ID: 924626806

View in Genome Browser
Species Human (GRCh38)
Location 1:245702414-245702436
Sequence ATGGAGACGCAGAGCAAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 215}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924626806_924626814 19 Left 924626806 1:245702414-245702436 CCCTGTTTGCTCTGCGTCTCCAT 0: 1
1: 0
2: 1
3: 16
4: 215
Right 924626814 1:245702456-245702478 AGTTGACTTGGAGCAGGTTTGGG 0: 1
1: 0
2: 0
3: 12
4: 136
924626806_924626812 13 Left 924626806 1:245702414-245702436 CCCTGTTTGCTCTGCGTCTCCAT 0: 1
1: 0
2: 1
3: 16
4: 215
Right 924626812 1:245702450-245702472 TCTTGCAGTTGACTTGGAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 130
924626806_924626815 25 Left 924626806 1:245702414-245702436 CCCTGTTTGCTCTGCGTCTCCAT 0: 1
1: 0
2: 1
3: 16
4: 215
Right 924626815 1:245702462-245702484 CTTGGAGCAGGTTTGGGAGCTGG 0: 1
1: 1
2: 2
3: 36
4: 295
924626806_924626810 7 Left 924626806 1:245702414-245702436 CCCTGTTTGCTCTGCGTCTCCAT 0: 1
1: 0
2: 1
3: 16
4: 215
Right 924626810 1:245702444-245702466 TTCCTCTCTTGCAGTTGACTTGG 0: 1
1: 0
2: 1
3: 10
4: 155
924626806_924626813 18 Left 924626806 1:245702414-245702436 CCCTGTTTGCTCTGCGTCTCCAT 0: 1
1: 0
2: 1
3: 16
4: 215
Right 924626813 1:245702455-245702477 CAGTTGACTTGGAGCAGGTTTGG 0: 1
1: 0
2: 1
3: 10
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924626806 Original CRISPR ATGGAGACGCAGAGCAAACA GGG (reversed) Intronic
903579887 1:24362872-24362894 ATGCAGATTCATAGCAAACAGGG - Intronic
903789742 1:25884729-25884751 ATGGAGACCCAGAGAAATAAAGG + Intronic
903858189 1:26349528-26349550 ATGGAGACCCAGAGAGATCAAGG - Intronic
904293713 1:29504220-29504242 ATGGAGACCCAGAGACAACAGGG - Intergenic
906294745 1:44642711-44642733 ATGGCAAAGCAGAGAAAACAGGG - Intronic
906471792 1:46137066-46137088 ATTGAGACCCAGAGCAATGAGGG + Intronic
906575408 1:46885018-46885040 ATGGGGACTCAGAGAAAAGATGG - Intergenic
906596568 1:47082877-47082899 ATGGGGACTCAGAGAAAAGATGG + Intronic
908170651 1:61501399-61501421 GTGGAGACGGAGAGGAAAAAGGG - Intergenic
909041729 1:70661328-70661350 ATGCAGATGCAGAGCAAAGCGGG - Intergenic
909998774 1:82315812-82315834 ATGGAAACGCACAGAAAATAAGG - Intergenic
910016218 1:82527849-82527871 ATGGACACCAAAAGCAAACAGGG - Intergenic
910793417 1:91074519-91074541 ATGGAAACGCAAAGCAGCCAGGG - Intergenic
912953032 1:114133734-114133756 CTGGAGAGCCAGAGCAAACCGGG - Intronic
915030999 1:152880487-152880509 ATGGAGAGGCACACCAAAAATGG - Intronic
916760692 1:167814715-167814737 ATGGAGATGGAGGGCAGACATGG + Intronic
917721046 1:177786876-177786898 AGGAAGACTCAGAGCAATCATGG + Intergenic
917766383 1:178223186-178223208 ATGGAGAATCAAAACAAACATGG + Intronic
919204265 1:194400369-194400391 ATGGAGAGACAGCTCAAACAAGG + Intergenic
920831024 1:209465812-209465834 ATGGAGTTGCAATGCAAACAAGG + Intergenic
921031315 1:211337434-211337456 ATGGAGAGGCAGAGAAACGAAGG + Intronic
921297993 1:213722640-213722662 AGGGAGACCCAGAGTGAACAAGG + Intergenic
922216560 1:223524824-223524846 ATGGAGACAAAGGCCAAACAGGG + Intergenic
922370335 1:224904151-224904173 ATGGTGACCCAGAGCACACTTGG - Intronic
923469937 1:234281450-234281472 ATGGGTACAAAGAGCAAACAAGG - Intronic
924626806 1:245702414-245702436 ATGGAGACGCAGAGCAAACAGGG - Intronic
1063672342 10:8109430-8109452 ATGAAGACGCAGAGATAAGAAGG - Intergenic
1063834893 10:10001533-10001555 ATGAAGACACAGAGCAGCCATGG - Intergenic
1067570008 10:47364852-47364874 ATGGAGAGGCTGAGCACAGAAGG - Intergenic
1071318280 10:84424862-84424884 ATGGAGTCACAGGGCAAACTGGG + Intronic
1071379889 10:85047995-85048017 TTGGAGACCCAGAGAAAGCATGG - Intergenic
1073660612 10:105472032-105472054 ATGGAAATGAAGAGCAAAGAAGG + Intergenic
1074527994 10:114278182-114278204 AGGGAGACGCAGAGCATCCAGGG - Intronic
1074677994 10:115874287-115874309 ATGGAGAGGCAGGGCAATCAGGG - Intronic
1076316102 10:129542804-129542826 ATGGAATCGCAGAGCCAGCAGGG - Intronic
1076827762 10:132978149-132978171 ACAGAGACGCAGAGCACCCAGGG + Intergenic
1079791478 11:24745527-24745549 ATGGACACGAAAAGCAAGCAGGG - Intronic
1080798399 11:35587193-35587215 ATTGAGAAGCAGAGAAATCAAGG + Intergenic
1083193373 11:61068435-61068457 GTGGAGATGCTGAGCAGACAGGG - Intergenic
1083783984 11:64933563-64933585 ATGGAGTCACAGAACAAAAATGG + Intronic
1084116720 11:67046677-67046699 AGGGAGAGGCAGAGGACACATGG - Intronic
1085536797 11:77226199-77226221 ATGGAGATGAGGAGGAAACATGG - Intronic
1086942803 11:92815770-92815792 ATGGAGAGGAAGATGAAACATGG + Intronic
1090806939 11:130208740-130208762 CCGGACACGCAGAGGAAACACGG - Intronic
1091467037 12:693818-693840 ATGGAGTTTCAGAGAAAACAGGG + Intergenic
1092093817 12:5825338-5825360 ATGGTGATTCAGAGCATACATGG - Intronic
1092952710 12:13522463-13522485 ATGGAAACAGAGAGCAAACTGGG - Intergenic
1093852398 12:24056494-24056516 ATGGAGAAATAGAGCAACCATGG - Intergenic
1095121730 12:38426906-38426928 ATGGAGACTCAGATAATACATGG - Intergenic
1097333661 12:58358622-58358644 ATGGAGAGGCAGAGCATATGAGG + Intergenic
1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG + Intergenic
1097909801 12:64957706-64957728 GTGGAGACCCAGAGCAACCTTGG + Intergenic
1098044987 12:66391241-66391263 ACTGAAACCCAGAGCAAACAAGG + Intronic
1099150170 12:79101469-79101491 ATGGAGAGTCAGAGTATACAAGG + Intronic
1100725736 12:97406472-97406494 ATGGAGAAGCAGAGCAGAATGGG - Intergenic
1102243910 12:111343044-111343066 AGGCAGACGCAAGGCAAACAGGG - Intronic
1103101993 12:118185056-118185078 ATGGAGACACAGAGCACAAGTGG + Intronic
1104971430 12:132532602-132532624 ATGGACACGCTCAGCACACATGG - Intronic
1105433753 13:20360104-20360126 ATTAAGAAGCAGAGCATACATGG + Intergenic
1106097495 13:26660949-26660971 ATGGAGAGAGAGAGGAAACAAGG + Intronic
1107983391 13:45754581-45754603 ATGTTGATGCAGAGCATACATGG + Intergenic
1108362677 13:49681844-49681866 ATGAAGACCTAGAGAAAACATGG + Intronic
1108518918 13:51227255-51227277 ATGGAGACTCAGAGGGCACATGG + Intronic
1108923454 13:55706565-55706587 ATTGAGACAAACAGCAAACAGGG + Intergenic
1109551401 13:63906072-63906094 ATGCAGAAGCACAGCGAACAGGG + Intergenic
1109689538 13:65867638-65867660 AGGAACACGCAGAGCACACAAGG + Intergenic
1110709326 13:78632746-78632768 TTGGTGATGCAGAGTAAACAAGG + Intronic
1114818658 14:25989958-25989980 AAGGAGACTCAAAGAAAACAAGG + Intergenic
1115714302 14:36085695-36085717 TTGGAAATGTAGAGCAAACATGG - Intergenic
1118950567 14:70433189-70433211 ATGCTGACTCAGAGCATACACGG + Intergenic
1121493792 14:94378320-94378342 AGGGAGACTCAGAGAAAACATGG + Exonic
1122535811 14:102461726-102461748 GTGGAGCCGCAGAGCAAAGCAGG - Intronic
1122903903 14:104793225-104793247 ATGGACAGGGAGAGCAAACGGGG - Exonic
1123921435 15:25072588-25072610 ATGGAGATGGAGATCAATCATGG + Intergenic
1125130035 15:36273676-36273698 ATGGAATTGAAGAGCAAACACGG + Intergenic
1125351123 15:38768575-38768597 AAGGAGACTCAGAGCTACCATGG - Intergenic
1126789591 15:52209028-52209050 ATGGGGAGGCAGAGCAGCCAGGG + Intronic
1127401504 15:58591154-58591176 AGAGAGAGACAGAGCAAACAGGG + Exonic
1128717087 15:69916640-69916662 GTGGAGATGCAGAGCAGGCATGG + Intergenic
1131307693 15:91259761-91259783 ATGGAGACACAGAGGCATCAGGG - Intronic
1132409420 15:101565452-101565474 AGAGAGAGGCAGAGGAAACAAGG + Intergenic
1132691205 16:1182679-1182701 ATTGAGACTCAGAGCAGACTGGG + Intronic
1141458866 16:84164395-84164417 ATGAAGAAGCAGAGCACAGAGGG - Intronic
1142080147 16:88144776-88144798 ATGGACACGTCTAGCAAACAAGG - Intergenic
1144193492 17:12868195-12868217 ATGAAGACGCAGAGAGAAGATGG - Intronic
1145829896 17:27907450-27907472 ATGGAGAGTCAGAGGAAAGAGGG + Intergenic
1147839221 17:43358868-43358890 TTGGAAAAGCAAAGCAAACACGG + Intergenic
1148195077 17:45707370-45707392 ATGGAGACTGAAACCAAACAGGG - Intergenic
1152298269 17:79480910-79480932 CTGGAGACGCAGTGGAGACAAGG - Intronic
1156509026 18:37619922-37619944 AGTGAGAAGCAGAGAAAACAAGG + Intergenic
1158280413 18:55819393-55819415 ATGGAGAAGGAGACCAAAGAGGG + Intergenic
1160064552 18:75562561-75562583 ATTGAGAGGCAGAGAAAAGAAGG + Intergenic
1160229436 18:77035150-77035172 CTGGAGAAGCAGAGGAAACCTGG - Intronic
1163505426 19:17703183-17703205 AAGGAGCCGCAGAGAAAAAAGGG - Intergenic
1164237884 19:23352778-23352800 ATGGACACCCAAAGCAAGCAGGG + Intronic
1165362328 19:35344653-35344675 AGGGAGGCCCAGAGCAAGCAGGG + Intronic
1165432700 19:35781612-35781634 ATGGCGACGAAGAGCCAAGAGGG + Intronic
1167261989 19:48463929-48463951 ATGGAGGTCCAGAGAAAACATGG - Intronic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1168115798 19:54220923-54220945 GGGGAGACTCAGAGAAAACAGGG - Intronic
1168133724 19:54337235-54337257 GGGGAGACTCAGAGAAAACAGGG - Intronic
929822959 2:45288122-45288144 ATGGAGAAGCAGAGAAGCCAGGG - Intergenic
934676330 2:96252460-96252482 AGCCAGACCCAGAGCAAACAAGG + Exonic
936940606 2:117880124-117880146 ATTCAGAGGCAGAGCAAAGATGG - Intergenic
937064432 2:119006514-119006536 AAGGAGACCCAGAGCAAGGATGG + Intergenic
937852385 2:126647352-126647374 ATGCTGATGCAGAGCATACATGG + Intergenic
939596925 2:144136683-144136705 ATGGAGAGGCAGAGAAAAAAGGG - Intronic
939788491 2:146544732-146544754 ATGCTGACTCAGAGCATACATGG + Intergenic
941768524 2:169326119-169326141 AGGGAGAGGCAGAGCAAAAAAGG - Intronic
942919586 2:181355557-181355579 ATGGAAATGATGAGCAAACAGGG + Intergenic
944134766 2:196386615-196386637 AAAGAGACCCAGAGCAAAGAAGG - Intronic
945742304 2:213678597-213678619 AGGGAGTTGCAGAGTAAACAAGG - Intronic
945955319 2:216081500-216081522 GTGGAGCTGCAGAGCAAAGACGG - Intronic
946626025 2:221613138-221613160 CTGGAGACGCAGAGGAGAGAAGG + Intergenic
948509238 2:238452253-238452275 ATGAAGAGGCAGAACACACAAGG - Intergenic
948611735 2:239173463-239173485 ATTGAAACCCCGAGCAAACAAGG + Intronic
1168904971 20:1395795-1395817 ATGGAGAATGAGAGCAACCAGGG + Intergenic
1169891857 20:10461973-10461995 ATGGAGTCTCAGAGCGAAAAAGG + Intronic
1170604022 20:17862676-17862698 ATGGAGAGGGCAAGCAAACAAGG + Intergenic
1175392703 20:58637136-58637158 ATGGAGAGGCAGAGCCAAGATGG - Intergenic
1178171267 21:30042449-30042471 AGGGAAACAGAGAGCAAACAAGG - Intergenic
1179421647 21:41241190-41241212 AGGGAGACACAGAGCACACGAGG + Intronic
1181006238 22:20014995-20015017 AGGGAGTGCCAGAGCAAACATGG + Intronic
949445801 3:4132451-4132473 ATGGTGATTCAGAGCATACATGG - Intronic
949452506 3:4202123-4202145 ATGGAGAACCAAAGCAAAAATGG - Intronic
950164570 3:10784384-10784406 ATGGGGAGGGAGAGAAAACACGG + Intergenic
951545267 3:23818566-23818588 AGAGAGAGACAGAGCAAACATGG - Intronic
954099120 3:48355823-48355845 ATGGAGACCCAGGGCTAACAAGG - Intergenic
954638257 3:52083322-52083344 GTGGCGAAACAGAGCAAACAAGG + Intronic
955116558 3:56010983-56011005 ATGGAGAGGCTAAGCAAAGAGGG - Intronic
956159160 3:66330313-66330335 ATGGAAACGCTGAGTAGACAGGG + Intronic
956420745 3:69084510-69084532 ATGGTGAAACAGAGAAAACATGG + Intergenic
958088105 3:88839026-88839048 ATGGACACCAAAAGCAAACAGGG - Intergenic
958855931 3:99385617-99385639 ATGGAGACTCACAGCAGAGAGGG + Intergenic
960299031 3:115979171-115979193 ATGGGGAAGAAGAGCAAAGAGGG + Intronic
961824146 3:129589994-129590016 GTGGAGACGCAGAGCCAGCCGGG - Intronic
962193260 3:133333331-133333353 ATGGATAAGCAGAGTAAAGAAGG - Intronic
968682928 4:1933914-1933936 ATGGAACAGCTGAGCAAACATGG + Intronic
970804864 4:20018786-20018808 AAGGAAATGCAGAGCAAACATGG - Intergenic
971228904 4:24781597-24781619 ATGCAGATGCAGAGCCATCAGGG + Intergenic
971503448 4:27341231-27341253 AGGGAGAGGCACAGCATACAAGG + Intergenic
971931317 4:33087331-33087353 ATGGAGAACCAGAGCAAATCTGG + Intergenic
974695251 4:65359847-65359869 TTGAAGACGTAGAGCTAACATGG - Intronic
981825048 4:148930447-148930469 ATGGACACCAAAAGCAAACAGGG + Intergenic
982969572 4:161966629-161966651 GTGAAGACACAGAGAAAACATGG + Intronic
983523067 4:168730909-168730931 ATGGAGATGGAGAGCCAAAAGGG - Intronic
993878869 5:93340376-93340398 ATGGAGAAGGAGAGGAAACTAGG - Intergenic
995227275 5:109715046-109715068 AAGGAGTTGCAGAGCAACCATGG + Intronic
995816413 5:116174104-116174126 ATGGAGATGGAGAGCAATAACGG + Intronic
996660882 5:126001407-126001429 ATGCAGACACACAGAAAACAAGG - Intergenic
997458830 5:134038441-134038463 AGGCAGAGGCAGAGCATACAGGG + Intergenic
998769381 5:145524525-145524547 ATCCAGAAGCAGAGCAAAGAGGG + Intronic
999859023 5:155625088-155625110 ATGGAGACGGAGAGAAGGCAAGG + Intergenic
1000759676 5:165206810-165206832 ATGGAGACGGAGAACAAAGAGGG + Intergenic
1000863856 5:166488878-166488900 ATGGAGACCCTGAGGGAACAGGG - Intergenic
1001152660 5:169245722-169245744 ATGGAGAGGAAGAGCAACCCTGG + Intronic
1005277129 6:24231215-24231237 AGGGAGACACACAGCAAACCTGG - Intronic
1006087191 6:31604494-31604516 ACGGAGAGGCAGACCAGACACGG - Intergenic
1007770261 6:44186389-44186411 CTGGAGACGGAGAGGAAGCAGGG - Intergenic
1007850867 6:44801586-44801608 AGGGAGACCCAGAGTTAACAAGG + Intergenic
1008370386 6:50724219-50724241 ATGCAACCGCAGAACAAACAGGG + Intronic
1013159587 6:107529075-107529097 AAGGAGACCCAGAGAAAACTGGG - Intronic
1013348791 6:109287796-109287818 ATGGAGATGGGGAGCAAAAAAGG + Intergenic
1015916515 6:138222961-138222983 ATGGAGTCACAGAGTAAACAAGG - Intronic
1015958557 6:138623303-138623325 AAGGAGACGAAGAGACAACAGGG + Intronic
1016373389 6:143396686-143396708 ACGGAGAGGCAGTGTAAACATGG + Intergenic
1017159400 6:151350874-151350896 TTGAAGACGCAGGGCCAACAGGG + Exonic
1018322631 6:162628193-162628215 ATGAAGACGCAGAGGAAACAAGG + Intronic
1018393560 6:163359497-163359519 ATAGAGACACAGAGAAAAGATGG + Intergenic
1018498255 6:164372450-164372472 ATGAAGACGCAGAGAAGACATGG + Intergenic
1018706580 6:166467907-166467929 ATGGAGAAGCAGATCATACGGGG + Intronic
1024745161 7:52398067-52398089 ATGGACACCAAAAGCAAACAGGG - Intergenic
1024949296 7:54842008-54842030 CTGGAGACGCAAAGTAAACCAGG + Intergenic
1025638115 7:63341579-63341601 ATTGAGACGCTGAGAAAAAAAGG + Intergenic
1025644581 7:63406520-63406542 ATTGAGACGCTGAGAAAAAAAGG - Intergenic
1026653784 7:72238687-72238709 ATAGAGGTGCAGAGCAAAGAGGG - Intronic
1028525282 7:91777816-91777838 ATGGAGAATCAGAGCAAGCCTGG - Intronic
1028925418 7:96352162-96352184 ATGGAGATGCAGAGAAAAACAGG + Intergenic
1029136779 7:98378588-98378610 AAGGAGACAGAGAGTAAACAGGG - Intronic
1032209498 7:129900535-129900557 ATGGAGAGGAAGAAGAAACATGG - Intronic
1032743224 7:134760316-134760338 ATGGAGAGGCAGAGCAGGCAGGG + Intronic
1035808627 8:2473037-2473059 AGGGAGATGCAGAGCAACCCTGG + Intergenic
1035909414 8:3549124-3549146 ATCTAGAAGCAAAGCAAACATGG - Intronic
1037108260 8:15136663-15136685 ATGGAGAATGAGAGCAAGCAGGG - Intronic
1038024023 8:23573232-23573254 CGGGTGACGCAGAGCAGACAAGG - Exonic
1041527304 8:58821840-58821862 ATGGAGACTTAGAACATACAAGG + Intronic
1043376534 8:79655932-79655954 TTGGAGATGCAGAGCAAAACAGG + Intronic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045450838 8:102323247-102323269 ATTCATATGCAGAGCAAACAAGG + Intronic
1045915247 8:107462224-107462246 ATGAAGAGGGAGAGAAAACAAGG + Intronic
1046871094 8:119206721-119206743 AAGGAGAGGCAAAGCAAAGATGG + Intronic
1047388922 8:124434153-124434175 ATGGGGATGCAGAGGAAACAAGG - Intergenic
1047779035 8:128096944-128096966 CTGGGGAGGCAGAGGAAACATGG - Intergenic
1047905456 8:129468235-129468257 ATGGAGAGGCAGGGCATCCAAGG - Intergenic
1047923096 8:129655422-129655444 ATGTAGACCCAGAGAAAAAACGG + Intergenic
1048094443 8:131276014-131276036 ATGGAGAAGCACAGCAGCCATGG + Intergenic
1048407736 8:134140292-134140314 ATGGAGAGGCAGTTCATACAGGG - Intergenic
1048670645 8:136715470-136715492 AGGGAGACGCAGAGAACACCTGG - Intergenic
1048964196 8:139603582-139603604 AGGAAGACCAAGAGCAAACAGGG + Intronic
1048964493 8:139605485-139605507 AGGAAGACCAAGAGCAAACAGGG + Intronic
1049345633 8:142137062-142137084 AAGGAGACTCAGAGCAAAGGCGG - Intergenic
1049718004 8:144102747-144102769 ATGAAGAGGCAGAGCAGGCAGGG - Intronic
1051331202 9:16026472-16026494 GTGGAGACGCAGGGCAACAAAGG - Intronic
1056014364 9:82367339-82367361 ATGGAGAAGGAAAGGAAACATGG - Intergenic
1056042098 9:82678906-82678928 ATGGAGGTGCAGAGTACACAGGG + Intergenic
1056353670 9:85776939-85776961 ATGCTGATGCAGAGCATACACGG + Intergenic
1059990332 9:119859325-119859347 AAGGAGACCCAGAGCAACCCAGG + Intergenic
1060084219 9:120681798-120681820 AGGGACAGGGAGAGCAAACACGG + Intronic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1061629639 9:131863972-131863994 ATGGAGACGCAGAGAGGATAAGG - Intronic
1061629731 9:131864632-131864654 ATGCAGGCGCAGAGCAAGCTGGG + Intronic
1062570778 9:137184205-137184227 ATGCAGACACAGAGCCGACATGG + Intronic
1062570788 9:137184249-137184271 ATGCAGACACAGAGCAGACACGG + Intronic
1062570805 9:137184357-137184379 ATGCAGACAAAGAGCAGACACGG + Intronic
1062570816 9:137184421-137184443 ACGCAGACACAGAGCAGACACGG + Intronic
1062570822 9:137184465-137184487 ACGCAGACACAGAGCAGACACGG + Intronic
1062570859 9:137184677-137184699 ACGCAGACACAGAGCAGACACGG + Intronic
1062570869 9:137184742-137184764 ACGCAGACACAGAGCAGACACGG + Intronic
1062570878 9:137184786-137184808 ACGCAGACACAGAGCAGACACGG + Intronic
1062570885 9:137184829-137184851 ATGCAGACACAGAGGAGACACGG + Intronic
1185461801 X:336301-336323 ATGGACACACAGAGGAACCACGG + Intronic
1186289503 X:8081019-8081041 ATGGGGAAGCAGAGCACAGAAGG + Intergenic
1187268402 X:17758306-17758328 AAGGAGATGCAGATGAAACAGGG + Intergenic
1192343231 X:70281065-70281087 ATGGAGACGGAGGGAAAAAATGG - Intronic
1193833140 X:86311487-86311509 ATGGTGATTCAGAGCATACATGG - Intronic
1195384244 X:104298599-104298621 AAGGAGATGCAGTGCAAACTAGG + Intergenic
1195459076 X:105103341-105103363 ATGGGAAACCAGAGCAAACAGGG - Intronic
1196296016 X:113998342-113998364 CTGGTGACACAGATCAAACATGG - Intergenic
1197420066 X:126227715-126227737 ATGCTGACTCAGAGCATACAGGG - Intergenic
1198868731 X:141153713-141153735 CTGGAGAAACAGAGCAAATAGGG + Intergenic
1199589299 X:149451332-149451354 ATGGAGAGTCCGAGCCAACAGGG - Intergenic
1201442290 Y:14021305-14021327 TTTGAGAAGCAGAACAAACATGG - Intergenic
1201587122 Y:15573344-15573366 ATGCAGACACAGAGAAATCACGG + Intergenic