ID: 924633439

View in Genome Browser
Species Human (GRCh38)
Location 1:245763373-245763395
Sequence CAGGGTGGGCAGAGAGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 600
Summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 536}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924633432_924633439 7 Left 924633432 1:245763343-245763365 CCTACTGCAATGTGAAAAGGGCT 0: 1
1: 1
2: 1
3: 18
4: 149
Right 924633439 1:245763373-245763395 CAGGGTGGGCAGAGAGCTGTAGG 0: 1
1: 0
2: 4
3: 59
4: 536

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924633439 Original CRISPR CAGGGTGGGCAGAGAGCTGT AGG Intronic
900081992 1:865364-865386 CAGGGTGGGCAGAGAGGAGAGGG - Intergenic
900291142 1:1924127-1924149 GGGGGTGGGCAGTGAGCTGGAGG - Intronic
900330722 1:2133272-2133294 CAGGGCGGTCACACAGCTGTGGG - Intronic
900482939 1:2908145-2908167 CAGGGCGGGGAGGGAGCTGGGGG - Intergenic
900694137 1:3999752-3999774 CAGGGTGGGCATGGAGTTGCAGG + Intergenic
900703766 1:4063356-4063378 CAGGGTGGGCCGAGCCCTCTGGG - Intergenic
900763081 1:4486091-4486113 CAGAGTGGGCATACAGCTGCAGG - Intergenic
900915589 1:5635883-5635905 GGGGCTGGGCAGAGAGCTGTGGG - Intergenic
901425010 1:9176966-9176988 CAGTGTAGGCTCAGAGCTGTGGG + Intergenic
901529108 1:9842661-9842683 CAGGGTGGCCAGAGGCCTCTGGG - Intergenic
901592787 1:10359799-10359821 CAAGGTGGGCAGAGCGCTTGAGG + Intronic
902515974 1:16989855-16989877 CAGGGCGGCCAGGGAGCTGGGGG + Intronic
903140949 1:21338928-21338950 CAAGGAGGGAAGGGAGCTGTGGG + Intronic
903153008 1:21426387-21426409 CAGGCTCAGCAGAGAGCTGCTGG - Intergenic
903160122 1:21481594-21481616 CAGGCTCAGCAGAGAGCTGCCGG + Exonic
903246372 1:22018782-22018804 AAGGATGGGAAGAGAGTTGTAGG - Intergenic
903445809 1:23422612-23422634 CTGGGTGGGCATGGAGCTCTGGG - Intronic
903535848 1:24065819-24065841 CAGGGAGGGCCAAGAGCTCTGGG - Intronic
903568578 1:24287037-24287059 GAGGGTGGGCGGAGGGCGGTGGG - Intergenic
904263669 1:29305489-29305511 CAGGCAGGGCAGAAACCTGTCGG + Intronic
904612631 1:31733795-31733817 CAGGGAGGCCAGGGAGGTGTAGG - Intronic
905282677 1:36859290-36859312 CAGGGTGGGCTGAGGACTGGAGG - Intronic
906999062 1:50831403-50831425 CAGGCTGGGCATGGTGCTGTAGG - Intronic
907304387 1:53505684-53505706 CAGGGTGGGCACAGGGCTTCTGG + Intergenic
907919049 1:58895994-58896016 CAGGATGGGCACAGGGCTGGGGG + Intergenic
908208092 1:61871794-61871816 CAGGGTGGGCAGATAGCCTGAGG - Intronic
908474580 1:64474892-64474914 CAGGTTGGTCAGACAGCTGCTGG + Intronic
908478873 1:64517447-64517469 GAGAGTTGGCAGGGAGCTGTGGG + Intronic
910938359 1:92505665-92505687 CAGGTTGAGCAGAGACCTGGTGG + Intergenic
911969481 1:104413048-104413070 AATGGTGGGCAAAGAGCTGTTGG - Intergenic
912511932 1:110195525-110195547 CAGGGTGGGCAGGGCCCTGGGGG - Intronic
912602793 1:110955112-110955134 TAGGATGGGCAGAGATCTGCTGG - Intronic
912936167 1:114005315-114005337 CAGGCTGGGCAGACACCTGAGGG + Intergenic
912948596 1:114105295-114105317 CAGGGGGGGAACAGGGCTGTAGG - Intronic
913642273 1:120823971-120823993 CAGGCTCAGCAGAGAGCTGCTGG + Exonic
914249151 1:145907450-145907472 AAGGGGGAGCAGAGACCTGTGGG + Exonic
915014252 1:152718689-152718711 TGGGGTGGGATGAGAGCTGTGGG + Intergenic
915323722 1:155070052-155070074 CAGTGTGGGCTGAGAGCAGAGGG - Intergenic
915444431 1:155966788-155966810 CAGGGAGGGCAGAGGGCTGGGGG - Intronic
917514512 1:175696380-175696402 CAGGGTGGGCAGAGAGAAAATGG + Intronic
917853607 1:179084783-179084805 CAGGGTGTGCGGCCAGCTGTGGG - Intronic
918314786 1:183314219-183314241 CAGGTTCAGGAGAGAGCTGTAGG - Intronic
919060559 1:192626951-192626973 GAGGGTTGGCAAAGAGCTGCAGG + Intergenic
919306028 1:195838824-195838846 CAAGGTGGACAGATAGCTTTAGG + Intergenic
920049075 1:203152438-203152460 CATGGTGGGAAGGGAGCTGATGG - Intronic
920099885 1:203510423-203510445 CGGGGTGGGCAGAGAGGAGCAGG + Intergenic
920496872 1:206461179-206461201 CTGGGTGTGCAGAGGGCTGGAGG - Exonic
920507843 1:206529254-206529276 CAGGCTGAGAAGAGAGCTGCCGG + Intronic
920854717 1:209653106-209653128 CAGGGTTGGCAGGGAGCCCTGGG + Intergenic
921066145 1:211623258-211623280 CAGGATGGGCAGTGAGCTTGGGG + Intergenic
922404483 1:225298235-225298257 GACTGTGGGCACAGAGCTGTTGG + Intronic
922891052 1:229062242-229062264 CAGGATGGGCAGTGAGAGGTGGG + Intergenic
922937522 1:229433405-229433427 CAGGGAGGGCAGACAGGTCTTGG - Intronic
922997497 1:229976203-229976225 GGGGGTGGGCAGAGTCCTGTTGG - Intergenic
923023638 1:230187380-230187402 CATGAGGGGCTGAGAGCTGTGGG - Intronic
923434482 1:233955403-233955425 CAAGATGAGCAGAGAGCTGGTGG - Intronic
923838140 1:237637839-237637861 CTGGGTGGGCCAAGAGCTGCAGG - Intronic
924633439 1:245763373-245763395 CAGGGTGGGCAGAGAGCTGTAGG + Intronic
924740176 1:246790248-246790270 CAGGGAGGGGAGAGGGCTGCTGG + Intergenic
1063078995 10:2747063-2747085 TAGGATGGGCTGAGAGGTGTAGG - Intergenic
1063088409 10:2839930-2839952 CAGGCTGGGCAGGAAGCTGGGGG - Intergenic
1063603224 10:7500613-7500635 CCGGGTGGGCAATGGGCTGTGGG + Intergenic
1063972740 10:11392892-11392914 CATGGTGGGTAAAGAGCTGGAGG + Intergenic
1064265405 10:13821432-13821454 CAGGCTGGGCAGGGACCTCTGGG - Intronic
1064306771 10:14174331-14174353 CAGGGTACACAGAGAGCTGTAGG - Intronic
1064346873 10:14540556-14540578 AAGTGTGGGCAGAAAGCTGGGGG - Intronic
1064347280 10:14543890-14543912 CAGGGTGGGACAAGAGCTGTAGG - Intronic
1065681518 10:28238630-28238652 CAGGGTGTCCGGAGAGCGGTGGG - Exonic
1065804734 10:29384073-29384095 CAGGGTGATCAGAGAGCAGGAGG + Intergenic
1065895374 10:30158669-30158691 CAAGGTGGCCAGAGAGATGAAGG - Intergenic
1065916364 10:30357510-30357532 CAGAGAGGGCAGAGAGCTCGTGG + Intronic
1066559031 10:36648005-36648027 CAGGGTGGCCACACAGCAGTAGG + Intergenic
1067077288 10:43195343-43195365 CCAGGTGGGAAGAGGGCTGTTGG + Exonic
1067251829 10:44593168-44593190 AAGGGAGAGCAGAGAGCTATGGG + Intergenic
1067782845 10:49221521-49221543 CAGGAGGGGCACAGAGTTGTGGG - Intergenic
1070643221 10:78183827-78183849 CAGGGGTGTCAGAGAGATGTTGG + Intergenic
1070780625 10:79135642-79135664 CTGGGTGGCCAGAGAGCTAAGGG + Intronic
1070787197 10:79168810-79168832 CAGGGTGGACGGACACCTGTGGG - Intronic
1070917693 10:80165354-80165376 CAGGGTGCACACAGAGCTGTGGG + Intronic
1070931602 10:80264876-80264898 CAGGATGGGGAGAGTGCTCTGGG - Intergenic
1071299500 10:84245603-84245625 CATTGAGGGCAGAGAGCTGAAGG - Intronic
1071345474 10:84687947-84687969 CAGGGTAGGCAGCGGTCTGTGGG + Intergenic
1071772533 10:88745145-88745167 CAGGAATGCCAGAGAGCTGTAGG - Intronic
1071933143 10:90496472-90496494 CAGGGGAAACAGAGAGCTGTGGG + Intergenic
1072232627 10:93425952-93425974 CTGGGTGGGCAGGGAGCTACAGG + Intronic
1072418937 10:95273222-95273244 AAGGGTGGCCAGAGCCCTGTGGG - Intronic
1072662080 10:97369372-97369394 CAGGGTGGCCTCTGAGCTGTTGG - Intronic
1073284530 10:102379758-102379780 CTGGATGGGCATAGAGCTGAAGG - Intronic
1074057300 10:109934047-109934069 CAGGGTGAGCAGGAAGCTGTGGG + Intergenic
1075471587 10:122694653-122694675 CTGGTTGGGAACAGAGCTGTAGG + Intergenic
1075552257 10:123401112-123401134 CAGGGTGGAGAGAGCACTGTGGG + Intergenic
1075928602 10:126273890-126273912 CAAGGTGGGCAGATCGCTGGAGG + Intronic
1075991624 10:126843220-126843242 CAGGGAGGGCTGGGAGCTGAGGG + Intergenic
1076110316 10:127855089-127855111 CAGGGTGGGCAGACACAGGTTGG - Intergenic
1076474784 10:130744309-130744331 CAGGGAGGGCAGAGGGCAGGAGG - Intergenic
1076897846 10:133322756-133322778 CAAGGTGGGCAGATCACTGTAGG - Intronic
1077030370 11:462789-462811 CAGGGTGTCCAGAAGGCTGTGGG + Intronic
1077227005 11:1442895-1442917 CCGAGTGGGCAGACAGCTTTGGG + Intronic
1077453357 11:2663974-2663996 CAAAGTGGGCAGAGAGCTTGGGG - Intronic
1077496800 11:2890574-2890596 CAGTGGGGGCAGGGAGCTCTGGG - Intronic
1077520229 11:3028831-3028853 CTGGGTGGGCCCAGAGTTGTAGG + Intronic
1078055194 11:8003557-8003579 TAGGGTGGGCAGGCAGCTGGGGG - Intergenic
1078591171 11:12641427-12641449 GAATGTGGGCAGAGAGCTATTGG - Intergenic
1078602574 11:12746842-12746864 CAGGCTGGGCTGAGGGCTGTGGG + Intronic
1078604306 11:12761638-12761660 GAGGGTGGGCAGAGGGATGATGG + Intronic
1078628126 11:12977017-12977039 CAGAGTAGGCAGAGATTTGTGGG - Intergenic
1079096237 11:17512165-17512187 CAGAGTGGTGAGAGAGCTGGGGG - Intronic
1079321276 11:19453706-19453728 CAGGAGGAGGAGAGAGCTGTGGG - Intronic
1079459968 11:20670258-20670280 CGGCGAGGGCAGAGAGCTGCGGG + Intronic
1080003994 11:27385333-27385355 TAGGGTGGGCAGATTGCTGAGGG + Exonic
1081647844 11:44802319-44802341 GTGGGTGGGGGGAGAGCTGTGGG + Intronic
1082182132 11:49132956-49132978 GAGTGTGGGCAGAGTGATGTAGG - Intergenic
1082848592 11:57745527-57745549 CTGGGTGGGGAGAGCACTGTAGG + Exonic
1083981841 11:66177747-66177769 CATGGTGGTGTGAGAGCTGTGGG - Intronic
1084045094 11:66563792-66563814 CAGGGTGAGCAGAGGGCACTGGG - Exonic
1085460898 11:76692656-76692678 TGGGGAGGGCAGAGAGGTGTGGG - Intergenic
1085460936 11:76692808-76692830 TGGGGAGGGCAGAGAGGTGTGGG - Intergenic
1085790424 11:79492951-79492973 CAGGGCAGGCAGAGATCTGAGGG + Intergenic
1088187811 11:107193140-107193162 CAGGGTGGGCAGACTGGTGAAGG - Intergenic
1088649687 11:111946454-111946476 CAAGGTGGGCAGATAGCTTGAGG - Intronic
1088771302 11:113038267-113038289 CAAGGAGGCCAGAGAGCAGTGGG - Intronic
1088840366 11:113622532-113622554 CAGGGAGGACAGAGGCCTGTTGG + Intergenic
1088887526 11:114019574-114019596 CAGTGAGGACAGAGAGCTCTTGG - Intergenic
1088977679 11:114830313-114830335 CAGGGTGTCAAGAGAGCTGTGGG + Intergenic
1089201329 11:116726279-116726301 GAGGGTGGGCAGCGGGCTCTAGG - Intergenic
1089270814 11:117300238-117300260 GAGGGGAGGCAGAGAGCAGTGGG - Intronic
1089334340 11:117712847-117712869 CAGGGTGGGGAGAGAGGCGGGGG - Intronic
1089460652 11:118651255-118651277 CAAGGTGGGCAGATAGCTTGAGG + Intronic
1089624906 11:119745202-119745224 GAGGTGGGGCAGAGAGCAGTGGG + Intergenic
1089651962 11:119920407-119920429 CAGGCTGGGCTGAGGGCTGCTGG - Intergenic
1090246794 11:125221879-125221901 CCGGGCGGGCAGTGGGCTGTAGG - Intronic
1090436798 11:126693921-126693943 CAAGGTGGGCAGACAGGGGTGGG - Intronic
1090748133 11:129723496-129723518 CTGGGTGGGGAGGGAGGTGTTGG - Intergenic
1091260639 11:134231462-134231484 CAGGGTTGGCAGACAGGAGTAGG + Intronic
1091306006 11:134536430-134536452 CAGCGTGGGCAGGGTGCTGTGGG + Intergenic
1091358634 11:134957417-134957439 CTAGGTGGGCAGAGAGCGGGAGG + Intergenic
1091963603 12:4719991-4720013 CTGGGTGGAGAGAAAGCTGTTGG + Intronic
1093485526 12:19647948-19647970 CAGGGGGGCTAGACAGCTGTTGG + Intronic
1094249047 12:28338708-28338730 TAGGGTGGGGAGAGACCAGTAGG + Intronic
1094352898 12:29546292-29546314 GAGGGTGGCCAGAAAGCTGAGGG + Intronic
1094719229 12:33045966-33045988 AAGGGTGGGAAAGGAGCTGTGGG - Intergenic
1094808030 12:34109512-34109534 CAGGGTGGGCATTGTGCTGTGGG - Intergenic
1095129180 12:38518546-38518568 CAGGGAGGGGAGAGAGCATTAGG - Intergenic
1096580463 12:52581497-52581519 CAGGTTGGACACACAGCTGTGGG + Intergenic
1096872493 12:54602215-54602237 CAGAGAGGTCAGAGTGCTGTGGG + Intergenic
1098169107 12:67728302-67728324 CAGGGTGGGCTGACAGCTCTGGG + Intergenic
1098482940 12:70986832-70986854 CAGGGCAGGCAGAGATCTTTTGG + Intergenic
1099966507 12:89452126-89452148 ATGTGTGGGCTGAGAGCTGTCGG + Intronic
1102026324 12:109715843-109715865 CAGGGTCCCCAGAGAGATGTGGG + Intronic
1102162706 12:110782431-110782453 CAGGGAGTGCAGAGAGGTGCAGG + Intergenic
1102513242 12:113429480-113429502 CAGGGTGGGCAGAGGAAAGTTGG - Intronic
1102594389 12:113981397-113981419 CAAGGTGGGCAGATAGCTTGAGG + Intergenic
1103737758 12:123071158-123071180 TAGGGTGGGCAGAGGGCTGCAGG + Intronic
1103749958 12:123151488-123151510 CAGGGAGGGCAGAGCGCAGCGGG + Intergenic
1104605512 12:130184778-130184800 CAGGGTGGGGAGGGAGCGGAAGG - Intergenic
1104672119 12:130688147-130688169 CAGGCTGGGCCGGGAGCTGTGGG - Intronic
1104965290 12:132506196-132506218 CGGGGTGGGGAGGGAGCTGGAGG + Intronic
1105736752 13:23279661-23279683 AAGGGTGGGCCAAGATCTGTGGG - Intronic
1106015312 13:25863505-25863527 CAGGGTGGGATGGGAACTGTGGG + Intronic
1106140169 13:27005406-27005428 GAGGGTGGGCAGAGGCCAGTGGG - Intergenic
1107196797 13:37661929-37661951 CAGGGTCAGAAGAGAGCAGTGGG + Intronic
1108581405 13:51831501-51831523 CATGCTGAGCAGACAGCTGTAGG - Intergenic
1110148338 13:72221232-72221254 CAGAGTAGGCAGATAGCTATGGG + Intergenic
1110744173 13:79033231-79033253 CTCTGTGGGCAGAGAGCTGAGGG - Intergenic
1111600518 13:90468341-90468363 CAGGGTGGGCAGATCACTGTAGG - Intergenic
1112030787 13:95454527-95454549 CAGGGTGGGGAGAGAGGGGAGGG - Intronic
1112378537 13:98866099-98866121 CAGGGTGGCCAGATAACAGTTGG - Intronic
1113138147 13:107116839-107116861 CAGGGTGGGCAGAAGGCAGAGGG + Intergenic
1114033292 14:18595485-18595507 GAGGGAATGCAGAGAGCTGTGGG + Intergenic
1114125408 14:19719868-19719890 GAGGGAATGCAGAGAGCTGTGGG - Intronic
1117703735 14:58441431-58441453 CAAGGTGGGCAGACAGCTTAAGG - Intronic
1117904382 14:60569102-60569124 CAGGGATGGCAGAGAGCAGAAGG + Intergenic
1118620848 14:67612702-67612724 CAAGGTGGGCAGATAACTGGAGG + Intergenic
1118743846 14:68760118-68760140 CAGGGTGGGCTGGCAACTGTTGG - Intergenic
1119517363 14:75258835-75258857 CAGGCAGCGCAGAGAGATGTTGG + Intronic
1119907150 14:78316287-78316309 CGGGGGTGGCAGACAGCTGTGGG + Intronic
1120158905 14:81124943-81124965 TAGGGTTGGCAGAGAGCTGGTGG - Intronic
1120939715 14:89935640-89935662 CAAGGTGGGCAGAGAGGTTGAGG + Intronic
1120954674 14:90071495-90071517 CAGGGAGCACAGAGAGATGTGGG - Intronic
1121218639 14:92267893-92267915 CAAGGTGGGCAGATCGCTGGAGG - Intergenic
1121521723 14:94590522-94590544 CAGAGTGGGCAGAGACCTCTGGG + Intronic
1121610311 14:95274207-95274229 CTGGGTGCGCAGAGAGCTCACGG - Intronic
1121998957 14:98630237-98630259 CAGGGTGGGGAGAGGGCTCTTGG + Intergenic
1122301848 14:100735865-100735887 CTGGGTGGGCAAAGAGGGGTGGG - Exonic
1122548679 14:102538728-102538750 CATGGTGGGAAGGGAGCTGGGGG - Intergenic
1122858711 14:104572489-104572511 CAGGGTGGGCACACAGCTTGTGG - Intronic
1122886919 14:104714323-104714345 CAGGGTGGGCTGAGGGCCGGGGG - Exonic
1122943337 14:104993328-104993350 CAGGGAGAGAAGAGAGCTGCAGG + Intronic
1122998698 14:105280225-105280247 CAGGCTGTGCAGAGACCTGGAGG + Intronic
1123035226 14:105469255-105469277 CTTGCTGGCCAGAGAGCTGTGGG + Intronic
1123566505 15:21553660-21553682 GAGGGAGTGCAGAGACCTGTGGG - Intergenic
1123568834 15:21580774-21580796 GAGGGAGTGCAGAGAACTGTGGG - Intergenic
1123604943 15:22016095-22016117 GAGGGAGTGCAGAGAACTGTGGG - Intergenic
1124061054 15:26294003-26294025 AAGGGTAAGCAGACAGCTGTGGG + Intergenic
1124197841 15:27648426-27648448 TAGGGAGGGCAGAGAGCTACAGG - Intergenic
1125516154 15:40322583-40322605 CAGGGAGAGCAGAGAGCGGAAGG + Intergenic
1125932181 15:43608188-43608210 CAGGGTGCCCAGAGCCCTGTGGG + Exonic
1125945279 15:43707662-43707684 CAGGGTGCCCAGAGCCCTGTGGG + Intergenic
1126492168 15:49249474-49249496 CAGGAAGGTCAGAGAACTGTAGG - Intronic
1127846767 15:62877279-62877301 CGGGCTGGACAGAGAGCTGGTGG + Intergenic
1127962971 15:63903603-63903625 CAAGGTGGGCACTGGGCTGTTGG - Intergenic
1128566850 15:68706359-68706381 CTGTGGGGGCACAGAGCTGTTGG - Intronic
1128673307 15:69590755-69590777 CAAGGGTGGCAGAGCGCTGTGGG + Intergenic
1129069616 15:72939748-72939770 CAGGGTGGGGAGAGGGCTTGGGG + Intergenic
1129476824 15:75791380-75791402 CAGAGAGGGCAGAGAGCTCGTGG - Intergenic
1129867687 15:78921988-78922010 CAGGCTGGGCACAGAGGTGAGGG + Exonic
1130282888 15:82532908-82532930 CAGAGAGGGCAGAGAGCTTGTGG - Intergenic
1132029917 15:98430925-98430947 CAGGGTGGGCCAAGAGCAGATGG + Intergenic
1132396573 15:101479369-101479391 CTGGGTGAGCACAGAGCAGTGGG + Intronic
1202974869 15_KI270727v1_random:280748-280770 GAGGGAGTGCAGAGACCTGTGGG - Intergenic
1202977188 15_KI270727v1_random:307864-307886 GAGGGAGTGCAGAGAACTGTGGG - Intergenic
1132465271 16:74580-74602 CAGGGTGGGCTGAGAGCCTGGGG - Intronic
1132880045 16:2158148-2158170 TGGGGAGGGCCGAGAGCTGTTGG + Intronic
1133206862 16:4239248-4239270 CATGGCGGGCACTGAGCTGTGGG + Intronic
1133312801 16:4861139-4861161 CAGTTTGGGCAGATTGCTGTTGG + Intronic
1133452924 16:5918625-5918647 CAGGGTAGACAGTGAGCTGTAGG + Intergenic
1133749378 16:8712928-8712950 TTGGGGGGGCAGAGAGCTTTCGG - Intronic
1133771114 16:8867726-8867748 CAGGGAGTGCAGAGGGCGGTGGG + Intronic
1134456224 16:14397542-14397564 CAGGGTGGCCAGAAACCTGCTGG - Intergenic
1135044046 16:19140183-19140205 CAGGATGATCAGAGAGCTGGGGG - Intronic
1136071857 16:27792118-27792140 CAAGGTGGGGAGACAGCTGCAGG - Intronic
1137316874 16:47334687-47334709 CAGGGTGGGGAAGGAGCTGCAGG - Intronic
1137430202 16:48412401-48412423 CAAGGTGGGAAGAGGGCTGAAGG - Intronic
1137615090 16:49841655-49841677 AAGTGTGGGCTGAGGGCTGTGGG - Intronic
1138832754 16:60395031-60395053 CAGGGTGGGCAGAGAGATGGTGG - Intergenic
1139489334 16:67278317-67278339 CTGGGTGGGGAGATTGCTGTTGG + Exonic
1139548872 16:67662553-67662575 CAGGGAGGGCAGAGAGCTGCGGG - Exonic
1139696466 16:68678755-68678777 CAGCGTGGCCAAAGAGCTGTGGG - Exonic
1141162437 16:81638418-81638440 GGGGGTGGGCCAAGAGCTGTGGG - Intronic
1141288490 16:82695056-82695078 CAGCGTGGGCAAAGTCCTGTCGG + Intronic
1141466029 16:84206368-84206390 GAGGGAGGGCAGTGAGGTGTGGG - Intergenic
1142178867 16:88657615-88657637 CAGGGCGGGCAGGGTGCTGACGG - Intronic
1142192838 16:88725778-88725800 CAGCGTGGGCAGAGAGGAGCAGG - Intronic
1142359259 16:89619049-89619071 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359286 16:89619110-89619132 CAGGGGGGGCAGGGAGCTGCAGG - Intronic
1142359396 16:89619352-89619374 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359411 16:89619383-89619405 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142425344 16:89999594-89999616 CAGGGTGGGCAGAGCGTAGGTGG + Intergenic
1142817125 17:2435431-2435453 GAGGGTGGGGAGAGAGGTCTAGG + Intronic
1143166518 17:4899773-4899795 CAGGGTGTCCAGGGAGCTGGGGG - Exonic
1143283816 17:5774515-5774537 CAGGGTGGGAAGATTGCTCTTGG + Intronic
1143530205 17:7498348-7498370 CCAGGTGTGCAGGGAGCTGTTGG + Intronic
1143877145 17:10000512-10000534 CAGGTTGGTCAGAGAGATCTAGG + Intronic
1144404933 17:14942963-14942985 CCTGGTGGGCAGGGAGTTGTAGG + Intergenic
1144431544 17:15196774-15196796 GAGGTTGGACAGAGAGCTGCTGG - Intergenic
1145877110 17:28327319-28327341 GAGGGTGGGCAAAGGGGTGTGGG + Exonic
1145944340 17:28761675-28761697 CAGGAGGGGCAGAGAGATTTGGG + Intronic
1146054298 17:29573572-29573594 CGGGATGGGGAGAGAGCTGGTGG + Exonic
1146055356 17:29578117-29578139 CAGGCTGGGTAGAGTGCTGAGGG - Intronic
1146725080 17:35149838-35149860 CAAGGTGGGAAGAGAGCTTGGGG - Intronic
1147122455 17:38343676-38343698 CAGAGGGGGCAGAGAGCGGATGG + Exonic
1147159582 17:38562430-38562452 GAGGGAGGGCAGAGAGCAGAAGG - Intronic
1147946377 17:44082566-44082588 CTGGGTAGGCAGTGAGCTGGTGG - Exonic
1147988961 17:44321870-44321892 CAGGGAGGCCTGAGGGCTGTGGG - Intronic
1148581212 17:48745249-48745271 CAGGGTCTGCAGGGAGCTGAGGG - Intergenic
1148675815 17:49444270-49444292 GCGGGTGGGCAGAGAGGGGTGGG + Intronic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1149479988 17:56995587-56995609 CAGAGAGGCCACAGAGCTGTGGG + Exonic
1151073170 17:71240684-71240706 CAGGGTGGGCAGAGAGGATGGGG + Intergenic
1151370911 17:73645489-73645511 AAGGCTGGGCAGAGAGCGGAGGG - Intergenic
1151499086 17:74477543-74477565 CAGGTGGGGCAGAGGGGTGTGGG - Intronic
1151733403 17:75923978-75924000 CAGGGTGGGCAGATCGCTTAAGG + Intronic
1151909288 17:77071197-77071219 AGGGCTGGGCAGATAGCTGTGGG + Intergenic
1152045283 17:77930966-77930988 CGGGGTGGGCTGAGAACTGGGGG + Intergenic
1152253043 17:79221658-79221680 CAGGGTGGGAAGACCTCTGTGGG - Intronic
1152369710 17:79878693-79878715 GAGGGCAGGCAGAGGGCTGTGGG - Intergenic
1152423649 17:80207316-80207338 CAGGGTGGGCAGATTGCTTGAGG + Intronic
1152455457 17:80413548-80413570 CAGGGTGCGCAGGGTGCAGTGGG + Intergenic
1152564952 17:81096249-81096271 CATGGTGGGCAGAGAGCTCAGGG - Intronic
1152701926 17:81823644-81823666 TGGGGTGGGCAGAGGGCTGTGGG - Intronic
1154387959 18:13912480-13912502 CAGGTTGGGCCAAGAGCTGTGGG + Intronic
1154480931 18:14823739-14823761 CAAGGTGGGCAGATAACTGAAGG + Intronic
1155003098 18:21705001-21705023 AAGGGTGGGCCGAGAGCTGACGG + Intronic
1156411243 18:36829497-36829519 CAGGGTGGGCAGAGGGACCTCGG - Intronic
1156510593 18:37633377-37633399 TTGGGTTGGCAGAGAGCTGTGGG + Intergenic
1157221349 18:45830292-45830314 CAGGGTAGGCAGAGAGCTCCAGG - Intronic
1157300291 18:46474292-46474314 CCTGCTGGGCACAGAGCTGTGGG + Intergenic
1157490770 18:48122183-48122205 CAGTGTAGGCACAGAGGTGTGGG + Intronic
1157622287 18:49023608-49023630 CAGGGTGGGCAGGAAGCAGGTGG - Intergenic
1158941264 18:62407364-62407386 AAGGATGGGGAGAGAGCTGGAGG - Intergenic
1159002952 18:62989287-62989309 CTGGGTGGGGAGAGTGCTGATGG - Intergenic
1159148939 18:64494993-64495015 CCAGGTGGACAGAGAGCTGAGGG + Intergenic
1160078830 18:75703886-75703908 CTGGGGGTGCAGAGAGCTGTGGG + Intergenic
1160078917 18:75704238-75704260 CTGGGGGGGCAGAGACCTGGGGG + Intergenic
1160144449 18:76352151-76352173 CAGGATGTCCAGAGAGCTGGGGG + Intergenic
1160155689 18:76432338-76432360 CACGGAAGGCAGAGACCTGTGGG - Intronic
1160314423 18:77827921-77827943 CAGAGTGGACAGAGCTCTGTAGG - Intergenic
1160820889 19:1057238-1057260 CAGGGTGGGAACAGGGCTGAGGG + Intronic
1160853343 19:1205403-1205425 CAGGGTGGGCTGAGCCCGGTGGG - Intronic
1160917936 19:1506646-1506668 CAGGGTGGGCAGGGGTCTGTGGG + Exonic
1161285974 19:3468479-3468501 CTGGGTGGGCAGGAAGCTGGGGG - Intronic
1161332885 19:3696715-3696737 CAGGGAGGGCAGAGTGCGGAGGG + Intronic
1161666166 19:5578317-5578339 CTGGGCGGGCAGAGAGATGGGGG + Intergenic
1161770848 19:6230027-6230049 CAGGGTGGGCGCAGGGCTGGTGG - Intronic
1161916381 19:7231531-7231553 CAAGGTGGGCAGATAACTGGTGG - Intronic
1161933608 19:7357403-7357425 CAGGTGGGGGAGTGAGCTGTGGG + Intronic
1162013414 19:7830984-7831006 CAGGCTGAGCTGAGGGCTGTGGG - Intronic
1163476078 19:17526937-17526959 CAGGGTAGGCACAGTGCTGGTGG + Intronic
1163594847 19:18215083-18215105 CAGGGTGGGGAGACAGCATTTGG - Intronic
1163633282 19:18427618-18427640 CAGGGTGGGCAGAGGGCCCCAGG - Intronic
1163685571 19:18710022-18710044 CAGGGTGGGCAAAGAAGTGTGGG - Intronic
1164158726 19:22612481-22612503 CAGGCTGGTCAGAGGGCTGCAGG - Intergenic
1164515358 19:28930716-28930738 GAGAGTGGGCAGAGAGCTTTGGG - Intergenic
1164635553 19:29788636-29788658 CAGGGGAGGCACAGACCTGTGGG + Intergenic
1164738303 19:30558641-30558663 CCTGGTGGGGAGAGAGGTGTGGG + Intronic
1165194371 19:34090152-34090174 CAGGGTGGGCAGAGCACTTGAGG + Intergenic
1165445530 19:35855166-35855188 CAGGGGGTGTAGAGAGCAGTTGG - Intronic
1165466659 19:35978797-35978819 TAGGGTGGGCAGGGCGGTGTGGG - Intergenic
1165495234 19:36148838-36148860 CAGGGTGTGCAGGACGCTGTGGG + Intronic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1166079440 19:40434373-40434395 CAGGGCAGGCAGAGAGCTGCAGG + Intergenic
1166685225 19:44792621-44792643 CAGAGAGGGCAAAGAGCTGATGG + Intronic
1166859246 19:45800346-45800368 CAGGGTGGGCAGAGATGGGGAGG - Intronic
1167104029 19:47419961-47419983 CAGGATGGGCAGTGCGCTGGGGG + Intergenic
1167235372 19:48311477-48311499 CAGGAAGGGCAAACAGCTGTGGG + Intronic
1167412963 19:49355878-49355900 GAGGAGGGGCAGAGGGCTGTGGG - Intronic
1167529172 19:50004281-50004303 CAGGGTGGGGAGAGGGCAGGAGG - Intronic
1168269029 19:55239728-55239750 CAGGGTGGGCAGGCAGCTATCGG + Intronic
1168287575 19:55342208-55342230 CAGGGGGGGCACAGGGCTGGGGG - Exonic
1202683413 1_KI270712v1_random:29783-29805 CGCGGTGGGCAGAAAGCCGTGGG - Intergenic
925290919 2:2748246-2748268 CAGGGTGGGCTGCAGGCTGTGGG - Intergenic
925742515 2:7018399-7018421 GAGGGCAGGCAGAGAGTTGTCGG + Intronic
927353961 2:22151998-22152020 CAGTGTGGGGAGAAAGCTGTGGG + Intergenic
927861186 2:26561283-26561305 CTGGTTGGAAAGAGAGCTGTAGG - Intergenic
928040821 2:27875313-27875335 CAAGGTGGGCAGATAGCTTTAGG + Intronic
928079916 2:28301707-28301729 CTGGGAGGGGAGAGAGCTGCTGG - Intronic
928168264 2:28986604-28986626 CAGGGTGAGCAGGAAGCAGTGGG - Intronic
929440681 2:41963959-41963981 CAGGATGTGCAGAGAGCAGTGGG + Intergenic
929858007 2:45651870-45651892 CAGGGAGGGGGGAGAGCTGGGGG - Exonic
930453896 2:51581202-51581224 GAGGGGGGGCAGAGAGGTGCTGG + Intergenic
931514832 2:63044110-63044132 CAGTCTGGCCAGAGAGCAGTTGG + Intronic
931615594 2:64153465-64153487 CAGGGTTGGGAGAGAGCTTAGGG + Intergenic
931882747 2:66583349-66583371 CAAGGTCGGAAGAGAGCTGGCGG + Intergenic
932102282 2:68912057-68912079 CAGGCTAGGCAGAGCCCTGTAGG - Intergenic
932471564 2:71962716-71962738 CTGGGGGGCCAGAGAACTGTGGG - Intergenic
932486180 2:72085685-72085707 CCAGGTTGGCAGGGAGCTGTGGG - Intergenic
933102480 2:78277617-78277639 CAAGGTGGGCAGATAGCTTGAGG + Intergenic
933283153 2:80354907-80354929 GAGGGTGGACAGAGAAGTGTGGG + Intronic
934261148 2:91477943-91477965 CGCGGTGGGCAGAAAGCCGTGGG - Intergenic
935426073 2:102919554-102919576 GTGGGTGGGCCGAGAGTTGTGGG + Intergenic
935736701 2:106112017-106112039 AAGGGAGGCCAGAGGGCTGTGGG + Intronic
937151076 2:119686072-119686094 CAGAGTGGGCAGCCAGCTGTGGG + Intronic
937229324 2:120388382-120388404 CAGCCTGGGCAGAGAGCACTGGG + Intergenic
937243625 2:120478153-120478175 CTGGGTGTGCAGAGAACTCTGGG - Intergenic
938026483 2:127953496-127953518 TGGGGTTGGCAGGGAGCTGTTGG - Intronic
938132436 2:128728316-128728338 CAGGATGTGCCGTGAGCTGTGGG - Intergenic
938330131 2:130443070-130443092 CAGGGTGGGCAGTGCGGTGCAGG - Intergenic
938359814 2:130678433-130678455 CAGGGTGGGCAGTGCGGTGCAGG + Intergenic
938436226 2:131285154-131285176 CAGGGTGGGCAGTGGGGTGCAGG + Intronic
939376582 2:141375965-141375987 CAGTGTGGGCAAGAAGCTGTCGG + Intronic
942882782 2:180883078-180883100 CAGTGTAGGCAGGTAGCTGTGGG - Intergenic
943049568 2:182898889-182898911 AGGGGTGGGCAGAGACCTGGAGG + Intergenic
943276554 2:185875735-185875757 CAGTGGAGGCAGACAGCTGTGGG - Intergenic
943692368 2:190881435-190881457 CAGCGAGGGCAAAGAGCTGGTGG + Exonic
946037348 2:216754707-216754729 GTGGGTGGGCAGAGGGATGTAGG + Intergenic
947527152 2:230885680-230885702 CAGGGATGGCAGGAAGCTGTAGG + Intergenic
947575362 2:231269609-231269631 CAAGGTGGGCAGAGAGGTCAGGG - Intronic
947659146 2:231853870-231853892 CAGGGAGGGGAGAGAGGAGTGGG - Intergenic
948116860 2:235499740-235499762 CACGGTGGGCAGAGACCAGGAGG - Intronic
948453457 2:238093013-238093035 CAGGGTGGGAAGAGGGTTGGAGG - Intronic
948514604 2:238496207-238496229 AAGGCTGGGCAGACAGTTGTAGG + Intergenic
948629685 2:239294105-239294127 CAGGTTGGGCAGAAAGCTCATGG + Intronic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
948901069 2:240957170-240957192 CAGGGAGGGCAGAGAGCTGGGGG - Intronic
1168958768 20:1853803-1853825 CAGGGCGGGGATAGAGATGTTGG - Intergenic
1168986771 20:2055930-2055952 CAGGGAGCCCAGGGAGCTGTGGG - Intergenic
1169249638 20:4050462-4050484 TAGAGTGGGCTGGGAGCTGTTGG - Intergenic
1169452597 20:5724886-5724908 AAGACTGGGCAGAGAGTTGTAGG + Intergenic
1170358334 20:15517287-15517309 CAGTGTGAGCAGAGAGCTTTAGG - Intronic
1170949016 20:20917953-20917975 CATGGAGGGCAGAAGGCTGTGGG + Intergenic
1171468848 20:25353768-25353790 CAAGGTGTGCAGACAGCCGTTGG - Intronic
1172487135 20:35305084-35305106 CAGGGAGGGCAGAGTGCTGAAGG - Intronic
1172805822 20:37610925-37610947 GAGGGTGGGCAGAGATGGGTGGG - Intergenic
1172834223 20:37862690-37862712 GAGGGTGGGCAGAAAGCAGTGGG - Intronic
1172979722 20:38931767-38931789 CTGTGTGGTCAGAGAGCTGCTGG - Intronic
1173528574 20:43751205-43751227 CAGCCTGGTTAGAGAGCTGTGGG + Intergenic
1173591593 20:44229069-44229091 CAGAGTGGGCAGACAGCTCCTGG + Intergenic
1173972439 20:47163261-47163283 CAAGGTGGGCAGATAGCTTGAGG - Intronic
1174332641 20:49832129-49832151 AAGGGAGGACAGAGAGCAGTGGG - Intronic
1174484534 20:50852874-50852896 CAGGCTGGGCAGGGAGAGGTGGG - Intronic
1174547081 20:51333751-51333773 CAAGGTGGGCAGGGACCTCTAGG - Intergenic
1174605607 20:51759198-51759220 CCAGGGGGGCAAAGAGCTGTTGG + Intronic
1175547180 20:59785925-59785947 CAGGGGAGGCAGAGGGCCGTTGG - Intronic
1175570242 20:60012615-60012637 CAAGCTGGCCAGAGAGCTGAGGG - Exonic
1175576419 20:60064000-60064022 CAGGGTGGGCTGGGTTCTGTGGG - Intronic
1175702394 20:61149332-61149354 CAGGATGGGCAGGCAGCTGCCGG + Intergenic
1175727940 20:61332241-61332263 CAGGGTGGGCGGAGCGGTGACGG + Intronic
1175794390 20:61762573-61762595 CAGGCTGGACAGAGTGCAGTGGG - Intronic
1176234283 20:64047116-64047138 CCGGGTGGGGGGAGCGCTGTGGG + Intronic
1176799672 21:13412875-13412897 CAAGGTGGGCAGATAACTGAAGG - Intergenic
1178007243 21:28235179-28235201 CAGGGTGGTCACAGGGGTGTAGG + Intergenic
1179133089 21:38656144-38656166 CAGGGAGGGCAGAGAGGTTCAGG + Intronic
1179629056 21:42665595-42665617 CAGGGAAGGCCGGGAGCTGTAGG - Intronic
1179654677 21:42837787-42837809 CAGGGTTGGCAGAGGGCGGAGGG - Intergenic
1179841084 21:44074317-44074339 CAGGTGGGACAGAGACCTGTGGG - Exonic
1179971916 21:44840853-44840875 AAGCGTGAGCACAGAGCTGTGGG + Intergenic
1180457406 22:15522540-15522562 GAGGGAATGCAGAGAGCTGTGGG + Intergenic
1180754028 22:18147897-18147919 CAGGGAGGGCAGGGTGCTGGTGG - Intergenic
1181627604 22:24132346-24132368 CAGGGTGGGGAGAAAGGGGTGGG - Intronic
1182094543 22:27617101-27617123 CAAGGTGGGAAGAGAGCTTAAGG - Intergenic
1183280517 22:36929658-36929680 CAGGGTGGCCTGGGAGGTGTTGG - Exonic
1183281351 22:36934296-36934318 CTGGGTGGGCACAGAGATGTGGG + Intronic
1183580055 22:38719237-38719259 CAAGGTGGGCAGATTGCTGGAGG - Intronic
1183700896 22:39450418-39450440 GAGGGAGGCCAGAGACCTGTCGG - Intergenic
1183910980 22:41079032-41079054 GAGGGTGGGCAGAAGGCTTTGGG - Intergenic
1184067608 22:42129362-42129384 CAGGGTGGGCAGAGACGAGGTGG - Intronic
1184070346 22:42143058-42143080 CAGGGTGGGCAGAGACGAGGTGG - Intergenic
1184095196 22:42312613-42312635 CAGGGTGTGGAGTGGGCTGTGGG + Intronic
1184279393 22:43428394-43428416 CAGGGTGGGCACAGGGATGAGGG + Intronic
1184289130 22:43489009-43489031 CAGTGTGGGCAGTGAGGGGTGGG + Intronic
1184486868 22:44785040-44785062 CTGAGTGGGCAGGGAGGTGTGGG + Intronic
1184669324 22:46004511-46004533 CAGGGTGGCCAGAGACCCTTTGG - Intergenic
1184689425 22:46110706-46110728 CAGGGTGGGGTGAGGGCTGAAGG - Intronic
1184762344 22:46551646-46551668 CCGTGTGGCCAGAGAGCTGGAGG - Intergenic
1184857419 22:47153980-47154002 GAGGGTGGGCAGAGAGTAGGAGG + Intronic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
1185099285 22:48828883-48828905 CCGGGTGGGGAGGCAGCTGTGGG + Intronic
1185127726 22:49021177-49021199 CAGAGGGGGCAGAGAGCAGCGGG - Intergenic
1185202209 22:49514469-49514491 CAGGGTGGGCAGGGAGCATGGGG - Intronic
1185328046 22:50237161-50237183 CAGGGAGGGCCGTGAGCAGTCGG + Intronic
950129746 3:10533982-10534004 CAGCCTGGGAAGAGAGCTGCTGG - Intronic
950514963 3:13459153-13459175 GAGGGAGGGATGAGAGCTGTTGG - Intergenic
950565329 3:13766597-13766619 CATGGTGTGCAGAGAGATGGTGG - Intergenic
951027053 3:17841396-17841418 CGGGGGCAGCAGAGAGCTGTTGG - Intronic
951264901 3:20553199-20553221 CAGGGAGGGCAGAGGGGCGTGGG + Intergenic
952404699 3:32994971-32994993 AAGGGGTGGCAGAGTGCTGTAGG + Intergenic
952822566 3:37498035-37498057 CTGGGTGGCCAGGGAGCTGTGGG + Intronic
953998266 3:47536882-47536904 CAGTCTCAGCAGAGAGCTGTGGG - Intergenic
954285667 3:49617381-49617403 CAGGAAGGGCAGAGAGATGAAGG - Intronic
954538772 3:51380307-51380329 CAGGCTGGGGAGAGAGGTGAAGG - Intronic
954747482 3:52795325-52795347 TAGGGTGTGAAGAGAGCTCTGGG + Intronic
955996611 3:64685960-64685982 AAGGGTGGGCCGAGGGCTCTGGG - Intronic
956170187 3:66427152-66427174 CATGATGGGCAGAGTGCTGCAGG - Intronic
956436465 3:69238862-69238884 CAGCCTGGGCAGAGAGTGGTAGG - Intronic
959606016 3:108242509-108242531 CAGAGTGGGCCAAGAGTTGTGGG + Intergenic
960658135 3:120028750-120028772 GAGGCTGGGCAGAGAGAGGTTGG + Intronic
961522081 3:127472761-127472783 CGGGGTGGGCAGAGACCTTCGGG - Intergenic
961637341 3:128341825-128341847 CAGCCTGGGCAGGAAGCTGTCGG - Exonic
961664255 3:128486392-128486414 CAGGGTGGGCAGAAAGATCAGGG + Intronic
962367328 3:134795211-134795233 AGGGGTGGGGAGAGAGCTGATGG + Intronic
963127186 3:141827151-141827173 CAGGGTGGGAAGAGAGCTGGTGG + Intergenic
964499019 3:157327628-157327650 GAGGATGGGGAGTGAGCTGTAGG + Intronic
965556718 3:170026078-170026100 CAAGGTGGGTAGAGAGCTTGAGG - Intergenic
965964702 3:174473200-174473222 CAGGGAGGGCAGGGAGGAGTTGG - Intronic
967811239 3:193762746-193762768 CAGTTTGGGCAGAGAGGTGGGGG - Intergenic
968423888 4:508250-508272 CAGGGTGAGCAGAGACTTGAAGG + Intronic
968600810 4:1508488-1508510 CAGGGTGGGGGAAGAGCTGTGGG + Intergenic
968600837 4:1508598-1508620 CAGGGTGGGCAGAGCCCGGCTGG - Intergenic
968621580 4:1605656-1605678 CAGGGTCGGCAGGGAGCCCTGGG - Intergenic
968867893 4:3225501-3225523 CAGGTTGTGCAGAGCCCTGTGGG - Intronic
969457532 4:7308648-7308670 TGGGGTGGGCAAGGAGCTGTGGG - Intronic
969533531 4:7742052-7742074 TAGGGTGGGGAGAGAGCTTTGGG - Exonic
969619537 4:8272148-8272170 CAGGGCTGGCAGGGAGCTGGAGG + Intronic
970546796 4:17137938-17137960 GAGGGTGGGCATAGAGCCCTGGG - Intergenic
970655517 4:18226104-18226126 CAGGGTGGGCAGATTGCTTGAGG - Intergenic
971331151 4:25682546-25682568 AGGGGTGGGCAGTGAGCTGCAGG - Intergenic
974894870 4:67926797-67926819 AGGGGTGGGCAGAGAGGTGCTGG + Intronic
974920819 4:68237092-68237114 CAGGGTTGGCAGGGAGGTGGAGG - Intronic
977588500 4:98801487-98801509 AAGGGTGGGAAGAGAGCTGAGGG - Intergenic
979876635 4:125899565-125899587 CAGGGTGGCCAGAGAGATAATGG - Intergenic
980088442 4:128416429-128416451 CAGCATGGGCAGGAAGCTGTGGG + Intergenic
980428560 4:132658856-132658878 CAGTGAAGGCAGACAGCTGTGGG + Intergenic
983617763 4:169726523-169726545 CAAGGTGGGCAGACAGCTTAAGG - Intergenic
984062932 4:175014396-175014418 AAGTGTTGGCAGTGAGCTGTAGG + Intergenic
984959094 4:185077327-185077349 CAGGGTGGAAAGAGAGAGGTCGG - Intergenic
985662670 5:1165103-1165125 CAGGGAGGGCACAGGGCTCTCGG + Intergenic
986748346 5:10762842-10762864 CAGGGTGGCCAGAGAACTGGAGG - Intergenic
989536736 5:42572854-42572876 CAGGATTGGCAGAGAGGTGGGGG + Intronic
990749598 5:59000126-59000148 CAGGGTGGCCTCAGAGCTGCAGG - Intronic
991404642 5:66289819-66289841 CAGGGCTGGCAGAGAGAGGTAGG - Intergenic
992118300 5:73564325-73564347 CAGGGTGCTCAGAGAGCTTAGGG - Intronic
993634946 5:90332029-90332051 CAGTGTGGGCAAGAAGCTGTGGG + Intergenic
994559267 5:101346774-101346796 CAGGGGAGGCTGACAGCTGTGGG - Intergenic
995485509 5:112636344-112636366 CATGGTGAGCTGAGACCTGTAGG - Intergenic
997209200 5:132067677-132067699 CAGGGAGGGAGGACAGCTGTGGG + Intergenic
997595294 5:135103260-135103282 ATGGGTGGGTGGAGAGCTGTGGG + Intronic
997630027 5:135360358-135360380 CAGAGTGGGCTGTGAGCTTTGGG - Intronic
997781784 5:136667053-136667075 CAGGATGGGCTGAGAGCCGAGGG + Intergenic
998214635 5:140227869-140227891 CAGGGTGTGGAGAGAGGTGGAGG - Intronic
998519534 5:142787126-142787148 CAGGGTGGGCACAGAACTTCTGG + Intronic
999242528 5:150136233-150136255 GGGAGGGGGCAGAGAGCTGTAGG - Intronic
999630630 5:153567383-153567405 CAGGGTGGGGAGGCAGCTTTAGG + Intronic
1000122673 5:158212196-158212218 CATGGTGGGCAGAGAGAGATGGG + Intergenic
1000816423 5:165928295-165928317 GAGGAAGGGCTGAGAGCTGTTGG + Intergenic
1001380667 5:171304488-171304510 GAGGATGGGCAGAGAGGTGAGGG + Intergenic
1001470028 5:172005908-172005930 CTGGGGGGGCAGGGAGCTTTCGG - Intronic
1001626754 5:173142720-173142742 GAGGGTGTGTAGAGGGCTGTAGG + Intergenic
1002021846 5:176368657-176368679 CAGGGTGGGGTGGGGGCTGTGGG + Intronic
1002261268 5:177995429-177995451 CATGGTGGACAGTGAGCTCTAGG - Intronic
1002635041 5:180603125-180603147 CAGGGCGGGCAGAGGGCTGGAGG - Exonic
1002662262 5:180799471-180799493 CAGCGTGGAGAGAGTGCTGTGGG - Intronic
1002931199 6:1636552-1636574 CAGGACGGCCAGAGAGGTGTTGG - Intronic
1003142662 6:3484593-3484615 CAGAGTGGAAAGAGAGCTGCTGG + Intergenic
1003578443 6:7318032-7318054 CAAGTAGGGCAGAGAGCTCTGGG - Intronic
1003896070 6:10608945-10608967 CAGGGTGGCCAGAGAGCTCCTGG + Intronic
1005816133 6:29554152-29554174 CAGGCTGGGCAGTGAGTAGTTGG + Intergenic
1005889418 6:30124545-30124567 CAGAGTGGGCACAGAACTGCTGG + Intergenic
1005941510 6:30563612-30563634 GAGGGAGGGGTGAGAGCTGTTGG + Exonic
1006155540 6:32011088-32011110 GAGGGTGGGCAGAGTGCAGGGGG + Intergenic
1006161872 6:32043942-32043964 GAGGGTGGGCAGAGTGCAGGGGG + Intronic
1006318631 6:33305590-33305612 GAGGGTGAGCAGAGAGGTCTAGG + Intronic
1006351444 6:33524196-33524218 CAGGGAGGGGAGAGGGCTGAAGG + Intergenic
1006448443 6:34092546-34092568 CTGAGCTGGCAGAGAGCTGTGGG - Intronic
1006679690 6:35788061-35788083 CAGGGTGAACACAGAGCTCTGGG - Exonic
1007397302 6:41585212-41585234 CAGGGAGGGTTCAGAGCTGTGGG + Intronic
1007780089 6:44247679-44247701 CGGTGTGGGAAGAGAGCTTTCGG + Intronic
1008572822 6:52831269-52831291 CAGGGTGGCCTGAGAGCAGAGGG + Intergenic
1008579769 6:52896235-52896257 CAGGGTGGCCTGAGAGCAGAGGG + Intronic
1011090747 6:83596199-83596221 CTGGCTGGGCATAGTGCTGTAGG - Intronic
1011277426 6:85643690-85643712 CTGGCGGGGCAGAGTGCTGTGGG + Intronic
1011509831 6:88088318-88088340 CAGGGTGGTGAGAGGGCTGTGGG - Intergenic
1012698213 6:102417346-102417368 CAGGGAGGGCAGGGAGCTTATGG - Intergenic
1013226215 6:108120912-108120934 CGGGGAGGGCAAAGAGCTGAAGG - Intronic
1015783889 6:136900799-136900821 CAGGCTGAGAAGAAAGCTGTTGG - Intronic
1017491645 6:154950691-154950713 CAGGGTGGGATGATAGCTGGAGG + Intronic
1018169676 6:161134807-161134829 CACCGTGTGCAGAGATCTGTGGG - Exonic
1018365552 6:163116525-163116547 CAGTGTGTGCAGAGCGCTCTTGG + Intronic
1019053166 6:169200235-169200257 GAGGGTGGGCAGAGGGGTTTGGG - Intergenic
1019437904 7:1031390-1031412 CCGGGGGGGCAGAGACCTGCAGG + Intronic
1019437917 7:1031427-1031449 CCGGGGGGGCAGAGACCTGCAGG + Intronic
1019437942 7:1031501-1031523 CCGGGGGGGCAGAGACCTGCAGG + Intronic
1019437999 7:1031686-1031708 CCGGGGGGGCAGAGACCTGCAGG + Intronic
1019603182 7:1895454-1895476 CAGGCGGGGCTGAGAGCTGCGGG - Intronic
1019789488 7:3001751-3001773 CAGGATTGCCAGAGAGCTCTTGG - Intronic
1019871575 7:3768684-3768706 AAGGTTTGGCACAGAGCTGTAGG + Intronic
1019925927 7:4191745-4191767 CAGGGTGGACAGGGGGCTGCAGG + Intronic
1021450656 7:20780703-20780725 CAGGGTGGGCAGGGTTCTTTTGG - Intergenic
1021745999 7:23741996-23742018 CAGCATGGGCAAAAAGCTGTGGG + Intronic
1022324886 7:29322222-29322244 CAGGGAAGGCAGAGACCTGCTGG - Intronic
1022582088 7:31565501-31565523 CACAGTGGGCAGAGAGCTTGAGG + Intronic
1023113499 7:36838013-36838035 CAGGGTGGGCAGAGATGGGGTGG - Intergenic
1023869211 7:44253945-44253967 CAGGGTGGGCAGAGCCCAGTGGG + Intronic
1024117577 7:46208454-46208476 CAGGGTGGTGAGAGACCAGTTGG + Intergenic
1024264239 7:47594641-47594663 CTGGGGAGGCAGAGAGCTGCAGG - Intergenic
1026274995 7:68868986-68869008 CATGTTAGGCAGAGAGCTTTTGG - Intergenic
1026636771 7:72090063-72090085 CAAGGTGGGCAGATCGCTGGAGG + Intronic
1027252632 7:76408666-76408688 CAGGCTTGGCAGAGGGCTCTGGG - Intronic
1027255227 7:76426548-76426570 GAGGGAGGCCAGAGAGCTGCAGG + Intronic
1027342442 7:77223486-77223508 CAGGATGAGCAGAGAACTCTGGG - Intronic
1028106246 7:86882399-86882421 GAGGGAAGGCAGAGACCTGTTGG + Intronic
1028406945 7:90485599-90485621 CTGGCTGGGCAGTGAGTTGTTGG + Intronic
1028503888 7:91550209-91550231 CAGGGTGGGCAGAGATCCCATGG - Intergenic
1029286643 7:99470382-99470404 CAGGGTGGGCAGGTAGTTTTTGG - Intergenic
1029535473 7:101154932-101154954 CCGGGTGGGGAGAGGGGTGTGGG + Intronic
1031998250 7:128246909-128246931 CAGGGAGTGCAGAGAGAAGTGGG + Intronic
1032015306 7:128376280-128376302 CTGTGTGGGCAGAGAGCTTATGG - Intergenic
1032166989 7:129553145-129553167 CAGGGTGTGCAGTGCACTGTCGG + Intergenic
1032781127 7:135166061-135166083 CAGACAGGGCAGAGAACTGTGGG + Exonic
1034413920 7:150955295-150955317 CAGGCTGGGGAGAGGGCTGCTGG - Intronic
1035235802 7:157497070-157497092 CAGGGTGGGCAGGGAGGGGCAGG - Intergenic
1035523276 8:292190-292212 CAGGGTGGGCAGAGAGGAGAGGG + Intergenic
1035667181 8:1387988-1388010 CACGGTGGGCGCAGAGCTGCTGG + Intergenic
1035700115 8:1631985-1632007 CAGGGGGTTCAGAAAGCTGTTGG + Intronic
1037359016 8:18053795-18053817 CAGGCTGGGAAGGGAGGTGTGGG - Intergenic
1037661737 8:20933764-20933786 CAGAGTGGGCAAAGAGGTGTGGG - Intergenic
1039474000 8:37829825-37829847 CAGGGTGGGCAGAGGGGTCACGG - Intronic
1039598092 8:38809068-38809090 CAGGCTGGGCAGAGGGCTGAAGG - Intronic
1041871821 8:62643516-62643538 CATGCTGGGAACAGAGCTGTTGG + Intronic
1041964251 8:63656712-63656734 TATGGTGGGTAGAGAGCTGCTGG - Intergenic
1043400481 8:79879583-79879605 CAGGGTGAGCATAGAGAGGTGGG + Intergenic
1044720405 8:95140064-95140086 CAGGATGGGCAGGGAGCTCCAGG - Intronic
1045364540 8:101463271-101463293 GATTGTGGGAAGAGAGCTGTTGG + Intergenic
1045493063 8:102685115-102685137 CAGGATAGGCAGAGTGCTCTGGG + Intergenic
1049609757 8:143549256-143549278 CATGTTGGGCAGATAACTGTTGG - Intergenic
1052100498 9:24440616-24440638 CAAAGTGGGCAGGGAGATGTGGG + Intergenic
1053179701 9:35958032-35958054 CTGGGTGGGCAGAGAGCCTCAGG + Exonic
1056844353 9:90024718-90024740 CTGGGAGGACAGAGAGCTCTGGG - Intergenic
1056931745 9:90883496-90883518 CAGAGTAGGCAGGTAGCTGTGGG - Intronic
1057138705 9:92713834-92713856 CGCGCAGGGCAGAGAGCTGTGGG + Exonic
1058051239 9:100409063-100409085 CAGGGAGGCCAGGGAGATGTTGG + Intergenic
1058645148 9:107124996-107125018 CAGGGTGAGGAGAGAGCCCTTGG + Intergenic
1058899857 9:109432591-109432613 CCTGGTGGGAAGAGACCTGTAGG - Intronic
1059639012 9:116198155-116198177 GGTGGTGGGAAGAGAGCTGTGGG + Intronic
1059727391 9:117022817-117022839 CAGAGTGGGCAGTGGGCAGTGGG + Intronic
1060335721 9:122719941-122719963 CTGGGTGGGCAGTGTGCTGGTGG - Intergenic
1060599691 9:124869563-124869585 CCGGGTCGGCAGGGAGCTGGAGG - Intronic
1060779423 9:126400612-126400634 CAGGGAGGGCACAGAGCAGTGGG + Intronic
1060977189 9:127771557-127771579 CAGGCTGCGCGGAGAGCTGCTGG - Intronic
1061061606 9:128253429-128253451 CAGAGAGGGCAGAGAGCTCGTGG + Intronic
1061168382 9:128937775-128937797 GAAGGTGAGCTGAGAGCTGTGGG + Intronic
1061201688 9:129141815-129141837 CATGGCAGGCAGAGGGCTGTCGG + Intronic
1062088218 9:134659627-134659649 CAGGGAGGACAGAGGGTTGTTGG - Intronic
1062253050 9:135607963-135607985 CAAGGTGGGGAGGGAGCTGGTGG + Intergenic
1187364044 X:18651973-18651995 CAGGGCGGGCAGAGATCTGAAGG - Intronic
1187821296 X:23290946-23290968 CAGGTTGAGCAGAGAGTTCTAGG - Intergenic
1189114467 X:38328513-38328535 CAGGAGGGGGAGAGAGCTCTTGG + Intronic
1189800823 X:44690421-44690443 CAGAGTGGGCATAGATCAGTGGG + Intergenic
1190246071 X:48691217-48691239 GAGGGTGGGCACAGAGCAGGTGG - Exonic
1190877917 X:54472650-54472672 CTGGCTGGGCAGGGGGCTGTGGG + Intronic
1192759888 X:74086065-74086087 CAGTGTAGGCAGGTAGCTGTGGG - Intergenic
1194836132 X:98685534-98685556 AAGGCTGGGGAGGGAGCTGTAGG + Intergenic
1196818602 X:119685343-119685365 CTGGGTGGGGAGAGAGTCGTAGG - Intronic
1196938123 X:120749731-120749753 AAGGGTGGGGAGAGAGCTGCAGG - Intergenic
1197393329 X:125895533-125895555 CAGGGTGGGTAGAGAAAGGTAGG + Intergenic
1198167267 X:134070374-134070396 CAGCATGGGCAAAGAGCTGTTGG - Intergenic
1198420831 X:136469572-136469594 CAGGGTGGGGAGGGGGTTGTGGG + Intergenic
1199895002 X:152119527-152119549 CAGGGTTGGCAGGGTGCTGGGGG + Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200080724 X:153575163-153575185 CAAAGTGGGCAAAGAGCTATGGG + Intronic