergenic
965310032 3:167116203-167116225 ACACTCCTGACAGCCAGGCCAGG - Intergenic
967202260 3:187082480-187082502 ATGGAGCTGTCAGTCAGGCGTGG - Intergenic
967805532 3:193711655-193711677 CTCCAGCTGACAGCCAGGCCGGG + Intergenic
967853313 3:194098219-194098241 GCACAGCTGTGAGCAAGGCCAGG + Intergenic
972071205 4:35020751-35020773 ACGAAACTGTAAGCCAGACCAGG + Intergenic
972541663 4:40044166-40044188 GCGCAGGTGTCTGGCAGGCCTGG + Intergenic
973552630 4:52051320-52051342 GCGCGGCTGTCACCCAGGGCGGG + Exonic
975865153 4:78717802-78717824 ACGAAACTGTAAGCCAGACCAGG + Intergenic
976249840 4:83039196-83039218 AGTTAGCTGCCAGCCAGGCCAGG + Intronic
976696470 4:87923635-87923657 ACGAAACTGTAAGCCAGACCAGG - Intergenic
976730925 4:88260341-88260363 ATGCAGGTTTCAGCCAGGCGCGG - Exonic
977010249 4:91625857-91625879 ACGAAACTGTAAGCCAGACCAGG - Intergenic
977062573 4:92275436-92275458 ACGAAACTGTAAGCCAGACCAGG + Intergenic
977198498 4:94088568-94088590 ACGAAACTGTAAGCCAGACCAGG + Intergenic
977217220 4:94297158-94297180 ACGAAACTGTAAGCCAGACCAGG + Intergenic
977411974 4:96678166-96678188 ACTCTGCTTTCAGCCAGGCATGG + Intergenic
979526804 4:121725994-121726016 AATAAGCAGTCAGCCAGGCCCGG + Intergenic
980284884 4:130769100-130769122 ACGAAACTGTAAGCCAGACCAGG - Intergenic
981039539 4:140210598-140210620 ATGCACCTGTCAGCCGGGCACGG - Intergenic
982084032 4:151816546-151816568 AGGAAGCTGTAAGCCAGACCAGG + Intergenic
982835862 4:160119170-160119192 AATCAGCTGTCAGCATGGCCAGG + Intergenic
983055420 4:163094856-163094878 ACGAAACTGTAAGCCAGACCAGG - Intergenic
983883831 4:172960356-172960378 ACGAAACTGTAAGCCAGACCGGG + Intronic
984322215 4:178209500-178209522 ACTCAGCTGGCAGCCACTCCCGG + Intergenic
986013717 5:3739709-3739731 ATGCCGGTGCCAGCCAGGCCCGG + Intergenic
986738198 5:10682903-10682925 CCACAGCTGTGAGCCAGGCCTGG + Intronic
987891742 5:23887600-23887622 ATGCAGGTTTCAGCCAGGCGCGG - Intergenic
989615219 5:43331922-43331944 ACGAAACTGTAAGCCAGACCGGG + Intergenic
989987803 5:50722444-50722466 ACACAGCAGTCAGCCAGCCTGGG + Intronic
991424595 5:66477829-66477851 AAGCAGCTGTCAGCTTGGGCAGG + Intergenic
994532606 5:100988198-100988220 ACGAAACTGTAAGCCAGACCAGG + Intergenic
994989482 5:106980146-106980168 ACGAAACTGTAAGCCAGACCAGG - Intergenic
995769311 5:115652262-115652284 ACGAAACTGTAAGCCAGACCGGG - Intergenic
996726070 5:126674299-126674321 ACGAAGCTGTAAACCAGACCAGG + Intergenic
997157165 5:131573233-131573255 ACGAAACTGTAAGCCAGACCAGG - Intronic
997509409 5:134443201-134443223 AACAAGCTGTCAGCCAGGCGTGG - Intergenic
998420424 5:141980217-141980239 AGGCAGCTGGCAGCACGGCCGGG - Exonic
1001378182 5:171282768-171282790 ATGCAGCTTTCAGCCAGGTGCGG - Intronic
1001426306 5:171625100-171625122 AGGCAGCTTTCTGCCTGGCCTGG + Intergenic
1002605764 5:180381829-180381851 ACACAGCTGCCAGGCAGGACAGG - Intergenic
1003364644 6:5460844-5460866 ACTCAGTTGTCAGGAAGGCCAGG + Intronic
1004015791 6:11730752-11730774 ATGCAGCTGTCACCCAGCCTTGG - Intronic
1004637585 6:17483762-17483784 ACACCCCTGTCAGCCACGCCGGG - Intronic
1005821950 6:29605929-29605951 AAGCTGCTGTCAGTCAGGCAAGG + Intronic
1006220337 6:32484372-32484394 ATGCTCCTGACAGCCAGGCCCGG + Intergenic
1006340313 6:33443171-33443193 AGGCTGCTGTCAGCGAGGCCTGG - Exonic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1012014457 6:93834022-93834044 ACGAAACTGTAAGCCAGGCCAGG + Intergenic
1012117295 6:95318331-95318353 AAGTAGCTGTCACTCAGGCCTGG - Intergenic
1012921383 6:105224059-105224081 ACTGAGCTGTCAGACTGGCCAGG + Intergenic
1012939634 6:105403086-105403108 AAGCCGCTGTCTGCGAGGCCGGG + Intergenic
1012988906 6:105904750-105904772 ACGCAGATGGCAGCCCAGCCTGG - Intergenic
1013479510 6:110541945-110541967 ACCCAGCTCACAGCCAGGCACGG + Intergenic
1013891636 6:115033650-115033672 ACGAAACTGTAAGCCAGACCAGG - Intergenic
1014454937 6:121624383-121624405 ACGAAACTGTAAGCCAGACCAGG + Intergenic
1016426339 6:143939592-143939614 ACCCAGCTGCCAGACAGACCTGG - Intergenic
1016853203 6:148641565-148641587 ACGAAACTGTAAGCCAGACCAGG - Intergenic
1017672439 6:156779377-156779399 ACGCCGCTGCCAGCCCGGCCTGG + Exonic
1018003937 6:159603062-159603084 AGGGCGCTGCCAGCCAGGCCTGG - Intergenic
1018034091 6:159866901-159866923 ACACCGCTGACAGCCAGCCCGGG + Intergenic
1018195475 6:161353066-161353088 ACACATCTATCAGCCAGGCGCGG - Intronic
1018895317 6:168012755-168012777 ACGCAGCTGTGACCCAGACATGG - Intronic
1019262281 7:88300-88322 ACCAAGGTATCAGCCAGGCCTGG + Intergenic
1022372808 7:29786617-29786639 ACGAAACTGTAAGCCAGACCTGG - Intergenic
1022707970 7:32823800-32823822 TAGCAGTTGGCAGCCAGGCCTGG - Intergenic
1022854778 7:34303836-34303858 ACGAAACTGTAAGCCAGACCGGG + Intergenic
1022914989 7:34939541-34939563 TAGCAGTTGGCAGCCAGGCCTGG + Intronic
1026584982 7:71648725-71648747 ACGCAGCTGAGGGCCAGGCTTGG - Intronic
1027158157 7:75783022-75783044 ACGAAACTGTAAGCCAGACCGGG - Intronic
1030193363 7:106831096-106831118 ACGAAACTGTAAGCCAGACCAGG - Intergenic
1031399921 7:121317337-121317359 ACGAAACTGTAAGCCAGACCAGG - Intergenic
1032488905 7:132309272-132309294 CCGCATCTCTCAGCGAGGCCAGG - Intronic
1032683508 7:134209158-134209180 CCGCAGCCCTCAGCCAGGCCAGG + Intronic
1033465106 7:141582767-141582789 ACGAAACTGTAAGCCAGACCGGG + Intronic
1034459054 7:151187873-151187895 GCCCAGCTGTCAGTCAGGCCGGG + Intergenic
1034481036 7:151320701-151320723 ACGCTCCTGATAGCCAGGCCTGG + Intergenic
1034756216 7:153622910-153622932 ACCAAGGTGTCAGCCAGGCCTGG + Intergenic
1035678773 8:1472297-1472319 ACGCAGCTGGGAGGGAGGCCAGG + Intergenic
1036185994 8:6622684-6622706 AGGCAGCTGTCTGCAAGCCCAGG - Intronic
1036767536 8:11558240-11558262 ACGCAGCTGTGAGGGAGCCCAGG + Intronic
1037693967 8:21207780-21207802 GCACAGCTGTTGGCCAGGCCAGG + Intergenic
1038612810 8:29070563-29070585 GGGCAGCTGTCAGCGAGGCCAGG + Exonic
1039848065 8:41340234-41340256 ATCCAGCTCTCTGCCAGGCCAGG + Intergenic
1041670946 8:60491461-60491483 ACACTGCTGTCAGAAAGGCCAGG + Intergenic
1043720776 8:83545149-83545171 ACGAAACTGTAAGCCAGACCGGG - Intergenic
1044148579 8:88746160-88746182 ACGAAACTGTAAGCCAGACCAGG + Intergenic
1044807381 8:96021898-96021920 AGGCTGTTGTCAGCCAGGCTTGG - Intergenic
1047111472 8:121793986-121794008 ATGCAGAGATCAGCCAGGCCAGG - Intergenic
1047829607 8:128615853-128615875 ACGAAACTGTAAGCCAGACCAGG + Intergenic
1048877743 8:138850400-138850422 TCGCAGCTGTCAGCAGGTCCAGG - Intronic
1049157279 8:141074865-141074887 AAGCAGGTGTCCGCGAGGCCGGG + Intergenic
1049219083 8:141420693-141420715 ACACAGGTCTCAGCCAGGCTCGG - Intronic
1049282594 8:141757984-141758006 AGGCAGATGAGAGCCAGGCCTGG - Intergenic
1049639976 8:143711131-143711153 GGGCAGCTGGCAGCCAGACCCGG - Intronic
1050126604 9:2362494-2362516 AAGCATATGACAGCCAGGCCTGG + Intergenic
1050379378 9:5010608-5010630 AGGCAACTGACAGCCAGGCGTGG - Intronic
1051712037 9:19941022-19941044 TGGCAGCTTTCAGCCAGGCTTGG - Intergenic
1052318335 9:27139612-27139634 ATAAAGCTGTCAGCCAGGCATGG - Intronic
1056437306 9:86587255-86587277 ACGAAACTGTAAGCCAGACCAGG + Intergenic
1056720005 9:89063416-89063438 TCACAGCTGTCAGCCAGGTGTGG - Intronic
1057036418 9:91814875-91814897 ACCCAGCTGAAACCCAGGCCCGG + Intronic
1057217028 9:93234766-93234788 ACGCAGCTGTCAGCTGGCCACGG - Intronic
1057220176 9:93253274-93253296 CCGCAGCTGACAGCAAGGACGGG - Intronic
1057234179 9:93345821-93345843 GTCCAGCTGTCAGCCAGGCCTGG + Intronic
1057251814 9:93509206-93509228 ATCCAGCTGTCAGCCAGGCATGG - Intronic
1058447190 9:105064572-105064594 AGACAGCAGTCAGCCAGGCAGGG - Intergenic
1061201669 9:129141751-129141773 AAGCAGCAGCCAGCCTGGCCTGG - Intronic
1061885605 9:133589788-133589810 ACAGAGCTGTAGGCCAGGCCAGG + Intergenic
1061930952 9:133832927-133832949 ATGCAGGTCACAGCCAGGCCTGG - Intronic
1062266603 9:135689442-135689464 GCCCAGCTGGCAGCCGGGCCAGG - Intergenic
1062371521 9:136241618-136241640 ACGCAGCTGAGTGACAGGCCGGG - Intronic
1062390977 9:136333752-136333774 TCGCCGCTGCCAGCCAGGACAGG - Intronic
1062474293 9:136719759-136719781 ACACTGCTGTCTGCCAGGCTGGG - Intronic
1187319532 X:18227375-18227397 AATCAGCTGTCAGCACGGCCAGG - Intergenic
1189202147 X:39205537-39205559 ATCAAGGTGTCAGCCAGGCCTGG - Intergenic
1189248397 X:39581033-39581055 AGCCAGCTGTCAGTCAGGGCAGG - Intergenic
1190006476 X:46744276-46744298 ACCCAGCTGCAAGACAGGCCAGG + Intronic
1190167326 X:48083944-48083966 CCGCAGTCATCAGCCAGGCCTGG - Intergenic
1190551148 X:51582307-51582329 ACCCAGCTTTTAGCCAGGCATGG + Intergenic
1192764720 X:74129131-74129153 ACGAAACTGTAAGCCAGACCAGG + Intergenic
1193927669 X:87508622-87508644 AAGAAACTGTCAGCCAGGCGCGG + Intergenic
1196763625 X:119223165-119223187 GCGCAGCAGGCGGCCAGGCCCGG + Intergenic
1199978003 X:152905693-152905715 ATGAAGCTGTCAGACAGGCTTGG + Intergenic
1200132923 X:153861332-153861354 AGGCAGCCAACAGCCAGGCCTGG + Intergenic
1200292435 X:154886180-154886202 ACGCCGCTCACAGCCCGGCCAGG + Intronic
1200339278 X:155381920-155381942 ACGCCGCTCACAGCCCGGCCAGG + Intergenic
1200347192 X:155458773-155458795 ACGCCGCTCACAGCCCGGCCAGG - Intergenic
1202594496 Y:26521986-26522008 ACACAGCTGTTTGCCTGGCCTGG - Intergenic