ID: 924645111

View in Genome Browser
Species Human (GRCh38)
Location 1:245870375-245870397
Sequence ATTGTCAGAAAGCGTGGGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924645111_924645119 3 Left 924645111 1:245870375-245870397 CCGGACCCACGCTTTCTGACAAT 0: 1
1: 0
2: 0
3: 6
4: 101
Right 924645119 1:245870401-245870423 GTCAAGGGTTATTTGGGGAGTGG 0: 1
1: 0
2: 3
3: 12
4: 180
924645111_924645118 -2 Left 924645111 1:245870375-245870397 CCGGACCCACGCTTTCTGACAAT 0: 1
1: 0
2: 0
3: 6
4: 101
Right 924645118 1:245870396-245870418 ATCGCGTCAAGGGTTATTTGGGG 0: 1
1: 0
2: 0
3: 2
4: 37
924645111_924645121 22 Left 924645111 1:245870375-245870397 CCGGACCCACGCTTTCTGACAAT 0: 1
1: 0
2: 0
3: 6
4: 101
Right 924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG 0: 1
1: 0
2: 1
3: 5
4: 75
924645111_924645120 4 Left 924645111 1:245870375-245870397 CCGGACCCACGCTTTCTGACAAT 0: 1
1: 0
2: 0
3: 6
4: 101
Right 924645120 1:245870402-245870424 TCAAGGGTTATTTGGGGAGTGGG No data
924645111_924645117 -3 Left 924645111 1:245870375-245870397 CCGGACCCACGCTTTCTGACAAT 0: 1
1: 0
2: 0
3: 6
4: 101
Right 924645117 1:245870395-245870417 AATCGCGTCAAGGGTTATTTGGG 0: 1
1: 0
2: 0
3: 6
4: 41
924645111_924645116 -4 Left 924645111 1:245870375-245870397 CCGGACCCACGCTTTCTGACAAT 0: 1
1: 0
2: 0
3: 6
4: 101
Right 924645116 1:245870394-245870416 CAATCGCGTCAAGGGTTATTTGG 0: 1
1: 0
2: 0
3: 0
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924645111 Original CRISPR ATTGTCAGAAAGCGTGGGTC CGG (reversed) Intronic
901683324 1:10929053-10929075 ATTGTCAGGAAGCCTGGCTCTGG + Intergenic
904719069 1:32492871-32492893 ACTCTGAGAACGCGTGGGTCGGG + Exonic
906060390 1:42944616-42944638 ATTCTCTGAAAGCGTCAGTCAGG + Intronic
910935907 1:92484578-92484600 ATTAGCAGAGAGCGGGGGTCGGG + Intronic
924645111 1:245870375-245870397 ATTGTCAGAAAGCGTGGGTCCGG - Intronic
1064708941 10:18103293-18103315 ATTGACAGGAAACCTGGGTCAGG - Intergenic
1066815293 10:39400890-39400912 ATTCTCAGAAAGCCTCTGTCTGG - Intergenic
1078964906 11:16327758-16327780 AGAGTCAGAAAGCATAGGTCAGG + Intronic
1082600306 11:55142345-55142367 TTTGTCAGAAAGCATCTGTCTGG + Intergenic
1093121708 12:15278938-15278960 ATTGCCAAAATGCGTGAGTCTGG + Intronic
1095067407 12:37795306-37795328 TTTGTCAGAAAGCTTCTGTCTGG - Intergenic
1096956058 12:55527432-55527454 ATAGCCAGAATGCATGGGTCTGG + Intergenic
1096971547 12:55670452-55670474 CTGGTCAGCAAGCATGGGTCAGG - Intergenic
1101325456 12:103711688-103711710 CTTGTTAGAAAGCCTGGATCTGG - Intronic
1101802436 12:108034046-108034068 ATTGTCAGGAATCGGGGGTAAGG - Intergenic
1103191053 12:119002498-119002520 GTTGTCAGAAACCTGGGGTCTGG + Intronic
1104109338 12:125690242-125690264 ATTGTTTGGGAGCGTGGGTCGGG + Intergenic
1107823880 13:44310235-44310257 AGTGGCAGAAAGCGTGGATCAGG - Intergenic
1108069843 13:46617151-46617173 ACTGTCAGATAGCCTGTGTCAGG + Intronic
1110195799 13:72787012-72787034 AATGTGAGAAAGTGTGAGTCTGG + Intronic
1121333319 14:93061473-93061495 ATGGGCAGAGAGAGTGGGTCTGG + Intronic
1123227215 15:17051602-17051624 TTTCTCAGAAAGTTTGGGTCTGG - Intergenic
1128153899 15:65379904-65379926 ATTGTGAGAAAGGGTGGGAGTGG + Intergenic
1128503688 15:68249644-68249666 ATTGACAGTAAGGGTGGGTGAGG + Intronic
1132949726 16:2554419-2554441 GATGTCTGACAGCGTGGGTCTGG + Intronic
1132964622 16:2645748-2645770 GATGTCTGACAGCGTGGGTCTGG - Intergenic
1134810300 16:17161401-17161423 ATTGTCTGGAAGGGTGGGGCGGG + Intronic
1137076791 16:35975861-35975883 TTTGTCAGAAAGCTTCTGTCTGG + Intergenic
1138021723 16:53489496-53489518 AATGTCAGAAAGACTGGGGCTGG - Intronic
1138570635 16:57869807-57869829 ATTATAAGAAAGGGTGGGCCAGG + Intergenic
1143593631 17:7901029-7901051 ATTCTCAGAAAACATGGGTGGGG + Intronic
1143818127 17:9536531-9536553 ATCGTCAGTCAGAGTGGGTCAGG + Intronic
1146329632 17:31917012-31917034 TTTGTCAGAGAGCGAGGGTCGGG + Intergenic
1152412705 17:80137054-80137076 GTGGTCAGAAAGCGTGGATTGGG - Intronic
1153600199 18:6773595-6773617 ATGGTCAGAAGGCAAGGGTCTGG - Intronic
1155829077 18:30489308-30489330 ATTATTAGAAAGAGAGGGTCGGG - Intergenic
1156048155 18:32900461-32900483 ACAGTCAGAAAGCGTGGGAGTGG - Intergenic
1164352032 19:27359853-27359875 TTTGTCAGAAAGCTTCTGTCTGG + Intergenic
926714111 2:15910407-15910429 ATTGACAGAAAGCCTGGGAATGG + Intergenic
929346532 2:40890678-40890700 AATGGCAGATTGCGTGGGTCTGG - Intergenic
936144929 2:109974528-109974550 ATTGTCATAAAGCATGGGGTTGG - Intergenic
936181615 2:110272491-110272513 ATTGTCATAAAGCATGGGGTTGG - Intergenic
936199757 2:110396939-110396961 ATTGTCATAAAGCATGGGGTTGG + Intergenic
936230951 2:110699189-110699211 ATTGTCATAAAGCATGGGGTTGG + Intergenic
948548203 2:238747266-238747288 CTTGTGGGAAAGCGTGGGGCTGG - Intergenic
1168945155 20:1748298-1748320 ATTCTCAGAAAGGTTGGGTCGGG + Intergenic
1169447609 20:5685601-5685623 ATTTTCAGCAAGCTTGGCTCAGG - Intergenic
1170006307 20:11673261-11673283 ATAGTAAGAAAGCGTATGTCTGG + Intergenic
1171763952 20:29240431-29240453 TTTCTCAGAAAGCTTTGGTCTGG + Intergenic
1171825067 20:29890592-29890614 ATTGTCAGAATGCATCTGTCTGG - Intergenic
1178205923 21:30464957-30464979 ATTGCCAGAAAGCATGCATCAGG - Intergenic
1180750478 22:18121058-18121080 AATGTCAGAAAGTCAGGGTCAGG + Intronic
1182141743 22:27965487-27965509 ATTTACATAAAGGGTGGGTCTGG - Intergenic
1182938975 22:34255462-34255484 ATTCTCAGAAGGGGTGGGGCGGG - Intergenic
1182990014 22:34758554-34758576 ATTGTCAGACAGCCTGGGCTTGG - Intergenic
1184937261 22:47734319-47734341 TTAGCCAGAAAACGTGGGTCTGG - Intergenic
950430465 3:12947998-12948020 CTTGGCAGAAAGCCTGGGTGGGG - Intronic
954521561 3:51231417-51231439 AATGTCAAAAAGCCTGGGTGTGG - Intronic
954981529 3:54750418-54750440 TTTATGAGAAAGCATGGGTCTGG + Intronic
960005996 3:112781799-112781821 CTTGGCAGAAAGGGTGAGTCAGG - Intronic
960763151 3:121096106-121096128 ATTGTCAGACAGTGGGGGGCAGG - Intronic
960938264 3:122916600-122916622 GTGGTCAGAAAGCTTAGGTCTGG - Intronic
964606816 3:158569319-158569341 AATGAAAGAAAGCGTGGGTCAGG - Intergenic
967156237 3:186695071-186695093 ATAGTCAGAAAATGTGGGACTGG + Intergenic
967966032 3:194960872-194960894 ATCCTCAGAAACCCTGGGTCTGG - Intergenic
969883575 4:10195793-10195815 ATTGCAAGAAAGAGTGGGGCGGG + Intergenic
970215335 4:13752878-13752900 AGAGACAGAAGGCGTGGGTCAGG + Intergenic
974140429 4:57879791-57879813 ATTGTCAGAAGCCATGGGTCTGG - Intergenic
977627726 4:99205762-99205784 ATTGCTAGAAAGGGTGGGTGTGG + Intronic
978625421 4:110679834-110679856 AATGCCAGAAAGGGGGGGTCGGG - Intergenic
979436984 4:120704764-120704786 ATTGGCAGAAGGCCTGGATCTGG + Intronic
980195711 4:129585815-129585837 AATGTCAGAAAGTGTGTGTGTGG + Intergenic
981808988 4:148751644-148751666 ATTCTCATGAAGCGTGGGGCTGG + Intergenic
982704237 4:158689689-158689711 ATTGTAAGAAAGCATGGGCATGG - Intronic
985608801 5:874499-874521 TTTATCAGACAGCGAGGGTCAGG + Intronic
988039267 5:25868021-25868043 ATTTTCAGAAAGTGTTTGTCTGG + Intergenic
989842139 5:46090175-46090197 TTTCTCAGAAAGCTTGTGTCTGG - Intergenic
991412435 5:66358247-66358269 ATTCTGAGAAAGTGTGGGTGAGG + Intergenic
992269302 5:75050065-75050087 AATGTCAGGAAGCTTGGGCCTGG + Intergenic
992997966 5:82350876-82350898 TTTGAGAGACAGCGTGGGTCAGG - Intronic
1002660942 5:180790880-180790902 ATTTTCAGAAAGGAGGGGTCAGG + Exonic
1002797358 6:485014-485036 ATTGTCAGAAACCATCTGTCAGG - Intergenic
1003052906 6:2796196-2796218 ACTGGCTGAAAGCGTGGGGCTGG - Intergenic
1003560275 6:7174086-7174108 TGTGACAGAAAGCCTGGGTCTGG - Intronic
1005101975 6:22181324-22181346 ATTTACAGAAAGCGTGGTGCTGG + Intergenic
1009259790 6:61470646-61470668 ATTCTCAGAAAGCTTCTGTCTGG - Intergenic
1023381035 7:39608917-39608939 ATTGTCAGAAATACTGAGTCAGG + Intronic
1025308941 7:57901899-57901921 ATTGTCAGAATGCTTCTGTCTGG - Intergenic
1025502164 7:61316000-61316022 TTTGTCAGAAAGCTTCTGTCTGG + Intergenic
1025517029 7:61662222-61662244 TTTGTCAGAAAGCTTCTGTCTGG + Intergenic
1025541366 7:62091046-62091068 TTTGTCAGAAAGCTTCTGTCTGG + Intergenic
1029311992 7:99675989-99676011 ATTTTCAGAAATGGTGGGACTGG - Intronic
1030934430 7:115567596-115567618 ATTGTCAGAAAGAGTGAGAGGGG - Intergenic
1031092542 7:117377243-117377265 AAGGTCAGAAATGGTGGGTCAGG + Intronic
1032068436 7:128790149-128790171 ATTGTCTGAAAGGGGGTGTCAGG + Intergenic
1035623188 8:1050778-1050800 ATTCTCAGAAACCTTGAGTCAGG + Intergenic
1039078174 8:33711050-33711072 ATTTTCAGACACCGTGTGTCTGG - Intergenic
1041766715 8:61426556-61426578 ACTGTCAGAAAATGGGGGTCAGG - Intronic
1042506034 8:69561797-69561819 GTTCTCACAAAGCATGGGTCAGG - Intronic
1051923832 9:22299295-22299317 GTTGTCTGAGAGCTTGGGTCTGG + Intergenic
1054363198 9:64199538-64199560 ATTCTCAGAAAGCTTCTGTCTGG - Intergenic
1056930598 9:90873415-90873437 TTTGGAAGAAAGGGTGGGTCAGG + Intronic
1203357008 Un_KI270442v1:162468-162490 ATTGTCAGAATGCATCTGTCTGG + Intergenic
1203359432 Un_KI270442v1:200396-200418 TTTCTCAGAAAGCTTCGGTCTGG + Intergenic
1186161609 X:6782600-6782622 ATTGTCAGAAATCGTAGATGTGG - Intergenic
1187489723 X:19739711-19739733 AATGTGAGAAGCCGTGGGTCTGG + Intronic
1191232592 X:58107736-58107758 ATTGTTAGAATGCCTGGGTTTGG - Intergenic
1191241520 X:58193782-58193804 CTTGTTAGAAAGCCTGGGTTGGG - Intergenic