ID: 924641257

View in Genome Browser
Species Human (GRCh38)
Location 1:245835753-245835775
Sequence ATGGGATCATTAGGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 1, 2: 0, 3: 25, 4: 271}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924641250_924641257 11 Left 924641250 1:245835719-245835741 CCTTTCTAATGATCCCACACACT 0: 1
1: 0
2: 0
3: 15
4: 121
Right 924641257 1:245835753-245835775 ATGGGATCATTAGGAAAAACAGG 0: 1
1: 1
2: 0
3: 25
4: 271
924641252_924641257 -2 Left 924641252 1:245835732-245835754 CCCACACACTCTCTGGACTGTAT 0: 1
1: 0
2: 1
3: 12
4: 154
Right 924641257 1:245835753-245835775 ATGGGATCATTAGGAAAAACAGG 0: 1
1: 1
2: 0
3: 25
4: 271
924641253_924641257 -3 Left 924641253 1:245835733-245835755 CCACACACTCTCTGGACTGTATG 0: 1
1: 0
2: 1
3: 13
4: 165
Right 924641257 1:245835753-245835775 ATGGGATCATTAGGAAAAACAGG 0: 1
1: 1
2: 0
3: 25
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924641257 Original CRISPR ATGGGATCATTAGGAAAAAC AGG Intronic
903000915 1:20265255-20265277 ATGGGGTGGGTAGGAAAAACAGG - Intergenic
903400158 1:23037815-23037837 ATGACATCATTAAGAAAAGCAGG - Intronic
903597475 1:24506448-24506470 ATAGGATAATTATCAAAAACAGG - Intronic
905288820 1:36907626-36907648 ATGAGGTCATCAGGAGAAACAGG + Intronic
905648618 1:39641382-39641404 ATGGGATCATTCAGAAAACGTGG + Intergenic
908250879 1:62264745-62264767 ATGGGATCTTCAAGAAAATCTGG + Intronic
909274850 1:73670346-73670368 AAGGGAACATTTGAAAAAACAGG - Intergenic
910401372 1:86841236-86841258 ATGGGCTCTTTAGGAAAGACAGG + Intergenic
910727432 1:90353620-90353642 ATGGGATCATTTTGCAAAAGAGG + Intergenic
910800058 1:91136324-91136346 ATGAGTTTATTAGGAAGAACTGG - Intergenic
912180433 1:107212752-107212774 CTGGTATCTATAGGAAAAACTGG - Intronic
912321847 1:108720953-108720975 ATGGGAGAACTAGGAAAAATAGG - Intronic
912377426 1:109222269-109222291 ATGTTATCATTGGGGAAAACGGG - Intronic
912765235 1:112402963-112402985 ATGATACCATTAGCAAAAACAGG - Intronic
913249902 1:116904584-116904606 ATGGCTTTATTATGAAAAACTGG - Intergenic
914411561 1:147434019-147434041 GTGGGATCATTAATTAAAACAGG - Intergenic
917346439 1:174033080-174033102 ATGGAAGCATTAGGAGAATCTGG - Intergenic
917361292 1:174178852-174178874 GGGAGAGCATTAGGAAAAACAGG + Intronic
918367584 1:183825117-183825139 GTGGTATCATTAGTAGAAACAGG + Intronic
919047013 1:192464980-192465002 ATGAGATCATTTGGACACACAGG - Intergenic
919162740 1:193853034-193853056 ATTGTATCATTAGGAGAAACTGG - Intergenic
919191538 1:194227570-194227592 ATGGAGACATTATGAAAAACAGG - Intergenic
919556602 1:199063011-199063033 ATGGTATGATTAGGGAAAATAGG + Intergenic
921136256 1:212261807-212261829 GTGGGAACATTTGGAAAAATTGG - Intergenic
922224042 1:223629835-223629857 ATGGAATGAATAGGAGAAACAGG - Intronic
923720797 1:236465062-236465084 ATGCGATCACTGGGGAAAACAGG - Intronic
923854524 1:237831455-237831477 ATGGAAATATTAGGATAAACAGG - Intronic
924074248 1:240316806-240316828 ATGCTATCATTGGGGAAAACTGG - Intronic
924641257 1:245835753-245835775 ATGGGATCATTAGGAAAAACAGG + Intronic
1063050407 10:2441118-2441140 ATGGGATCCTTGGAGAAAACTGG + Intergenic
1064150965 10:12864571-12864593 ATGGGTTTAATAGGAATAACAGG - Intergenic
1064869887 10:19925600-19925622 ATGAGAACAATAGGAAAAAATGG - Intronic
1064924696 10:20556781-20556803 ATGGGATCAACAGGAAGAAAGGG + Intergenic
1065058249 10:21869838-21869860 ATGTAACCATTAGGAAAAACTGG + Intronic
1066068791 10:31783367-31783389 ATGGAATCATAAGAAAACACAGG + Intergenic
1066363387 10:34752969-34752991 AATGGAGCATTTGGAAAAACAGG - Intronic
1066452324 10:35541953-35541975 ATGGGATCCTAAAGAAAAAAAGG - Intronic
1067196476 10:44123746-44123768 ATGTTAACAGTAGGAAAAACTGG - Intergenic
1068327163 10:55507650-55507672 ATAGCATAATTGGGAAAAACTGG + Intronic
1069002562 10:63282039-63282061 ATGAAACGATTAGGAAAAACTGG - Intronic
1070188113 10:74085724-74085746 ATGAGATAATTAGGATACACAGG + Intronic
1071230863 10:83582964-83582986 AAGGGATCTTTAGGAAGAAAGGG - Intergenic
1071932652 10:90490264-90490286 ATGTTAACATTAGGGAAAACTGG - Intergenic
1072061106 10:91811327-91811349 AAGGGATGATTAGGAAAATGAGG - Intronic
1072698511 10:97622279-97622301 ATGGGAGCAGAAGGAACAACTGG + Intronic
1072989569 10:100178986-100179008 ATGGTATTATTGGAAAAAACTGG - Intronic
1073041980 10:100614088-100614110 ATGGCATCATTAGGGAAACAAGG - Intergenic
1074469032 10:113710263-113710285 ATGGGATGGTTAGGAAGCACTGG + Intronic
1075263673 10:120983212-120983234 ATAGGATTATTAGGAAAGTCAGG - Intergenic
1075308366 10:121389334-121389356 ATGTTAACAATAGGAAAAACTGG + Intergenic
1084451282 11:69240348-69240370 ATGGGGACATTTGGAAGAACTGG - Intergenic
1086580887 11:88397027-88397049 AGGACATTATTAGGAAAAACAGG + Intergenic
1087816888 11:102668390-102668412 ATGTAATCATTGGGGAAAACTGG - Intergenic
1088357386 11:108958167-108958189 ATGTTAACATTTGGAAAAACCGG - Intergenic
1088424062 11:109681980-109682002 ATCTGTTCATGAGGAAAAACTGG + Intergenic
1089873679 11:121699334-121699356 ATCCTACCATTAGGAAAAACTGG - Intergenic
1090724014 11:129505787-129505809 ATGTTACCATTAGGGAAAACTGG - Intergenic
1092011093 12:5113207-5113229 ATTTGATCATTAGGGAAAAAAGG - Intergenic
1092311408 12:7358829-7358851 ATGGGATCTAAAGGAAAAAGAGG + Intronic
1093566997 12:20618648-20618670 AAGGAGTCATTAGGAAAAAGGGG + Intronic
1094286327 12:28798548-28798570 ATGCTTTCATTAGGAAAACCAGG + Intergenic
1095207389 12:39454202-39454224 ATGATATCATTAGCAGAAACAGG + Intergenic
1095922911 12:47548837-47548859 ATGTTAACATTAGGAGAAACTGG + Intergenic
1097987440 12:65798806-65798828 ATGGGATGATGAGGAAAGACAGG + Intergenic
1097997867 12:65909615-65909637 AAGGGATGATGAAGAAAAACAGG + Intronic
1098556816 12:71828182-71828204 ATGCTATCACTGGGAAAAACTGG - Intergenic
1100755546 12:97747699-97747721 ATGGGATCTTTAGGGAAGGCAGG - Intergenic
1101083047 12:101208707-101208729 TTGGGATCAGTAGGAAAATTAGG - Intronic
1101743880 12:107522977-107522999 ATTGGATCATAAGTAAATACAGG - Intronic
1102610670 12:114109210-114109232 AAGGTAGCATGAGGAAAAACAGG + Intergenic
1102618955 12:114178464-114178486 ATGAGATCATTAGTTAAAAATGG - Intergenic
1102905778 12:116674237-116674259 AAGGCATCAATAGGAAAAGCTGG - Intergenic
1103038970 12:117678961-117678983 ATGGCATCAGTGGGAAAGACTGG + Intronic
1105242878 13:18623091-18623113 ATGGTAGTATTAGGAAAAATAGG + Intergenic
1105686762 13:22791416-22791438 TTGGGAACATGTGGAAAAACTGG + Intergenic
1105895079 13:24710539-24710561 ATCTGATCATCAGGAAAACCCGG + Exonic
1106442178 13:29785253-29785275 ATGTTACCATTAGGGAAAACTGG + Intronic
1106444017 13:29807522-29807544 ATAGAATTAATAGGAAAAACTGG - Intronic
1106819284 13:33445194-33445216 ATGAGGGCATTAGGAAAAAATGG - Intergenic
1110116073 13:71818239-71818261 ATGCTATAATTAGGGAAAACAGG + Intronic
1111561707 13:89958631-89958653 TTGGAATGATTAGCAAAAACTGG + Intergenic
1111769004 13:92572540-92572562 TTGGGTTCATTAGGCAAAAAAGG + Intronic
1112905210 13:104409526-104409548 ATGCTATCATTTGGAGAAACTGG + Intergenic
1113543462 13:111127031-111127053 GTGGACTGATTAGGAAAAACGGG + Intronic
1113895677 13:113763026-113763048 ATGGGAGCCTAAGGAAAAGCAGG + Intronic
1114764064 14:25350486-25350508 ATGCAAGCATTAGGAAACACAGG - Intergenic
1115368578 14:32586245-32586267 ATGGGAACATGAGTAAAAAGGGG - Intronic
1115507498 14:34106454-34106476 AGGGGATCATAAGGAAGAAAAGG + Intronic
1115699704 14:35939571-35939593 ATGTGTACATTGGGAAAAACTGG + Intergenic
1115967918 14:38912667-38912689 ATGCGGTCATTTGGAAAAAGAGG - Intergenic
1116153248 14:41169048-41169070 TATGAATCATTAGGAAAAACAGG - Intergenic
1117343601 14:54812024-54812046 ATGGGATCATCAGGTACAGCTGG + Intergenic
1117859129 14:60071414-60071436 ATGTTAACATTAGGAAAAGCTGG + Intergenic
1118426885 14:65675160-65675182 GTGGGATCATCAGGAAATACAGG + Intronic
1121710594 14:96036084-96036106 ATGTTATCATTGGGAGAAACTGG + Intergenic
1123488422 15:20761513-20761535 ATGGTAGTATTAGGAAAAATAGG - Intergenic
1123544919 15:21330586-21330608 ATGGTAGTATTAGGAAAAATAGG - Intergenic
1124592262 15:31063784-31063806 ATGGCCTCATTGGGAAAACCAGG + Intronic
1125124635 15:36205912-36205934 ATATTATCATTAGGAGAAACTGG + Intergenic
1128759052 15:70202986-70203008 ATGCCATCATGAGGAAGAACAGG - Intergenic
1202953264 15_KI270727v1_random:57857-57879 ATGGTAGTATTAGGAAAAATAGG - Intergenic
1134345375 16:13386219-13386241 ATGTTATCATTAGGAGAAACTGG + Intergenic
1134515130 16:14880849-14880871 CTGGGAGCATTCAGAAAAACTGG - Intronic
1134702805 16:16279496-16279518 CTGGGAGCATTCAGAAAAACTGG - Intronic
1134964738 16:18432619-18432641 CTGGGAGCATTCAGAAAAACTGG + Intronic
1134969025 16:18515154-18515176 CTGGGAGCATTCAGAAAAACTGG + Intronic
1137468446 16:48732666-48732688 ATGCCATCATTGGGAGAAACTGG - Intergenic
1137949418 16:52768999-52769021 ATGCTAACATTAGGAAGAACAGG + Intergenic
1139070224 16:63371381-63371403 AAATGATCATTAGGAAACACTGG + Intergenic
1139645184 16:68324259-68324281 ATGGGATCATTGGGAAAAGTTGG + Intronic
1139973548 16:70791250-70791272 GTGGGATCATCAGGAAAGGCAGG - Intronic
1151810492 17:76437767-76437789 ATGTGAACATTAGGGAAAACTGG + Intronic
1152490980 17:80633494-80633516 ACGGAATCATTAGGAGACACCGG - Intronic
1153892687 18:9532923-9532945 ATGGGGTCACTAGGAAAAGAAGG - Intronic
1154446059 18:14436786-14436808 ATGGTAGTATTAGGAAAAATAGG - Intergenic
1156539310 18:37893992-37894014 ATGTGATAATTTGGAAAGACAGG + Intergenic
1156822966 18:41394747-41394769 GTGGGATCAGTAGGAACATCAGG - Intergenic
1158661754 18:59394973-59394995 ACGGGACCATTTGGAAGAACAGG + Intergenic
1158883703 18:61805605-61805627 ATGGAATCATGAGGAAAATTAGG - Intergenic
1158958078 18:62561379-62561401 ATGGGATCTGCAGGAGAAACTGG - Intronic
1159719807 18:71874385-71874407 ATGGAATCAATTTGAAAAACTGG + Intergenic
1162001724 19:7748798-7748820 ATGTTACCATTAGGAGAAACTGG - Intergenic
1162937825 19:13990324-13990346 AGGGGATCTTTGGGAAAAAGGGG + Intronic
1163096188 19:15058998-15059020 TTGAGTTCATTAGGAAAAATAGG - Intergenic
1164863691 19:31584874-31584896 ATGCTAACATTAGAAAAAACAGG - Intergenic
1165773442 19:38390941-38390963 ATGGGTTCATCAGGAATAACTGG + Intronic
1165932167 19:39366653-39366675 AGGGGATCATTAAGAGAAATAGG + Intronic
1166015614 19:39977285-39977307 ATAGTATAATTAGGAAAACCAGG + Intronic
1166455097 19:42934142-42934164 ATGGGAACTTTGGGAAACACAGG + Intronic
1168570361 19:57462546-57462568 ATGTAACCATGAGGAAAAACTGG - Intronic
925440943 2:3884657-3884679 ATGGGATCCTAAGGAAGCACTGG - Intergenic
927288631 2:21382498-21382520 CTGGCATCATTAGGAAACAGAGG + Intergenic
927425989 2:22981780-22981802 ATGGGCACATTAGGAAGAACAGG - Intergenic
927801937 2:26108707-26108729 ATGTTATCATTAGGAAAAGCTGG + Intronic
931738634 2:65221723-65221745 TTGAGACAATTAGGAAAAACTGG + Intergenic
931782311 2:65589362-65589384 ATGTGATCAGTGGGAAGAACTGG + Intergenic
932404726 2:71505466-71505488 GTGGGATCCTTAGGAAACTCTGG + Intronic
932610528 2:73195992-73196014 GTGGGAAAATTAGGACAAACTGG - Intergenic
932642114 2:73459677-73459699 ATGGGATCATAAGAACACACAGG - Intronic
932818426 2:74879760-74879782 TTGGGATCATTGGCAGAAACTGG + Intronic
934949742 2:98567971-98567993 AGGTGATCATTAGGAAATGCAGG - Intronic
935291219 2:101612545-101612567 ATCTGATGATTAGGAAACACTGG + Intergenic
935634637 2:105240769-105240791 ATGTTACCATTAGGGAAAACTGG + Intergenic
936007575 2:108904941-108904963 ATGTTATCGTTAGGAGAAACTGG + Intronic
937563072 2:123248791-123248813 ATGGGATTCTTTGGAAAAAGAGG + Intergenic
939318922 2:140589985-140590007 ATGTAATCATTAGGGAAAACTGG + Intronic
939581289 2:143949932-143949954 ATACAATTATTAGGAAAAACTGG - Intronic
940131394 2:150387185-150387207 CTGGGCTCAGTAGGAAAAGCTGG - Intergenic
940879167 2:158929268-158929290 ATCTGATGATTAGGAAACACTGG - Intergenic
940969578 2:159881027-159881049 ATATTATCATTAGGTAAAACAGG + Intronic
941046498 2:160681845-160681867 ATAGGATTATAAGGAGAAACCGG - Intergenic
942606284 2:177694786-177694808 ATGAAAGCATTAGGAAACACAGG - Intronic
942691801 2:178593175-178593197 ATTGGATCTTTAGCAAAGACTGG + Exonic
943054351 2:182957471-182957493 TTGAGAGCATGAGGAAAAACAGG - Exonic
943068424 2:183113489-183113511 ATGTAATCATTGGGAGAAACTGG + Intergenic
944090716 2:195907487-195907509 ATTCGATCATAAGGAAAAACTGG + Intronic
945184181 2:207123011-207123033 ATGGGATAATTTGGAAAAGTGGG - Intronic
946426440 2:219600438-219600460 ATGTAACCATTAGGGAAAACTGG + Intronic
947069954 2:226278049-226278071 ATGTTACCATTAGTAAAAACTGG + Intergenic
947854976 2:233317385-233317407 ATGGAACCATTGGGAGAAACTGG + Intronic
1172178123 20:32984863-32984885 CTGGGCTCATCAGGAAAAAGGGG + Intronic
1173276040 20:41583741-41583763 ATAGGATGAAGAGGAAAAACTGG + Intronic
1173887759 20:46476491-46476513 ATGTTACCATTAGGCAAAACTGG + Intergenic
1176449920 21:6853066-6853088 ATGGTAGTATTAGGAAAAATAGG + Intergenic
1176828090 21:13718084-13718106 ATGGTAGTATTAGGAAAAATAGG + Intergenic
1177122295 21:17153110-17153132 ATGGGATCAAGAGGAAGAAAGGG + Intergenic
1178414849 21:32395725-32395747 CTGGGAACAATAGGAAAAACAGG + Intergenic
1178739135 21:35180955-35180977 AGGAGATGATTAGGAAACACTGG + Intronic
1179017605 21:37606534-37606556 AGGGGCACATTAGGAAAATCAGG + Intergenic
1179184212 21:39071827-39071849 AAGTGATCATTAGGAAAAAATGG - Intergenic
1179484985 21:41704333-41704355 CTGGGATCATAAAGACAAACAGG - Intergenic
1180580907 22:16835868-16835890 ATGGGATCTAAAGGCAAAACAGG + Intergenic
1180947186 22:19702648-19702670 ATGGCATCATTGGGGAAAACTGG + Intergenic
949275824 3:2279413-2279435 ATCAGATCATTAGGAGATACAGG + Intronic
951878164 3:27451834-27451856 ATGTTAACATTAGGAGAAACTGG + Intronic
952563780 3:34630157-34630179 ATTGCATCAGTAGGAAAGACGGG + Intergenic
952831185 3:37566439-37566461 ATGTTATCATTGGGAAAAGCCGG - Intronic
953302636 3:41794146-41794168 AAGAGATCATTAGGAGAAACAGG + Intronic
954505062 3:51062340-51062362 ATGGCATGTTCAGGAAAAACAGG - Intronic
955846271 3:63166422-63166444 ATGTTACCATTAGGGAAAACCGG - Intergenic
956214502 3:66834423-66834445 TAGGGAGCATGAGGAAAAACTGG - Intergenic
957128157 3:76188948-76188970 ATGGAATCATAAGCAAAAAAAGG + Intronic
957349478 3:79004609-79004631 ATTGATTCATTAGGACAAACAGG + Intronic
958158820 3:89790169-89790191 ATGGTATAATTATGAAGAACAGG + Intergenic
959168476 3:102812765-102812787 ATGGCATGATTAAGAAAAAATGG + Intergenic
962124528 3:132601857-132601879 ATGGAACCATTGGGGAAAACTGG + Exonic
963451985 3:145493594-145493616 ATATGATCATTAGGAAAACATGG + Intergenic
965644374 3:170864708-170864730 ATGTGATCATGAGGATAATCTGG - Intergenic
966549254 3:181185651-181185673 ATGGCATCACTTGGCAAAACAGG + Intergenic
966773694 3:183525676-183525698 AAGAGATCATTAGCAATAACTGG + Intronic
969842187 4:9890793-9890815 ATGGCATCATGATTAAAAACCGG + Intronic
971236711 4:24849078-24849100 AGGGGATCAGGAGGAAAAAAGGG - Intronic
971536084 4:27753165-27753187 GTGAGATGATTAGGAAAAAATGG + Intergenic
971885131 4:32435493-32435515 ATGGGAGTATGAGGAAAGACTGG + Intergenic
974009641 4:56594988-56595010 ATGGGATGATTGGGCAAAAACGG - Intronic
974544904 4:63289989-63290011 AAGGGATAATGAAGAAAAACAGG - Intergenic
975225699 4:71869351-71869373 ATGTTACCATTGGGAAAAACTGG - Intergenic
975377610 4:73664040-73664062 ATGGGATGATTAGAAATAATGGG + Intergenic
977077495 4:92474594-92474616 ATACCATCATTATGAAAAACAGG - Intronic
977973472 4:103237684-103237706 ATGTTATCATTGGGAGAAACTGG + Intergenic
977986793 4:103391934-103391956 ATGTTATCATTGGGAGAAACTGG - Intergenic
980625263 4:135366803-135366825 ATGTTACCATTAAGAAAAACTGG + Intergenic
982282906 4:153704102-153704124 TTGGCATCATTGGAAAAAACCGG + Exonic
984189775 4:176591883-176591905 ATCAGATCACTATGAAAAACTGG - Intergenic
986442058 5:7791616-7791638 CTGTGATCAATAGGAAAATCAGG - Intronic
986513670 5:8537455-8537477 ATGGGAAGATTATGAATAACTGG - Intergenic
988398115 5:30723572-30723594 ATGAGAACATTAGGTAAAAATGG - Intergenic
988473106 5:31558892-31558914 ATGGGATCATTAGAGAAAGGGGG + Intergenic
991083468 5:62625981-62626003 ATGTTAACATTAGGAAAAACTGG - Intronic
992343224 5:75848056-75848078 ACTGGATCCCTAGGAAAAACTGG - Intergenic
992402535 5:76424835-76424857 ATGGCATTATTAGGACAAAATGG + Intronic
993269715 5:85779450-85779472 ATGGAATCATCAGGAATAATGGG - Intergenic
993677002 5:90828062-90828084 AGTGAATCATTAGTAAAAACAGG + Intronic
996132594 5:119799661-119799683 ATGTGATCATTGTGAAAAAGGGG + Intergenic
996767878 5:127053094-127053116 GTGGACTGATTAGGAAAAACAGG - Intronic
996932515 5:128907233-128907255 ATGACATGATTAGAAAAAACAGG + Intronic
997275861 5:132588551-132588573 ATGTTATCATTGGGAGAAACTGG + Intronic
997787902 5:136730156-136730178 ATGTGATTAATAGGAAAAAGAGG + Intergenic
1000245655 5:159446727-159446749 GTGGGGCCATTAGGAGAAACAGG - Intergenic
1000577967 5:162999311-162999333 ATTGGATCATTGGGAAAACAAGG - Intergenic
1000731534 5:164840025-164840047 ATAGGAATATTATGAAAAACAGG + Intergenic
1000932443 5:167267752-167267774 AAGGGATCCTTAGGAAATGCAGG + Intergenic
1001226882 5:169952483-169952505 TGGGGAGCATTAAGAAAAACAGG - Intronic
1003749028 6:9035448-9035470 ATCGTATCATTAGGAGAAATAGG + Intergenic
1003907000 6:10710736-10710758 ATGTTATCATTGGGAAAACCGGG - Intergenic
1004333879 6:14746331-14746353 ATGTGATCATTGGGGGAAACTGG + Intergenic
1005064131 6:21801808-21801830 GTGGCCTCATTAGGAAATACGGG - Intergenic
1005668838 6:28084183-28084205 ATGGGATCTTTGGTAGAAACAGG - Intronic
1005851183 6:29823852-29823874 AGGGGAGCATTAGGAAAAATAGG - Intergenic
1006975899 6:38100806-38100828 ATGTTAACATTAGGAAAAGCTGG - Intronic
1007934321 6:45719558-45719580 AAGGGAACTTTAGGAAAACCGGG + Intergenic
1008677977 6:53841933-53841955 ATGTTACCATTGGGAAAAACTGG - Intronic
1009651966 6:66488789-66488811 ATGTGATAATTAGGAAAAAGTGG + Intergenic
1009977484 6:70687693-70687715 ATGTTACCATTAGGAGAAACTGG - Intronic
1010169020 6:72952962-72952984 ACTGGATCCTCAGGAAAAACAGG - Intronic
1011095557 6:83658176-83658198 ATGTTACCATTAGGATAAACTGG - Intronic
1012161115 6:95887117-95887139 ATGAGAGCATAAGGAGAAACAGG - Intergenic
1012646519 6:101690496-101690518 AGGGGATTATTAGGAAAGCCAGG - Intronic
1012752997 6:103186440-103186462 ATGGGACACTAAGGAAAAACTGG + Intergenic
1013004335 6:106057964-106057986 ATGGGAAAGTTAGGAGAAACCGG - Intergenic
1013678858 6:112500096-112500118 AAAGGATCATTAGGATATACTGG + Intergenic
1014095799 6:117459599-117459621 ATGGTATCAGTAGGAAAAATTGG - Intronic
1014428033 6:121333372-121333394 GTGGGAGCAGTAGGAAAAAGAGG - Intronic
1015176727 6:130317506-130317528 TAGGGTTCATTAGGAAATACTGG + Intronic
1015979437 6:138824206-138824228 ATGGAACCATTGGGGAAAACTGG + Intronic
1017184271 6:151585166-151585188 ATGGGAGCATTGGGCAAATCAGG + Intronic
1017925857 6:158911348-158911370 ATGGGATCATTACAAATTACTGG - Intergenic
1018484766 6:164229772-164229794 ATGGGATCAGAAGAGAAAACGGG - Intergenic
1019120301 6:169798160-169798182 ATGGCATCCTTATGAAAAATTGG - Intergenic
1019896438 7:3987153-3987175 ATGGGATGAAAAGGAAAAAGAGG - Intronic
1022219068 7:28294253-28294275 AGGGGATCATTAAAAAGAACAGG - Intergenic
1022304371 7:29132475-29132497 ATGGGTACATTTGGATAAACTGG + Intronic
1027358482 7:77383670-77383692 CTGTGATAATGAGGAAAAACTGG + Intronic
1028552748 7:92088888-92088910 ATGGTATCATTGGGAAAAGCTGG + Intronic
1028884893 7:95920535-95920557 ATGTGAACAATAGGGAAAACTGG + Intronic
1029309042 7:99644210-99644232 ATGGGGTTATTTGGATAAACAGG + Intergenic
1030755232 7:113279547-113279569 ATGGCTTCATTAGGAAACAAAGG + Intergenic
1031040994 7:116838418-116838440 AAGGGATCATTAGGAAAAACGGG - Intronic
1031510172 7:122639408-122639430 GTGCTATCATTAGGGAAAACTGG - Intronic
1032178345 7:129651974-129651996 ATGTGAACATTTGGAAAATCTGG - Intronic
1032277777 7:130474852-130474874 ATGGGATCATTGGATAACACAGG - Intergenic
1032963193 7:137064586-137064608 AGGGCATCAATAGGAAAAAATGG + Intergenic
1033164488 7:139028055-139028077 ATGGCATAGTTAGGAAAAAGAGG - Intronic
1034373287 7:150620284-150620306 ATGAGTACATTAGGAAAAAAAGG - Intergenic
1036141665 8:6214823-6214845 AGGGATTTATTAGGAAAAACTGG - Intergenic
1036398871 8:8390743-8390765 ATGGTATCATTATTACAAACGGG + Intergenic
1036420265 8:8588933-8588955 ATGGGATCAGAAATAAAAACAGG + Intergenic
1036556468 8:9864274-9864296 ATGGCATCACTAGGAAATAAGGG + Intergenic
1038077748 8:24096619-24096641 ATGTTAACATTAGGAAAAGCTGG - Intergenic
1038469477 8:27801459-27801481 AGGGTATCAGTAGGAAAAATTGG + Intronic
1039695763 8:39909286-39909308 ATAGGAGCTTTTGGAAAAACTGG + Intronic
1040849868 8:51888448-51888470 GTGGGAGCATTACGAAAATCAGG - Intronic
1042044863 8:64638762-64638784 CTGGGAGGATTAGGAATAACTGG + Intronic
1042811785 8:72833612-72833634 ATGGCATCTTTAGGAGAAAAAGG + Intronic
1043715017 8:83471837-83471859 ATGGAATCAGTAGAAAAACCAGG - Intergenic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1045102796 8:98862123-98862145 ATGAGATCATTAGGAGAAGCTGG + Intronic
1046523393 8:115354360-115354382 ATTGGCTCACTAGGAAAATCTGG + Intergenic
1047689665 8:127338878-127338900 ATGAGATCATAAGGTAAAAGGGG + Intergenic
1051428441 9:16958384-16958406 ATGGGATCATTTGCAAAAAAGGG + Intergenic
1051770902 9:20578329-20578351 ATGGAAGCATAATGAAAAACAGG + Intronic
1055084844 9:72303554-72303576 ATGAGTTCATTGGGAAAAAATGG + Intergenic
1056955118 9:91075312-91075334 AGGGGCTCATTAGGAAAAGAGGG - Intergenic
1057107674 9:92435424-92435446 ATGTTATCATTAGGGGAAACTGG - Intronic
1057247460 9:93468957-93468979 CTGGGATCAAGAGGAAAAGCGGG - Intronic
1203519261 Un_GL000213v1:31451-31473 ATGGTAGTATTAGGAAAAATAGG - Intergenic
1186924361 X:14316269-14316291 ATGTAAACATTAGGAAAAGCAGG + Intergenic
1187528243 X:20073165-20073187 TTGGGATGAAAAGGAAAAACAGG - Intronic
1187653635 X:21442609-21442631 GTGGAATCATCATGAAAAACAGG - Intronic
1188063266 X:25626968-25626990 ATGGTAGCATTAGGGAAAACTGG - Intergenic
1188707647 X:33355753-33355775 ATGTTATCATTGGGAGAAACTGG - Intergenic
1190650046 X:52560258-52560280 ATGGGTTCTCTAAGAAAAACAGG - Intergenic
1192573534 X:72225071-72225093 TTGGGAACAATAGGATAAACAGG - Intronic
1192960279 X:76122857-76122879 ATGTAATCATTAGGGAAATCTGG + Intergenic
1193410789 X:81160492-81160514 AGGAGAGCATTAGGAAAAATAGG - Intronic
1196928544 X:120658432-120658454 ATGGTGTCATTAGGAGAACCTGG + Intergenic
1198789177 X:140324171-140324193 ATGCTATCATTGGAAAAAACTGG + Intergenic
1199955494 X:152738538-152738560 ATGGGATAATTAGGCCAAAAAGG - Intergenic