ID: 924642479

View in Genome Browser
Species Human (GRCh38)
Location 1:245847537-245847559
Sequence CAGGCCCACCTGATTTCTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 226}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924642476_924642479 -5 Left 924642476 1:245847519-245847541 CCTTCATTACCCATTTTTCAGGC 0: 1
1: 0
2: 2
3: 20
4: 189
Right 924642479 1:245847537-245847559 CAGGCCCACCTGATTTCTTTTGG 0: 1
1: 0
2: 4
3: 17
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924642479 Original CRISPR CAGGCCCACCTGATTTCTTT TGG Intronic
900653495 1:3743052-3743074 GATGCCCACCTGCTCTCTTTAGG + Intergenic
901575335 1:10196211-10196233 CAGCACCAGTTGATTTCTTTAGG + Intergenic
902616225 1:17624964-17624986 CAGCCTCTGCTGATTTCTTTGGG + Intronic
902788956 1:18752106-18752128 CAGCCCCACCTGTTTTCTATGGG - Intergenic
903783005 1:25834458-25834480 CACGCCCAGCTAATTTTTTTTGG - Exonic
906359070 1:45137218-45137240 CATGCCCAGCTAATTTTTTTAGG + Intronic
907272999 1:53301572-53301594 CATGCCCAGCTAATTTTTTTTGG - Intronic
907411874 1:54288861-54288883 CACACCCAGCTGATTTTTTTTGG - Intronic
908696720 1:66851176-66851198 TAGCCCCTCCTGCTTTCTTTTGG - Intronic
909928277 1:81464208-81464230 CTGGCCAGCATGATTTCTTTGGG - Intronic
910297829 1:85669235-85669257 GAGCCCCACCTGACCTCTTTTGG - Intronic
910448510 1:87324016-87324038 CACGCCCAGCTAATTTTTTTTGG - Intergenic
910862256 1:91753231-91753253 CATGACCAGCTGATTTTTTTTGG - Intronic
911498682 1:98660819-98660841 CAGCCCCACCTCTTTTCTGTAGG - Intergenic
912817510 1:112841340-112841362 CAGGCACACCTAACTCCTTTAGG - Intergenic
912886975 1:113484879-113484901 CACGCCCAGCTAATTTTTTTTGG + Intronic
913193823 1:116436241-116436263 TATGCCAAACTGATTTCTTTTGG - Intergenic
913211542 1:116586827-116586849 TAGGCCCACCAGTGTTCTTTTGG - Intronic
915261715 1:154681620-154681642 CACGCCCGCCTAATTTTTTTTGG - Intergenic
915393625 1:155565138-155565160 CATGCCCACCTGATTTTTTTTGG - Intergenic
915477885 1:156163873-156163895 CAGGCCCAGCTCATTTTTTTTGG - Intronic
916150425 1:161783241-161783263 CAAGCCCACCTAAATTCTTGGGG + Intronic
916518417 1:165541557-165541579 CATGCCCAGCTAATTTTTTTTGG - Intergenic
917530934 1:175834328-175834350 CAGGCCCAGCTGATTTATTTTGG - Intergenic
918159967 1:181889305-181889327 CAGTCCCACATGAATTCTCTTGG - Intergenic
918224064 1:182463485-182463507 TAGGCACCCCTGCTTTCTTTTGG - Intronic
918777662 1:188655858-188655880 CAGGCCCAGCTAATTTTTGTGGG + Intergenic
919594451 1:199544901-199544923 GAGGGCCATCTGATTTCTGTAGG - Intergenic
920880612 1:209877002-209877024 CAGGACCACCAGTTTTCCTTGGG - Intergenic
921772776 1:219061704-219061726 CAGGTCCAGTTGATTTCATTGGG + Intergenic
923044692 1:230347165-230347187 CTGGCCCACCTGGTTTATTCAGG - Intronic
923072482 1:230578193-230578215 CTGGCTCACCTGACTTCTTAAGG + Intergenic
923372149 1:233325517-233325539 CACGCCCAGCTAATTTTTTTTGG - Intergenic
923870622 1:237989695-237989717 CAAGCACAACTGATTTATTTGGG - Intergenic
924077497 1:240355559-240355581 CATGCCCAACTGATTGGTTTGGG + Intronic
924642479 1:245847537-245847559 CAGGCCCACCTGATTTCTTTTGG + Intronic
1062865348 10:847681-847703 CAGGCCCAGCTAATTTTTTTTGG + Intronic
1065069529 10:22008180-22008202 CATGCCCAGCTAATTTTTTTTGG - Intergenic
1065559571 10:26948836-26948858 CACGCCCAGCTAATTTTTTTGGG - Intergenic
1068963086 10:62885068-62885090 CAGGCTCACCAGACTTATTTGGG - Intronic
1071151177 10:82636368-82636390 CAGGACAAACTGGTTTCTTTTGG - Intronic
1071983102 10:91023508-91023530 CAAGCCTCCCTGCTTTCTTTGGG + Intergenic
1072655549 10:97327757-97327779 GAGGCCTACCGGTTTTCTTTTGG - Intergenic
1073324337 10:102633844-102633866 CAGGCCCTCCTCATCTCCTTTGG + Intergenic
1074673314 10:115820551-115820573 CAGGCCGACCTGCCTTCATTAGG - Intronic
1076186702 10:128455838-128455860 CAGACCTTCCTGATTTCATTTGG + Intergenic
1076867057 10:133172646-133172668 CAGGGCCACCTGTTTTCTTTAGG + Intronic
1077066497 11:643346-643368 CAGGACCACCTGGTTTATTCCGG - Intergenic
1077266606 11:1653818-1653840 CAGGCCCACCTGAATGCTGAGGG + Intergenic
1081069869 11:38597353-38597375 CAGAACCTCCTGATGTCTTTCGG + Intergenic
1081419922 11:42863844-42863866 TGGGGCAACCTGATTTCTTTAGG + Intergenic
1081612211 11:44569290-44569312 CAGGCCCAGCTGGTGTCTCTCGG + Intronic
1082861720 11:57863443-57863465 CGGGCCCACGTGTTTTCTATTGG - Intergenic
1083907224 11:65680975-65680997 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1085288116 11:75377375-75377397 CATGCCCAGCTAATTTTTTTTGG - Intergenic
1085867256 11:80308862-80308884 CTGGCCCTCCTGATGTCTTCAGG - Intergenic
1086516024 11:87614228-87614250 CAGCCACACCTGCCTTCTTTTGG + Intergenic
1088870073 11:113883243-113883265 CATACCCAGCTGATTTCTGTAGG - Intergenic
1089020095 11:115204834-115204856 CAGGCCCACATTATTATTTTTGG - Intronic
1089286464 11:117411000-117411022 GAGGCCTGCCTGATTTCTTGGGG - Intronic
1090302781 11:125660693-125660715 TAGCCCCACTTGCTTTCTTTTGG + Intronic
1092124966 12:6068624-6068646 CATGCCCAGCTAATTTCTGTGGG + Intronic
1094106691 12:26819912-26819934 CATGCCCAGCTAATTTTTTTGGG - Intronic
1095109244 12:38273660-38273682 CAGGCCCAAGGGATTTATTTTGG + Intergenic
1096435487 12:51587230-51587252 CAGGCCCAGATGATTTCACTAGG + Intergenic
1096815405 12:54198772-54198794 AAGACAGACCTGATTTCTTTAGG - Intergenic
1097690868 12:62733409-62733431 CATACCCAGCTGATTTTTTTTGG + Intronic
1105009974 12:132749150-132749172 CACGCCCAGCTGATTTTTTTGGG + Intronic
1110087165 13:71394696-71394718 CAGGACCTCAGGATTTCTTTTGG - Intergenic
1112556266 13:100471531-100471553 CAGGCCTACCTCATTTTATTAGG - Intronic
1114034026 14:18604479-18604501 AATACCGACCTGATTTCTTTGGG - Intergenic
1114078822 14:19183653-19183675 AATACCGACCTGATTTCTTTGGG - Intergenic
1114124619 14:19710531-19710553 AATACCGACCTGATTTCTTTGGG + Intergenic
1116529826 14:45956386-45956408 CAGGGCCACCAGATTTCTGAAGG + Intergenic
1117488959 14:56227148-56227170 CAGGCCCACCTAATGACTTCTGG - Intronic
1118009057 14:61591325-61591347 CAGGAGCACCTGCTTTCTTCCGG - Intronic
1118123464 14:62872534-62872556 CACGCCCAGCTAATTTTTTTTGG - Intronic
1119831901 14:77710745-77710767 CAGGGTCACCAGATTTCTTGTGG - Intronic
1127273951 15:57426061-57426083 CAGGCCCTCCTCCTTTCTTCTGG + Intronic
1127464124 15:59227165-59227187 CCTGCCCACCTGAATTCCTTTGG + Intronic
1128374245 15:67064568-67064590 CAGACGCCCCTGAATTCTTTTGG + Intronic
1129083257 15:73060801-73060823 CATGCCCAGCTAATTTTTTTGGG + Intronic
1130221974 15:82027253-82027275 GAGGCCCACCTTTCTTCTTTAGG - Intergenic
1132827099 16:1910566-1910588 CATGCCCAGCTAATTTTTTTTGG - Intergenic
1133122983 16:3623050-3623072 CATGCCCAGCTAATTTTTTTGGG - Intronic
1133157793 16:3887978-3888000 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1134899288 16:17921502-17921524 CAGCCCCACCTGATGGCTTTTGG - Intergenic
1138034141 16:53585870-53585892 CAGGCCCAGATGATTTTTTAGGG - Intergenic
1138281637 16:55776401-55776423 GCAGTCCACCTGATTTCTTTGGG - Intergenic
1139093139 16:63673666-63673688 CAGTCCCACTTGAGATCTTTGGG + Intergenic
1141106389 16:81237219-81237241 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1142736356 17:1902669-1902691 CACGCCCAGCTGATTTTTTGGGG + Intergenic
1144526397 17:15994103-15994125 CATGCCCAGCTAATTTTTTTTGG + Intronic
1145915164 17:28569311-28569333 CACACCCAGCTGATTTGTTTTGG - Intronic
1148325824 17:46782939-46782961 CAGCCCCACCTGAGTCCCTTTGG - Intronic
1149587703 17:57803890-57803912 CACGCCCAGCTAATTTTTTTGGG + Intergenic
1150743006 17:67794763-67794785 CCCGCCCAGCTGATTTTTTTTGG - Intergenic
1151447149 17:74174645-74174667 CACGCCCAGATGATTTTTTTTGG - Intergenic
1153671838 18:7419180-7419202 CATGCCCAGCTAATTTCTTTTGG + Intergenic
1154117100 18:11620703-11620725 CATGCCCAACTGACTTCTTGAGG - Intergenic
1154118538 18:11633069-11633091 CAGGCCCAACTAATCTTTTTTGG + Intergenic
1155318285 18:24593847-24593869 CAAGCCCACCTGCTTTATCTTGG + Intergenic
1157934481 18:51858165-51858187 CAGGACCATCTGCTTTCTGTTGG - Intergenic
1158946526 18:62451668-62451690 CACCCCAGCCTGATTTCTTTCGG - Intergenic
1160505529 18:79424234-79424256 CGGGCCCACCTGGCCTCTTTAGG + Intronic
1160882456 19:1327389-1327411 CAGGCCCACCTCATTGCTCCCGG - Intergenic
1161687595 19:5711086-5711108 CAGGCCCACCTGGGTTCTTGAGG - Intronic
1161742227 19:6028920-6028942 CACACCCACCTAATTTTTTTTGG - Intronic
1162460943 19:10813667-10813689 CATGCCCAGCTAATTTTTTTTGG - Intronic
1162662528 19:12181627-12181649 CACGCCCAGCTAATTTTTTTTGG + Intronic
1163325529 19:16600701-16600723 CAGGCCCTCCTGCTTGCTGTAGG + Intronic
1164256016 19:23528909-23528931 CAAGCCCAGCTAATTTTTTTAGG - Intronic
1167588177 19:50386844-50386866 CAGGCTCACCTGCATGCTTTCGG - Intronic
1168045412 19:53790767-53790789 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1168345861 19:55649950-55649972 GAGGCCCACCCTAGTTCTTTGGG + Intronic
925135193 2:1521948-1521970 CAGGCTCATCTGCTTTCTCTGGG + Intronic
925686268 2:6476787-6476809 CAGGCCCACCTGGTTCCCCTGGG - Intergenic
927034177 2:19155801-19155823 CAGGCCCAGCTAATTTTTCTAGG - Intergenic
927062899 2:19440916-19440938 GAGGCCCATCTGCTTGCTTTGGG - Intergenic
927172847 2:20385096-20385118 CTGCCCCACCTGTCTTCTTTAGG + Intergenic
930877652 2:56237327-56237349 CAGGCCCAGCTCATTTGGTTGGG + Intronic
933490002 2:82973699-82973721 CGCGCCCAGCTGTTTTCTTTTGG + Intergenic
933737499 2:85506996-85507018 CAAGCTCACATGATTTCATTTGG - Intergenic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
942234966 2:173895137-173895159 CATGCCCAGCTAATTTCTTGGGG + Intergenic
943778010 2:191788506-191788528 CTGGCCCTGCTGATTTCTTGAGG - Intergenic
944671112 2:201995408-201995430 CTGGCCCACCTGAGCTCTTGGGG - Intergenic
948193519 2:236078323-236078345 GAGGCCCACCTGCTTTCTCAAGG + Intronic
1169739493 20:8876653-8876675 CAGGCTCACCTGATCTCAGTAGG + Intronic
1174214266 20:48904079-48904101 CATGCCCAACTAATTTTTTTTGG - Intergenic
1174486981 20:50867501-50867523 CATGCCCAGCTAATTTTTTTGGG + Intronic
1178362798 21:31963651-31963673 CATGCCCAGCTAATTTTTTTTGG + Intronic
1178418150 21:32420540-32420562 CAGGCCTAGCTAATTTTTTTTGG + Intronic
1179224211 21:39439090-39439112 CAGGCCCATGTGATTACATTAGG - Intronic
1180458145 22:15531522-15531544 AATACCGACCTGATTTCTTTGGG - Intergenic
1181986952 22:26806555-26806577 CAGTCCCACCTGAGTGCGTTTGG + Intergenic
950358974 3:12437085-12437107 CAGGCCAGCCTAATTTCTTATGG - Intergenic
950362658 3:12460865-12460887 CAGACCCAGCTCATTTCTTTAGG + Intergenic
950364104 3:12471064-12471086 CAGCCTCACCTGATTCCCTTAGG - Intergenic
950971890 3:17197531-17197553 CAAGCCCAGCTAATTTTTTTTGG + Intronic
953448847 3:42989922-42989944 CCCGGCCACCTGCTTTCTTTTGG + Intronic
954737093 3:52715541-52715563 CAGGCCCAGCTAATTTTTTTTGG + Intronic
955672038 3:61412171-61412193 CATGCCCAGCTAATTTTTTTTGG - Intergenic
960985168 3:123274378-123274400 CACGCCCAGCTTATTTTTTTTGG - Intergenic
961845881 3:129762623-129762645 CAAGCCCAGCTAATTTTTTTTGG - Intronic
963302620 3:143616035-143616057 CACGCCCAGCTAATTTTTTTTGG + Intronic
963356728 3:144217473-144217495 CAACCCCATCTGATTTATTTAGG - Intergenic
967598293 3:191353884-191353906 CAGGCCCTCCTCATATCTTTTGG + Intronic
968062543 3:195736989-195737011 CAGGCACACCTGCTTTCATCTGG + Intronic
970150005 4:13079680-13079702 CCAGCCCACCTAATTTCTTAAGG - Intergenic
971349678 4:25844762-25844784 CAGGGCCACCTAATTTGTTAAGG - Intronic
972436889 4:39044003-39044025 AATGCCCACGTGCTTTCTTTTGG - Intergenic
974369906 4:61002274-61002296 AAGGCCACCCTGCTTTCTTTTGG - Intergenic
974572770 4:63675771-63675793 CAGCCTCACCTGATAACTTTTGG - Intergenic
975464118 4:74689983-74690005 CAAGCCCAGCTAATTTATTTTGG + Intergenic
975611647 4:76209720-76209742 CAGTACCAGCTGGTTTCTTTTGG - Intronic
975787076 4:77902885-77902907 CAGGCCCACCTGATTCCCACTGG + Intronic
978419110 4:108511293-108511315 CATGCCCACCTGATTCCTTCTGG - Intergenic
978528157 4:109687200-109687222 CATGCCCACCTAATATTTTTTGG - Intronic
980089141 4:128423690-128423712 CAGGTCCTCCTGATTTCAGTAGG - Intergenic
981601334 4:146492061-146492083 CACGCCCAGCTAATTTTTTTTGG - Intronic
981635031 4:146867394-146867416 CAGGCCTAACTCATTTCTATTGG + Intronic
983474543 4:168197616-168197638 CATGCCCAGCTAATTTTTTTTGG - Intergenic
984285498 4:177723419-177723441 CCTGCCCACCTGCTTGCTTTTGG + Intergenic
986679463 5:10220343-10220365 CAGGGCCACCTGAATCCTTTCGG - Intergenic
987164079 5:15174995-15175017 CAGACCGACCCCATTTCTTTGGG + Intergenic
990048127 5:51459855-51459877 CAGGCCATCCTGAATTCATTTGG + Intergenic
990188915 5:53236376-53236398 TAGGCCTTCCTGAATTCTTTGGG - Intergenic
993173498 5:84451981-84452003 CATGCCCGGCTAATTTCTTTTGG - Intergenic
995064781 5:107847796-107847818 CAGGCCCACGTAATTTCACTGGG + Intergenic
995680841 5:114717792-114717814 CAGGCCCAGCTACTTTTTTTTGG - Intergenic
996887828 5:128379702-128379724 CTGGCACACGTGATTTCTCTGGG - Intronic
997329015 5:133045655-133045677 CATGCCCAGCTAATTTTTTTGGG - Intergenic
999071848 5:148751632-148751654 CAGGACTACCTGCTTTCTTCTGG + Intergenic
1000170101 5:158693987-158694009 CACGCCCAGCTAATTTTTTTTGG + Intergenic
1000564150 5:162827203-162827225 CATGGCCTCATGATTTCTTTTGG - Intergenic
1000613768 5:163405469-163405491 CATGCCCACCTAATTATTTTTGG + Intergenic
1000896200 5:166858452-166858474 CAGGCCCAGCTATTTTTTTTGGG - Intergenic
1002831010 6:820940-820962 CAAGCACACCTGAGTTCTGTAGG + Intergenic
1004313663 6:14567513-14567535 CACGCCCAGCTAATTTTTTTCGG - Intergenic
1004799961 6:19135115-19135137 GAGGCCAACCTGAGTGCTTTGGG - Intergenic
1006914862 6:37587742-37587764 CAGTCCCACCTGATTTCATGAGG - Intergenic
1007236564 6:40394641-40394663 AAGGCCCACCTGATATGGTTTGG + Intronic
1007723819 6:43902201-43902223 CAGGACCAGCTGACTTCTCTCGG - Intergenic
1007806401 6:44452634-44452656 CAGTCCTACATTATTTCTTTGGG + Intergenic
1008653331 6:53585871-53585893 CTAGCCAACCTAATTTCTTTTGG + Intronic
1008776037 6:55039006-55039028 CAGGCACACCTGAGTTCAGTTGG - Intergenic
1010956020 6:82091761-82091783 CAGGCCCACCAGAATCCTATAGG + Intergenic
1010991849 6:82488224-82488246 CAGGATTACCTGATGTCTTTAGG + Intergenic
1011228567 6:85134826-85134848 CTGGCCCTGCTGCTTTCTTTAGG - Intergenic
1013090903 6:106900106-106900128 CATGCCCAGCTAATTTCTGTAGG + Intergenic
1014156755 6:118119658-118119680 CATGCCCAGCTAATTTCTGTAGG + Intronic
1014189965 6:118484157-118484179 CACGCCCAGCTAATTTTTTTGGG - Intronic
1016720903 6:147296062-147296084 CAGGACCATCTGTTTTTTTTTGG - Intronic
1016842877 6:148542116-148542138 CAGGTACACCTGAATTCATTTGG - Intronic
1016961993 6:149682566-149682588 CATGCCCAGCTAATTTTTTTTGG + Intronic
1019646788 7:2134795-2134817 CATGCCCACCTGATTTCTGGTGG - Intronic
1020392726 7:7675829-7675851 CTGGCGGACCTGATTTGTTTGGG - Intronic
1020849609 7:13334924-13334946 CAGGCTCACGTGGCTTCTTTAGG + Intergenic
1021958411 7:25849838-25849860 CAGGCCCACATGATGTTTGTTGG + Intergenic
1028980246 7:96960343-96960365 CAGTCTCAAATGATTTCTTTTGG - Intergenic
1029481361 7:100815164-100815186 CATGCCCAGCTAATTTTTTTTGG - Intronic
1030224845 7:107138838-107138860 CATGCCCAGCTTATTTTTTTTGG + Intronic
1031114178 7:117649908-117649930 CATGGCCAACTGCTTTCTTTAGG - Intronic
1032093630 7:128925673-128925695 CAGCCCCACCAGTTTTCTTATGG + Intergenic
1036449445 8:8853013-8853035 CAGGACCTCCTGCTTCCTTTGGG - Intronic
1036539113 8:9686283-9686305 CAGACCCACCTGAGTTCGTATGG + Intronic
1038193359 8:25344102-25344124 CTGGCCAAGCTGTTTTCTTTAGG + Intronic
1038548624 8:28445699-28445721 CAGGGCCATCTGAATTCTGTAGG - Intronic
1039212304 8:35231738-35231760 CAGGCACACCTCATTTCATGGGG - Intergenic
1039853400 8:41391780-41391802 CAAGCCCAGCTAATTTTTTTTGG - Intergenic
1040399621 8:47035416-47035438 CAGGCCCACTTTATTTCCTTTGG + Intergenic
1043569810 8:81589788-81589810 CAGAGCCAGCTGTTTTCTTTGGG - Intergenic
1044722083 8:95160392-95160414 CTGGCCCACCTAATGGCTTTAGG + Intergenic
1045297552 8:100885307-100885329 CAGGCCTACCTGATTTAATGGGG - Intergenic
1047239978 8:123078115-123078137 CAATCCCACCTAATTGCTTTCGG - Intronic
1047791622 8:128209519-128209541 CATGCCCAGCTAATTTTTTTTGG + Intergenic
1047917159 8:129594564-129594586 CAGGCAGACCTGGTTTCTTCAGG + Intergenic
1048963103 8:139596331-139596353 CAGGCCCACCTAGTTTACTTAGG - Intergenic
1049058330 8:140256538-140256560 CAGGCCCACCTGCTTCCGCTTGG + Intronic
1049235188 8:141508645-141508667 GAAGCCACCCTGATTTCTTTGGG + Intergenic
1051880823 9:21838036-21838058 CAAGCCCACATGATTTATTCTGG - Intronic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1056993523 9:91432448-91432470 CAGGCCCAGCCAATTTCTTTCGG + Intergenic
1057029629 9:91765576-91765598 CAGTCCCAACTGATTTCTCATGG + Intronic
1058138434 9:101333621-101333643 CAAGCCCAGCTAATTTTTTTTGG - Intergenic
1060972139 9:127744460-127744482 CAGGCCCACCTGCTGTACTTGGG + Intronic
1187191068 X:17035524-17035546 CAGGCCCGCCCGGATTCTTTTGG + Intronic
1189019121 X:37316403-37316425 CAGGCCCACCTGATGGCTTGTGG + Intergenic
1189170398 X:38903844-38903866 CTGCCCCACCTAATGTCTTTAGG - Intergenic
1189660666 X:43294581-43294603 CAGGGAACCCTGATTTCTTTTGG - Intergenic
1189673252 X:43435051-43435073 CACCTCCACCTGATTTCCTTTGG + Intergenic
1189717539 X:43881753-43881775 CAGGCCCTCCTGATTCTTTGAGG - Intronic
1189911869 X:45818120-45818142 CATGCCCACCTGATTTTTTTAGG - Intergenic
1190196991 X:48328405-48328427 CACGCCCCGCTGATTTTTTTAGG + Intergenic
1190443845 X:50503241-50503263 CTGGCCCACTAGCTTTCTTTGGG - Intergenic
1190663724 X:52678784-52678806 CACGCCCCACTGATTTTTTTAGG + Intronic
1190675699 X:52779638-52779660 CACGCCCCACTGATTTTTTTAGG - Intronic
1196752606 X:119131272-119131294 GAGGCCCACCTGATTAGGTTAGG - Intronic
1197759120 X:130015352-130015374 CAGGCCCACCAGCGTTGTTTCGG + Exonic
1200936176 Y:8740374-8740396 GAGGCCTACATGATTTCTGTAGG - Intergenic
1201587924 Y:15581786-15581808 CATGCCCAGCTAATTTTTTTAGG + Intergenic