ID: 924630588

View in Genome Browser
Species Human (GRCh38)
Location 1:245736470-245736492
Sequence TGGCAGAAACAATATGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924630584_924630588 -5 Left 924630584 1:245736452-245736474 CCACGAACTTGGTGGTTCTGGCA No data
Right 924630588 1:245736470-245736492 TGGCAGAAACAATATGGGGATGG No data
924630581_924630588 5 Left 924630581 1:245736442-245736464 CCAGTTAATTCCACGAACTTGGT No data
Right 924630588 1:245736470-245736492 TGGCAGAAACAATATGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924630588 Original CRISPR TGGCAGAAACAATATGGGGA TGG Intergenic
No off target data available for this crispr