ID: 924638062

View in Genome Browser
Species Human (GRCh38)
Location 1:245807503-245807525
Sequence CAATGCTACTTGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924638055_924638062 20 Left 924638055 1:245807460-245807482 CCTTGTTCACTGGTGACAACTCA 0: 1
1: 0
2: 2
3: 15
4: 140
Right 924638062 1:245807503-245807525 CAATGCTACTTGAGGGAAGCAGG 0: 1
1: 0
2: 0
3: 13
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924638062 Original CRISPR CAATGCTACTTGAGGGAAGC AGG Intronic
909659290 1:78064380-78064402 CACTGGCATTTGAGGGAAGCAGG - Intronic
915297255 1:154929982-154930004 CAACGCTCCTGGAGGGAAACTGG - Intronic
915457560 1:156050957-156050979 CATTGATACTTGAGTCAAGCTGG - Intronic
917577823 1:176342851-176342873 CCAAGCCACTTGAGGAAAGCAGG + Intergenic
923392741 1:233530103-233530125 CATTTCTACATGAGGAAAGCTGG - Intergenic
924638062 1:245807503-245807525 CAATGCTACTTGAGGGAAGCAGG + Intronic
1062772520 10:114203-114225 CAATGTTTCTTGACTGAAGCAGG + Intergenic
1065428323 10:25628660-25628682 CAAGGCTACTTGAGGGTGGAGGG - Intergenic
1065486149 10:26238091-26238113 CAATGCCACTTGAGGTAAGGAGG + Intronic
1065524694 10:26608248-26608270 CAATTATACTTGAGTAAAGCGGG + Intergenic
1065781136 10:29168912-29168934 CAATTCTACTAGTAGGAAGCAGG - Intergenic
1065966796 10:30777221-30777243 GGATGCTACTTTTGGGAAGCAGG - Intergenic
1066473694 10:35724244-35724266 CAAGGGTACTAGAGGAAAGCAGG + Intergenic
1067467940 10:46515144-46515166 CAATGCCAGTTGAGGGAGGAAGG - Intergenic
1073376711 10:103041505-103041527 CAAGGCTACTTGGCAGAAGCAGG + Intronic
1074546022 10:114403334-114403356 CAAGACTACTTTAGGGAAGCCGG + Intronic
1076345915 10:129778916-129778938 CAATGCTTCTTGTGGGCTGCTGG - Intergenic
1078355727 11:10630134-10630156 CAATGTGACTGGAGGGAAGGTGG - Intronic
1078454310 11:11463142-11463164 CAGTGATAACTGAGGGAAGCAGG - Intronic
1082958280 11:58895137-58895159 AAGTGCTACGTAAGGGAAGCTGG - Intronic
1083492646 11:63024127-63024149 CCATGCAAATAGAGGGAAGCTGG - Intergenic
1087271164 11:96113489-96113511 CAAATCTACTTCAGGGAAGCTGG - Intronic
1087547148 11:99598691-99598713 CAGTGATAGCTGAGGGAAGCAGG + Intronic
1089833724 11:121351452-121351474 CTATGCTACTCGAGCAAAGCAGG - Intergenic
1091654225 12:2333566-2333588 CACTGCTACTGGAAGGAGGCTGG - Intronic
1095134533 12:38583924-38583946 TATTGCTACTTGTAGGAAGCAGG - Intergenic
1095535147 12:43237389-43237411 CAAAGCTACTTGAGGAAGTCAGG + Intergenic
1101376001 12:104172209-104172231 CAGTGCTCCTGGAGGGGAGCAGG + Intergenic
1102598449 12:114011345-114011367 CCAGGCTACCTGAGGGAAGAGGG - Intergenic
1106159142 13:27185025-27185047 CAAGGCTATGTGAGGGAAGAGGG + Intergenic
1107609958 13:42103212-42103234 GAATGCTACTTGAATGCAGCTGG + Intronic
1110789417 13:79570573-79570595 GAATGTTACTAGAGAGAAGCAGG + Intergenic
1111828305 13:93296282-93296304 CAGTGGTACTAGAGGGAAGAAGG - Intronic
1112101542 13:96195270-96195292 CATTGCTACTTTCAGGAAGCAGG - Intronic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1117598436 14:57347961-57347983 AACTGCTTCTTGAGTGAAGCAGG - Intergenic
1117830172 14:59742215-59742237 CATTTCTTCTTGAGGGAAACTGG + Intronic
1118677262 14:68200618-68200640 CAATTTTACTTGAAGGAAGTTGG + Intronic
1118961064 14:70533588-70533610 CAATGCTTGTTGAGGGATGGGGG + Intronic
1120311047 14:82828957-82828979 CAATGCAATTTGAGTGCAGCTGG + Intergenic
1128206322 15:65855836-65855858 TAATGCTACTTGAGGAAAGAAGG + Intronic
1132397477 15:101484865-101484887 CTATTCTACTTCAGGGAAGGTGG + Intronic
1133424652 16:5677504-5677526 CAAAGCAACATGAGGGAGGCAGG - Intergenic
1135431718 16:22389711-22389733 AAATGCTAAGTGAAGGAAGCTGG - Intronic
1135568205 16:23528338-23528360 CAATGGCACTGCAGGGAAGCAGG + Intronic
1135644244 16:24147356-24147378 CCAAGCCACTTGATGGAAGCAGG + Intronic
1139959493 16:70709581-70709603 CAAGGGTACGAGAGGGAAGCAGG + Intronic
1140542881 16:75775668-75775690 AAATTCTACTTGAGAGAAGCTGG + Intergenic
1141066971 16:80921809-80921831 CCAAGCTACTAGAGGGAACCCGG + Intergenic
1142142499 16:88478861-88478883 AAATGCTACTCGAGGGAAACGGG + Intronic
1142983594 17:3685319-3685341 CACTGCTACCTGAGGACAGCTGG + Intronic
1144256676 17:13475283-13475305 CATTGCCAATTGATGGAAGCTGG - Intergenic
1144300449 17:13918921-13918943 CATTCCTAGTTGAGGGAAGGGGG - Intergenic
1147909157 17:43844487-43844509 CCATGCTTCTGGTGGGAAGCAGG + Intergenic
1148405694 17:47412598-47412620 AAGTGCTGCTTGAGGGAAGTGGG + Intronic
1148500399 17:48086261-48086283 CAATGCTACTTGACTGCAGAAGG + Intronic
1149772735 17:59333481-59333503 CCATGCTCCTAGAGGGAAGAAGG - Intronic
1153094358 18:1383661-1383683 CAATGCAGCTGGAGGGGAGCAGG - Intergenic
1156552204 18:38029447-38029469 CAATTCTGCTTGAGGAAATCAGG + Intergenic
1162159829 19:8703537-8703559 CAATACTGCTTGAGTGAAGATGG + Intergenic
1164647473 19:29870208-29870230 CAATGATTCTTGAGGGGAGCAGG - Intergenic
1168666733 19:58210060-58210082 CAGTGCTCCCTGAGGTAAGCGGG + Exonic
926781330 2:16475029-16475051 CAATCCTACAGGAGAGAAGCAGG - Intergenic
927872445 2:26632170-26632192 CAATGCCACTGGAAGGAGGCTGG - Intronic
928012808 2:27626767-27626789 AAAAGCTAGTTAAGGGAAGCTGG + Intronic
929568760 2:43006691-43006713 CCATACTCCTTGAGGGCAGCAGG - Intergenic
930063227 2:47308205-47308227 AACTGCTACTAGAAGGAAGCTGG - Intergenic
1169881766 20:10354316-10354338 TATTGCTACCTGAAGGAAGCTGG + Intergenic
1173975228 20:47181906-47181928 CAAAGGTACTTGAGGTATGCAGG - Intronic
1175677186 20:60956954-60956976 GAAAGCTCCTTGAGGCAAGCAGG - Intergenic
1185106019 22:48870359-48870381 CAAGGCTGCCTGGGGGAAGCAGG - Intergenic
951632386 3:24736191-24736213 CAATGCTGCTGGAGAGAAGGAGG + Intergenic
951911264 3:27753148-27753170 AAATGCTACATGAGGCAAGATGG + Intergenic
955390727 3:58520595-58520617 AACTGCAACTTGAGGGAAGAGGG - Intronic
960590364 3:119359948-119359970 TAATGATACTTGAGGGAAGAGGG - Intronic
961226673 3:125256052-125256074 GAATTCTAATTGAGGAAAGCTGG - Intronic
962146894 3:132849066-132849088 CAATTCTACTTGTAGGTAGCAGG - Intergenic
964590953 3:158361328-158361350 CACTGCTACTGCAGGGAAGGAGG - Intronic
965253412 3:166371041-166371063 CCATTATACTTGAGAGAAGCAGG - Intergenic
965436270 3:168656376-168656398 CTATGCTAATTGAAAGAAGCCGG - Intergenic
965814856 3:172625800-172625822 CAATGGCACTTCAGGGAAGAAGG + Intergenic
966036677 3:175425382-175425404 CAATGCTGCTTGATGGTAGCAGG - Intronic
969495789 4:7525502-7525524 CCATGCTGCTTGGGGGAAGGTGG - Intronic
971545726 4:27883007-27883029 TAATGCTACCTAAGGAAAGCAGG - Intergenic
975248158 4:72144250-72144272 CAAGGCTACTTGAAGGTACCTGG + Intronic
975627314 4:76362931-76362953 GGTTGCTACTTGAGGTAAGCTGG + Intronic
977907366 4:102493579-102493601 AAATGCTACTGCAGGTAAGCAGG + Intergenic
981612977 4:146615826-146615848 CAATGATTCTTGCTGGAAGCTGG + Intergenic
983521371 4:168712399-168712421 CAATGAAACTGGAGGGAAGCAGG + Intronic
986651156 5:9964537-9964559 CGATGCCACATGAGGGAAGCAGG + Intergenic
990189894 5:53248300-53248322 CAATGCTACATTACGGAAGGTGG + Intergenic
993318580 5:86443098-86443120 CAATTCCACTGAAGGGAAGCTGG + Intergenic
993724975 5:91356450-91356472 CAATGGTAATGGAGGGAAACGGG + Intergenic
994745834 5:103677178-103677200 GAAGGCTAAATGAGGGAAGCAGG - Intergenic
996762168 5:126997482-126997504 GAATGCTGCCTGAGGGAGGCTGG + Intronic
997231288 5:132245220-132245242 CATTGTTACTTGAGGGAATAGGG - Intronic
997373448 5:133379140-133379162 CAATGCTACTGGAGATAACCAGG + Intronic
1000006977 5:157194833-157194855 CAATACTATTTGAGGGAACTAGG + Intronic
1002512089 5:179727243-179727265 AAATTCTACTTGGGGGAAACAGG + Intronic
1004789945 6:19014368-19014390 CAGTGCTACTTCAGTGAAGTTGG - Intergenic
1008070660 6:47095757-47095779 CAATACTAGTTCAGGGATGCAGG - Intergenic
1014981477 6:127950905-127950927 ACATGCCAGTTGAGGGAAGCAGG - Intergenic
1015391457 6:132686770-132686792 AAAAGCAACTTGAAGGAAGCAGG + Intronic
1015439175 6:133228017-133228039 CAGTGCTTCTTGAGGGAGGGAGG - Intergenic
1019383418 7:740149-740171 CAACACTCCTTAAGGGAAGCGGG - Intronic
1026279402 7:68908764-68908786 AACTGCTAATTCAGGGAAGCTGG + Intergenic
1027746645 7:82082851-82082873 AAATGCTAATTGAGGGATGATGG - Intronic
1028107461 7:86896715-86896737 CAAAGCTAGTTCAGTGAAGCAGG + Intronic
1030106864 7:105994917-105994939 CAGTGCAACCTGAGGGCAGCTGG + Intronic
1031964640 7:128018851-128018873 CAATGTTAGTTGAGGGTAGAGGG - Intronic
1037023119 8:13998581-13998603 AAATTCTACCTTAGGGAAGCAGG - Intergenic
1038259600 8:25981296-25981318 CAGTGCTAGGTGAGGGAAGATGG - Intronic
1042679746 8:71369729-71369751 CAAGGCTACTTGAGGGAACATGG + Intergenic
1045142868 8:99306395-99306417 TAATGCTGTTTGGGGGAAGCTGG + Intronic
1054707175 9:68474480-68474502 CCATGCTACTTGAGCTAGGCAGG - Intronic
1055131400 9:72779027-72779049 CAATGCTCCATGAGGGTTGCTGG - Intronic
1056115530 9:83437885-83437907 CAAAGCTAAGTGAGCGAAGCAGG + Intronic
1059441709 9:114311027-114311049 CAAGCCAACTTGAGGGAAGGGGG + Exonic
1188789130 X:34386867-34386889 CAATTATACTTCAGTGAAGCTGG - Intergenic
1194920724 X:99760810-99760832 CAATGCTAGTTGGGGGGAGCTGG + Intergenic
1196151793 X:112382398-112382420 AAAAGCTAGTTAAGGGAAGCTGG - Intergenic
1196970619 X:121104416-121104438 CAGTTCTACTTGAAGGAGGCAGG + Intergenic
1198390347 X:136167799-136167821 CGATTCTACTTGACGGAATCCGG - Intronic
1198996962 X:142583995-142584017 CAATGCTAATTTGGGGAATCAGG + Intergenic
1199816892 X:151405710-151405732 CAAGGGGACTTGAAGGAAGCAGG - Exonic
1201695691 Y:16822794-16822816 CAATGTGACTTGAGGGGAGTAGG - Intergenic