ID: 924645110

View in Genome Browser
Species Human (GRCh38)
Location 1:245870369-245870391
Sequence AGAAAGCGTGGGTCCGGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 104}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924645110_924645120 10 Left 924645110 1:245870369-245870391 CCGGCTCCGGACCCACGCTTTCT 0: 1
1: 0
2: 0
3: 10
4: 104
Right 924645120 1:245870402-245870424 TCAAGGGTTATTTGGGGAGTGGG No data
924645110_924645121 28 Left 924645110 1:245870369-245870391 CCGGCTCCGGACCCACGCTTTCT 0: 1
1: 0
2: 0
3: 10
4: 104
Right 924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG 0: 1
1: 0
2: 1
3: 5
4: 75
924645110_924645115 -6 Left 924645110 1:245870369-245870391 CCGGCTCCGGACCCACGCTTTCT 0: 1
1: 0
2: 0
3: 10
4: 104
Right 924645115 1:245870386-245870408 CTTTCTGACAATCGCGTCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 29
924645110_924645118 4 Left 924645110 1:245870369-245870391 CCGGCTCCGGACCCACGCTTTCT 0: 1
1: 0
2: 0
3: 10
4: 104
Right 924645118 1:245870396-245870418 ATCGCGTCAAGGGTTATTTGGGG 0: 1
1: 0
2: 0
3: 2
4: 37
924645110_924645114 -7 Left 924645110 1:245870369-245870391 CCGGCTCCGGACCCACGCTTTCT 0: 1
1: 0
2: 0
3: 10
4: 104
Right 924645114 1:245870385-245870407 GCTTTCTGACAATCGCGTCAAGG 0: 1
1: 0
2: 1
3: 0
4: 33
924645110_924645116 2 Left 924645110 1:245870369-245870391 CCGGCTCCGGACCCACGCTTTCT 0: 1
1: 0
2: 0
3: 10
4: 104
Right 924645116 1:245870394-245870416 CAATCGCGTCAAGGGTTATTTGG 0: 1
1: 0
2: 0
3: 0
4: 18
924645110_924645119 9 Left 924645110 1:245870369-245870391 CCGGCTCCGGACCCACGCTTTCT 0: 1
1: 0
2: 0
3: 10
4: 104
Right 924645119 1:245870401-245870423 GTCAAGGGTTATTTGGGGAGTGG 0: 1
1: 0
2: 3
3: 12
4: 180
924645110_924645117 3 Left 924645110 1:245870369-245870391 CCGGCTCCGGACCCACGCTTTCT 0: 1
1: 0
2: 0
3: 10
4: 104
Right 924645117 1:245870395-245870417 AATCGCGTCAAGGGTTATTTGGG 0: 1
1: 0
2: 0
3: 6
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924645110 Original CRISPR AGAAAGCGTGGGTCCGGAGC CGG (reversed) Intronic
900704112 1:4068172-4068194 AGAAACCGAGGGTCTGGAACAGG + Intergenic
901683435 1:10929629-10929651 AAAAAGGGTGGGGCCGGGGCAGG + Intergenic
904563401 1:31413347-31413369 AGAAAGTGAGGGCCCGCAGCAGG - Intronic
905337923 1:37258098-37258120 AGGAAGGGTGGGTCTGGGGCTGG + Intergenic
905403285 1:37717930-37717952 AGACAGCGTGGGTCCTGGGGGGG - Exonic
905734633 1:40316854-40316876 AGGCAGCGTGGGGCAGGAGCTGG - Intronic
913125282 1:115781570-115781592 TGAGAGCGTGAGTCAGGAGCTGG + Intergenic
915302429 1:154959245-154959267 GGAAAGCCAGGGTCCGGACCAGG + Exonic
915310579 1:155004080-155004102 GGGGAGCCTGGGTCCGGAGCAGG + Intronic
916203197 1:162290938-162290960 AAAAAGCATGGTTCCAGAGCTGG - Intronic
919974816 1:202603486-202603508 AGGATGCGTGGGGCCTGAGCTGG - Intronic
924645110 1:245870369-245870391 AGAAAGCGTGGGTCCGGAGCCGG - Intronic
1078638648 11:13075622-13075644 AGAAAGCATGGGGCTGGAGGTGG - Intergenic
1083261440 11:61525175-61525197 AGAAAGCGTGGATGCGGGGAGGG - Intronic
1084020689 11:66415703-66415725 AGAAAGCTTGGGTTGGGAGCAGG + Intergenic
1084522242 11:69670755-69670777 AGCAAGCGCGGGACCTGAGCTGG - Intronic
1089454703 11:118619207-118619229 AGACAGCCTGGGCCCTGAGCTGG - Intronic
1089691926 11:120192320-120192342 TGGCAGCGTGGGTCAGGAGCTGG - Intergenic
1096706421 12:53424982-53425004 GGAAAGCGTGGGGCGGGAGTAGG - Intronic
1099738624 12:86601744-86601766 AGAAGTGGTGGGGCCGGAGCGGG + Intronic
1101551480 12:105766492-105766514 AGGAAGCCTGGGTCCTGAGAAGG - Intergenic
1103180518 12:118907315-118907337 AGAAAGAGTGGCTTGGGAGCAGG - Intergenic
1104439339 12:128782108-128782130 AGAAAGAGAAGTTCCGGAGCTGG - Intergenic
1104709383 12:130974806-130974828 CGGGAGCGGGGGTCCGGAGCAGG - Intronic
1106107227 13:26743171-26743193 AGAAAGGGTGGGTGTGGAGAAGG - Intergenic
1112450292 13:99501693-99501715 AGAAAGCGCCGCTCCGGCGCGGG - Exonic
1112656088 13:101453809-101453831 AGGAAACGTGGGTTCGGAGCAGG + Intronic
1113130772 13:107034656-107034678 AGACAGCGTGGGGCCTGATCCGG - Intergenic
1113793359 13:113042249-113042271 AGAAGGTGTGGGTCCTGGGCAGG - Intronic
1119638583 14:76296658-76296680 GGAAAACGTAGGTCTGGAGCTGG + Intergenic
1121333322 14:93061479-93061501 AGAGAGAGTGGGTCTGGGGCAGG + Intronic
1121719049 14:96096613-96096635 AGTAAGTGTGGGGCTGGAGCGGG + Intergenic
1122342027 14:101034728-101034750 AGAAAGAGTGGGGCGGGGGCTGG - Intergenic
1122480087 14:102041599-102041621 GGAAAGCCTGGATCAGGAGCAGG - Exonic
1122881355 14:104691858-104691880 AGACAGCCTGGGTCCTGAGCTGG + Intronic
1123690864 15:22837621-22837643 GGAAAGGGTGGGTCCAAAGCTGG - Intergenic
1125712313 15:41796812-41796834 AGAAAGAGATGGTCCGTAGCAGG + Intronic
1126318738 15:47398880-47398902 AGGAAGTGTGGCTCCTGAGCCGG - Intronic
1127706479 15:61552154-61552176 AGAAAGCATTGGTCAGGAGTAGG + Intergenic
1128651198 15:69414720-69414742 AGGAAGGGTCGGCCCGGAGCCGG + Intronic
1129669131 15:77597454-77597476 AGAGAACAGGGGTCCGGAGCAGG - Intergenic
1130225686 15:82056636-82056658 ACAAAGCATGGGCCCAGAGCAGG + Intergenic
1131517465 15:93088897-93088919 GGTAAGCGCGGGTCGGGAGCCGG - Intronic
1131854773 15:96581944-96581966 AGAAAGGGAGGGGCCGTAGCAGG - Intergenic
1132114139 15:99123648-99123670 AGAAAGGGAGGCTCCGGAGCTGG - Intronic
1132949727 16:2554425-2554447 TGACAGCGTGGGTCTGGAGCCGG + Intronic
1132964621 16:2645742-2645764 TGACAGCGTGGGTCTGGAGCCGG - Intergenic
1133870379 16:9680347-9680369 AGAGAGAGGGGGTCCCGAGCCGG - Intergenic
1134063557 16:11212963-11212985 AGAAAGCGTGAGTCATGAGCAGG + Intergenic
1137399425 16:48141304-48141326 AGCAAGGGTGGGTCCTGAGAAGG - Exonic
1142888100 17:2925819-2925841 AGTCAGCGTGGGTCCGGGCCGGG + Intronic
1147176424 17:38658842-38658864 AGGAAGGGAGGGTCCGGAGGAGG + Intergenic
1148323849 17:46772106-46772128 TGCAAACGTGGGGCCGGAGCTGG + Intronic
1149703053 17:58671552-58671574 ACAAAGCTTGGGGCCTGAGCTGG - Intronic
1151953668 17:77369871-77369893 ACAAAGCGTGGGAACGGAGTGGG - Intronic
1155314992 18:24562716-24562738 TGAAAACGTGGGTCAGGAGGAGG + Intergenic
1157574347 18:48733610-48733632 AGACAGTGTGGGTGCTGAGCTGG + Intronic
1161283738 19:3458597-3458619 AGAAAGGGTGGGACCAGGGCTGG + Intronic
1161438635 19:4278748-4278770 AGGAAGGGTGGGTGCGGATCGGG - Exonic
1163433522 19:17282215-17282237 ATAGAGCCTGGGTCCGGGGCGGG + Intronic
1163509019 19:17724454-17724476 GGACAGCGTGGGTCTGGAGGTGG + Intronic
1164534708 19:29076495-29076517 AGAAAGCTTGGTTCTAGAGCAGG - Intergenic
1166437215 19:42777701-42777723 AGAAACCGTGGGTCAGCAGATGG + Intronic
930621986 2:53653131-53653153 AGAAAGAGGGGCTCCGGAGTGGG + Intronic
934758218 2:96839273-96839295 AGAAAGCGCGGGTCCAGATGAGG - Exonic
935270768 2:101432537-101432559 AGGGAGCGTGAGGCCGGAGCAGG + Intronic
944206729 2:197164659-197164681 AGAAAGCGGACGTCCGGGGCAGG - Intronic
946805782 2:223470158-223470180 AGAAAGAATAGGTCTGGAGCAGG + Intergenic
1174426671 20:50436511-50436533 AGACTGCCTGGCTCCGGAGCTGG + Intergenic
1181430317 22:22877538-22877560 AGACAGCTTGGTTCCTGAGCTGG + Intronic
1181531282 22:23518941-23518963 ACAAAGCCTGGGACGGGAGCGGG + Intergenic
1182704303 22:32266301-32266323 AGAAAGCTTGGATCCGGACCAGG + Intergenic
1184851006 22:47120587-47120609 AGAAGGCCTGGGGCTGGAGCAGG + Intronic
950442424 3:13017952-13017974 AGAAGGCGTGGGTGGGGAGGAGG + Intronic
952174098 3:30843071-30843093 AAAAAGCCTGGCTCCTGAGCTGG - Intronic
953975143 3:47376682-47376704 AGAAAGGGTGACTCCGGGGCAGG - Intergenic
954637276 3:52077857-52077879 AGAAAACGTGGGTGAGGTGCTGG + Intronic
954652167 3:52171865-52171887 AGAAAGGGTGGTTCGGGTGCAGG + Intergenic
954800258 3:53183206-53183228 AGTGAGCCTGGGTCCGGGGCAGG + Exonic
959539850 3:107525181-107525203 AGAGCGCGTGGGGCCGGACCCGG - Intronic
966890354 3:184403019-184403041 GGAAATCGTGGGTACGGAGAGGG + Intronic
968819910 4:2843135-2843157 AGAAAGCTTAGGTCCAGAGCTGG - Intergenic
968883776 4:3316259-3316281 CGAAAGCGTGAATCCGTAGCCGG - Exonic
972454625 4:39241504-39241526 AAAAAAAGTGGGTCCGGGGCCGG + Intronic
977043826 4:92045194-92045216 AGAAAGCATGGGTCAGGCACAGG - Intergenic
977233580 4:94480566-94480588 AGAAGGCATGGGTCTGGAGCTGG + Intronic
980481067 4:133387952-133387974 AGCAAGCTTGGGCCCAGAGCAGG + Intergenic
985553776 5:546297-546319 AGAAAGCTTGGGGCTGGAACAGG - Intergenic
997348332 5:133210224-133210246 ACCAAGTGTGGGTCCTGAGCTGG - Exonic
1002415645 5:179119622-179119644 GGAAAGCCTGGGTCGGGAGAGGG - Intronic
1006173811 6:32109937-32109959 AGAAATGGTGGGACTGGAGCAGG - Intronic
1006756806 6:36423373-36423395 AGAAAGCCTAGGGCGGGAGCGGG - Intronic
1011751686 6:90460717-90460739 AGTAAGAGGGGATCCGGAGCAGG - Intergenic
1017925445 6:158908262-158908284 AGATAGAGGGGGTCCTGAGCGGG - Intronic
1023278828 7:38548659-38548681 AGAGAGAGGGGGTCCCGAGCAGG + Intronic
1024537734 7:50451646-50451668 AGAAAGAGAGGGTCTGGGGCAGG + Intronic
1025851920 7:65251139-65251161 AGAAAGCGTAGGGCAGGAGGAGG - Intergenic
1026932139 7:74229144-74229166 ACAAAGCCTGGGTCGGGAGAGGG - Exonic
1030039793 7:105439396-105439418 AGAAGACGTGGGTGGGGAGCAGG - Intergenic
1030040769 7:105447868-105447890 AGAAAGCTGAGGTCCGGAGGAGG + Intronic
1034319337 7:150165109-150165131 AGAAAGTTTCGGTCAGGAGCAGG - Intergenic
1034569549 7:151944304-151944326 TCAAAGCGTGGGCCCGGGGCTGG - Intergenic
1034773424 7:153802100-153802122 AGAAAGTTTCGGTCAGGAGCAGG + Intergenic
1040105968 8:43542148-43542170 AGAAAGTGTAGGTCCAGACCAGG - Intergenic
1041008302 8:53516931-53516953 AGAAAGCCTGGGACCGTAGAAGG + Intergenic
1043314647 8:78905412-78905434 AGGCAGCTTGGGTCTGGAGCTGG - Intergenic
1047330877 8:123885736-123885758 AGAAAGCCTGGGCCAGGGGCGGG + Intronic
1047735280 8:127759746-127759768 AGCAAGGGTGGGTGGGGAGCAGG - Intergenic
1053314228 9:37037851-37037873 CGAAAGCCTGTGGCCGGAGCTGG + Intergenic
1056310868 9:85339655-85339677 AGACAGCGAGAGTCCAGAGCTGG + Intergenic
1056617254 9:88179144-88179166 AGGAAGCGTGGCTGTGGAGCGGG + Intergenic
1057950911 9:99368565-99368587 AGGAAGCGTGCGTCAGCAGCGGG + Intergenic
1060547239 9:124468679-124468701 AGAGAGTGTGGGTGCAGAGCAGG - Intronic
1198115146 X:133537470-133537492 AGAAAGCGTGGGGACTCAGCTGG + Intronic
1198171182 X:134106572-134106594 AGAAAGCGTTGGGCGGGAGATGG - Intergenic