ID: 924630588 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:245736470-245736492 |
Sequence | TGGCAGAAACAATATGGGGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
924630584_924630588 | -5 | Left | 924630584 | 1:245736452-245736474 | CCACGAACTTGGTGGTTCTGGCA | No data | ||
Right | 924630588 | 1:245736470-245736492 | TGGCAGAAACAATATGGGGATGG | No data | ||||
924630581_924630588 | 5 | Left | 924630581 | 1:245736442-245736464 | CCAGTTAATTCCACGAACTTGGT | No data | ||
Right | 924630588 | 1:245736470-245736492 | TGGCAGAAACAATATGGGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
924630588 | Original CRISPR | TGGCAGAAACAATATGGGGA TGG | Intergenic | ||
No off target data available for this crispr |