ID: 924645121

View in Genome Browser
Species Human (GRCh38)
Location 1:245870420-245870442
Sequence GTGGGCTCGCTTACCTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924645113_924645121 16 Left 924645113 1:245870381-245870403 CCACGCTTTCTGACAATCGCGTC No data
Right 924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG 0: 1
1: 0
2: 1
3: 5
4: 75
924645112_924645121 17 Left 924645112 1:245870380-245870402 CCCACGCTTTCTGACAATCGCGT 0: 1
1: 0
2: 0
3: 0
4: 10
Right 924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG 0: 1
1: 0
2: 1
3: 5
4: 75
924645111_924645121 22 Left 924645111 1:245870375-245870397 CCGGACCCACGCTTTCTGACAAT 0: 1
1: 0
2: 0
3: 6
4: 101
Right 924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG 0: 1
1: 0
2: 1
3: 5
4: 75
924645110_924645121 28 Left 924645110 1:245870369-245870391 CCGGCTCCGGACCCACGCTTTCT 0: 1
1: 0
2: 0
3: 10
4: 104
Right 924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG 0: 1
1: 0
2: 1
3: 5
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924645121 Original CRISPR GTGGGCTCGCTTACCTCTCC TGG Intronic
901079417 1:6575384-6575406 GTGGGCTCTCTTACCTGCCAGGG - Exonic
904502145 1:30919660-30919682 GTGGGCTTGCTCAGTTCTCCAGG + Intergenic
905714154 1:40133520-40133542 GTAGGCTCGCTCATCTCGCCTGG + Intergenic
906320168 1:44810690-44810712 GTGGGCACACGTTCCTCTCCAGG - Intronic
915981223 1:160420989-160421011 GTGGCCTCTCTTCCCACTCCAGG - Intronic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1067196398 10:44123254-44123276 GTGGGCCTGCCTCCCTCTCCAGG - Intergenic
1071454660 10:85836792-85836814 CTTGGCCTGCTTACCTCTCCTGG + Intronic
1076793591 10:132788556-132788578 GTGGCATCGCGGACCTCTCCAGG - Intergenic
1080823997 11:35832601-35832623 GAGAGCTCCCTTACCTCTTCTGG + Intergenic
1084973268 11:72782641-72782663 CTGGGCTCTCTTACCTCCCCAGG + Intronic
1085789729 11:79486620-79486642 GTGGGCTCACTCTCTTCTCCAGG + Intergenic
1089302953 11:117509582-117509604 CTGGGCTCTCTTCCCCCTCCAGG - Intronic
1105946745 13:25196887-25196909 GTGGGTTCGCTCCCCACTCCAGG + Intergenic
1108057465 13:46498904-46498926 GTGGCCTTGCACACCTCTCCAGG - Intergenic
1108201888 13:48052533-48052555 GTGGTCTGGTTTACCTCTCTTGG - Intergenic
1118265788 14:64294128-64294150 GTGCGCTCGCTTTCCTCAACAGG - Exonic
1119858429 14:77918612-77918634 GGGGGCTGGCTTCCCTCTTCTGG + Intronic
1121280096 14:92691881-92691903 GAGGGCTCCCTGGCCTCTCCTGG + Intergenic
1127850777 15:62910148-62910170 GTGGGATCACTTACCTCTCTGGG - Intergenic
1133417803 16:5619852-5619874 GGGGGCTCACTTCCTTCTCCTGG + Intergenic
1139674378 16:68513025-68513047 TTGGACTGGCTTAGCTCTCCTGG - Intergenic
1142144480 16:88487197-88487219 GTGAGCATGCTGACCTCTCCTGG - Intronic
1144755473 17:17677934-17677956 GTGGGCTGGGCTAGCTCTCCTGG - Intergenic
1146017542 17:29245895-29245917 GGGGGGTCTCTTTCCTCTCCTGG + Intergenic
1148832189 17:50440835-50440857 GTGAGCCAGCTCACCTCTCCTGG - Intronic
1153469526 18:5428299-5428321 GTGGGTATACTTACCTCTCCCGG + Exonic
1163795154 19:19333748-19333770 GTCGCCTTGCTTACCTCTGCTGG + Intronic
1167757554 19:51421917-51421939 GTGGGCTCTCCATCCTCTCCAGG - Intergenic
937699497 2:124847627-124847649 GTGGGTTCTCTTAGCTTTCCTGG + Intronic
938080013 2:128364853-128364875 GTGGGCTCCCTTGCCTTTGCTGG + Intergenic
948280149 2:236740753-236740775 CTGGTCTCCCTAACCTCTCCAGG - Intergenic
948505449 2:238424596-238424618 GTGGGCTGTCTTGCCCCTCCAGG - Intergenic
948531062 2:238605995-238606017 GTGGGCTCTCTTGGCTTTCCTGG - Intergenic
948965053 2:241372748-241372770 CTGGGCTCTCTTGCCTCTGCTGG + Intronic
949007729 2:241659345-241659367 GTGGCCTCGCTCTCCTATCCCGG + Intronic
1168831261 20:846427-846449 GTGGGTTCTCATAACTCTCCTGG + Intronic
1170753120 20:19170276-19170298 ATGGGCTGGCTTTTCTCTCCAGG + Intergenic
1178521163 21:33289448-33289470 GAGGGCCCGCTCTCCTCTCCCGG + Intronic
1178953793 21:37006294-37006316 CGGGCCTCGCTTTCCTCTCCCGG + Intronic
1182079077 22:27516410-27516432 CTGGGCTGGCTTACATTTCCAGG - Intergenic
1182457580 22:30461713-30461735 ATGGGCTTGCTTCCGTCTCCTGG + Intronic
1182709214 22:32310189-32310211 GTGGCCTTGCCTCCCTCTCCTGG - Intergenic
1184396811 22:44247124-44247146 GTGGCCTTGCCTCCCTCTCCTGG - Exonic
1185254160 22:49822937-49822959 TTGGACACGCTTACCTCTGCGGG + Exonic
950134058 3:10568194-10568216 GACAGCTCGCTTACCTCTGCCGG + Intronic
953428126 3:42812578-42812600 GTTTGCTTGCTTACCTCTCCAGG + Intronic
953481615 3:43256956-43256978 GTGGCCTTGCTGACCTCTTCAGG - Intergenic
955348090 3:58175612-58175634 TTGGACTCGCTTATCTCCCCGGG + Intergenic
967078031 3:186022280-186022302 TTGGGTTCGCTGACCTCTCTAGG - Intergenic
968900472 4:3429147-3429169 GTGGGCTTGCTGAGCTCTCTTGG + Intronic
972344420 4:38180929-38180951 ATGGGTTTGCTTACTTCTCCAGG - Intergenic
973316101 4:48762015-48762037 GTTAGCTCTCTTGCCTCTCCTGG - Intronic
979600411 4:122581234-122581256 GTGGGGTCACTTTCCTATCCAGG + Intergenic
983939046 4:173522797-173522819 GTGGGATTGGTTTCCTCTCCCGG + Intergenic
986057582 5:4154007-4154029 AGGGGCTCTCTTAGCTCTCCGGG - Intergenic
988595232 5:32585035-32585057 GTGAACTCCCTTACATCTCCAGG + Intronic
990825826 5:59896432-59896454 GTGTGCTGGATTAGCTCTCCTGG - Intronic
990902763 5:60771081-60771103 ATGGGCCCACTGACCTCTCCTGG - Intronic
993885794 5:93413431-93413453 GTGGGCTCTCTCATCTCTTCAGG + Intergenic
1002344532 5:178538190-178538212 GAGGGCTCGTTTACCGCTCAGGG + Intronic
1002451269 5:179320126-179320148 GTGGCCTCCCTTCCCTCACCAGG - Intronic
1003624022 6:7726823-7726845 GCGGGCTCGCTTCCCCTTCCTGG - Exonic
1005990284 6:30897998-30898020 GTGGGCTCTCTCTCCTCTCCTGG + Intronic
1006941575 6:37755129-37755151 GTGGGGTTGTTTTCCTCTCCTGG + Intergenic
1014403184 6:121015948-121015970 GTGGCCTCGCTTATCATTCCTGG - Intergenic
1015816896 6:137219959-137219981 GTCTGCTCTCTTACCTCTCTGGG + Intergenic
1022132760 7:27419083-27419105 GAGGGCTTGCTTACGGCTCCTGG - Intergenic
1027483898 7:78734842-78734864 GTGGTTTCGCTGATCTCTCCTGG - Intronic
1029371496 7:100153816-100153838 CTGTGCTCCCTTCCCTCTCCTGG + Intronic
1034259934 7:149748700-149748722 TTGGGCTGGGTTCCCTCTCCTGG + Intergenic
1040979447 8:53230758-53230780 GTGTGCTCGCTGACTTCTCAGGG - Intronic
1041870469 8:62628219-62628241 GTGGGCCCGCTTTCCTCTCCAGG - Intronic
1048544581 8:135374582-135374604 CTGGGCTCGCTCCCCTCACCAGG + Intergenic
1057140349 9:92722944-92722966 CTGGGCTCCCTCTCCTCTCCAGG - Intronic
1062056894 9:134473503-134473525 GTGGGCTCCCTCACCTGGCCTGG + Intergenic
1187095045 X:16139303-16139325 GTGGACTCGCTTTCCTTTTCAGG + Intronic
1192786845 X:74344530-74344552 GTGGGCTGGCTGATCTTTCCTGG - Intergenic
1194380863 X:93190509-93190531 GTGGGTTCTCTTAGCTTTCCTGG - Intergenic
1196061434 X:111411823-111411845 GTGGGGTCTCTTACCACTGCAGG - Intronic
1198223204 X:134621923-134621945 GTGGGCTGGCTTCCATCTCCAGG - Intronic
1198565275 X:137897611-137897633 GTGCCCTTTCTTACCTCTCCTGG - Intergenic