ID: 924645113

View in Genome Browser
Species Human (GRCh38)
Location 1:245870381-245870403
Sequence GACGCGATTGTCAGAAAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924645113_924645117 -9 Left 924645113 1:245870381-245870403 CCACGCTTTCTGACAATCGCGTC No data
Right 924645117 1:245870395-245870417 AATCGCGTCAAGGGTTATTTGGG 0: 1
1: 0
2: 0
3: 6
4: 41
924645113_924645118 -8 Left 924645113 1:245870381-245870403 CCACGCTTTCTGACAATCGCGTC No data
Right 924645118 1:245870396-245870418 ATCGCGTCAAGGGTTATTTGGGG 0: 1
1: 0
2: 0
3: 2
4: 37
924645113_924645119 -3 Left 924645113 1:245870381-245870403 CCACGCTTTCTGACAATCGCGTC No data
Right 924645119 1:245870401-245870423 GTCAAGGGTTATTTGGGGAGTGG 0: 1
1: 0
2: 3
3: 12
4: 180
924645113_924645120 -2 Left 924645113 1:245870381-245870403 CCACGCTTTCTGACAATCGCGTC No data
Right 924645120 1:245870402-245870424 TCAAGGGTTATTTGGGGAGTGGG No data
924645113_924645116 -10 Left 924645113 1:245870381-245870403 CCACGCTTTCTGACAATCGCGTC No data
Right 924645116 1:245870394-245870416 CAATCGCGTCAAGGGTTATTTGG 0: 1
1: 0
2: 0
3: 0
4: 18
924645113_924645121 16 Left 924645113 1:245870381-245870403 CCACGCTTTCTGACAATCGCGTC No data
Right 924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG 0: 1
1: 0
2: 1
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924645113 Original CRISPR GACGCGATTGTCAGAAAGCG TGG (reversed) Intronic
No off target data available for this crispr