ID: 924645133

View in Genome Browser
Species Human (GRCh38)
Location 1:245870497-245870519
Sequence ATGCAGGGATAGATGGAGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 454
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 428}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924645133 Original CRISPR ATGCAGGGATAGATGGAGCG AGG (reversed) Intronic
901006632 1:6174885-6174907 ATGGATGGATAGATGGTGGGTGG + Intronic
901928582 1:12582891-12582913 ATGCATGGATGGATGGAGTAGGG - Intronic
901928769 1:12583647-12583669 ATGGATGGATGGATGGAGTGGGG - Intronic
902335747 1:15753698-15753720 ATGCTGGGATAGATGCTGCTGGG + Intergenic
902689530 1:18101585-18101607 AGGCATGGATAGATGAACCGAGG - Intergenic
902724650 1:18326718-18326740 AGGGAGGGACAGATGGAGGGAGG - Intronic
903341661 1:22658744-22658766 ATGGATGGATAGATGGACAGAGG + Intronic
903341677 1:22658796-22658818 ATGGATGGATGGATGGAGGGTGG + Intronic
903341688 1:22658843-22658865 ATGCAGGGATGGAAGGATGGAGG + Intronic
903546703 1:24128606-24128628 AAGGAGGGATAGTGGGAGCGTGG - Intronic
903565977 1:24266178-24266200 ATGGATGGATAGAGGGAGGGTGG + Intergenic
904042640 1:27593341-27593363 CTGCAGGGAGAGAGGGAGAGAGG - Intronic
904438956 1:30517403-30517425 ATGCAGGGACAGGTGGGGTGGGG - Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905791584 1:40792410-40792432 TAGCAGGGATATATGGAGAGAGG - Intronic
905891252 1:41519845-41519867 ATGGAAGGATAGATGGAGAATGG + Intronic
906282699 1:44565284-44565306 ATGCAGGGAGGGAGGGAGGGAGG + Intronic
906659380 1:47571712-47571734 AAGGAGGGAGAGATGGAGGGAGG - Intergenic
906794769 1:48688126-48688148 ATGAAGGGAGAGAAGGAGGGAGG + Intronic
908824128 1:68117078-68117100 AAGCAGGGATAGAGGGAGGGAGG - Intronic
911090600 1:94014206-94014228 ATGGAGGGAGGGATGGAGGGAGG + Intronic
911301249 1:96177294-96177316 AGGCAGGGAGGGATGGAGGGAGG + Intergenic
912543789 1:110436552-110436574 CTCCAGGCATAGTTGGAGCGTGG - Intergenic
912651222 1:111441320-111441342 AAGCAGGGAGTGATTGAGCGGGG + Exonic
915009930 1:152676123-152676145 CTGCAGGGAAACATGGAGCTGGG - Exonic
917009849 1:170458374-170458396 ATGGAGGGTTAGATGAAGCAGGG - Intergenic
918458579 1:184753449-184753471 ATGCAGAGATAGATCCAGCCTGG - Intronic
919826995 1:201510182-201510204 ATGGATGGATGGATGGAGGGAGG - Intergenic
919935096 1:202245971-202245993 ATGAATGGATAGATGAAGGGAGG - Intronic
919935115 1:202246030-202246052 ATGAATGGATGGATGGAGGGAGG - Intronic
919935125 1:202246062-202246084 ATGAATGGATAGATGAAGGGAGG - Intronic
919935235 1:202246369-202246391 AGGGAGGGATGGATGGAGGGAGG - Intronic
919935245 1:202246393-202246415 ATGAATGGATAGATGAAGGGAGG - Intronic
920755561 1:208727747-208727769 ATGGATGGATAGATGGATAGAGG + Intergenic
923232816 1:232004836-232004858 AGGGAGGGAGAGATGGAGCGAGG - Intronic
923474988 1:234323728-234323750 ATGGAGGGATGGAAGGAGGGAGG + Exonic
923953381 1:238987340-238987362 ATGCAGGGATTGGTGGGGGGGGG - Intergenic
924328994 1:242923657-242923679 ATGCTGGAATAGAAGGAGAGAGG - Intergenic
924645133 1:245870497-245870519 ATGCAGGGATAGATGGAGCGAGG - Intronic
1062928340 10:1335200-1335222 ATGAATGGATGGATGGAGGGAGG + Intronic
1063850060 10:10177802-10177824 AGGCAGGGAGAGAGGGAGGGAGG - Intergenic
1064440809 10:15351697-15351719 ATGGATGGATGGATGGAGAGTGG + Intronic
1064483453 10:15762255-15762277 ATGGAGGGATGGAGGGAGGGAGG - Intergenic
1064587289 10:16851881-16851903 AGGGAGGGAAAGATGGAGGGAGG - Intronic
1064587304 10:16851937-16851959 AGGGAGGGAAAGATGGAGGGAGG - Intronic
1064587334 10:16852049-16852071 AGGGAGGGAAAGATGGAGGGAGG - Intronic
1064587352 10:16852108-16852130 AGGGAGGGAAAGATGGAGGGAGG - Intronic
1064587357 10:16852124-16852146 AGGGAGGGAAAGATGGAGGGAGG - Intronic
1064587395 10:16852264-16852286 AGGAAGGGAAAGATGGAGGGAGG - Intronic
1064587409 10:16852320-16852342 AGGGAGGGAAAGATGGAGGGAGG - Intronic
1064587429 10:16852396-16852418 AGGGAGGGAAAGATGGAGGGAGG - Intronic
1065282327 10:24152061-24152083 ATGCAGGGAGGGAGGGAGCGGGG - Intronic
1065383839 10:25115138-25115160 ATGGAGGGAGAGAGGGAGGGAGG - Intergenic
1065383870 10:25115219-25115241 ATGGAGGGAGAGAGGGAGGGAGG - Intergenic
1065383901 10:25115300-25115322 ATGGAGGGAGAGAGGGAGGGAGG - Intergenic
1065746811 10:28849490-28849512 CTGCAGGGATGGATGGAGGTAGG + Intronic
1065825052 10:29563025-29563047 ATGCATGGATGCATGGAGAGAGG + Intronic
1065952357 10:30663794-30663816 ATGCATGGATGCATGGAGAGAGG - Intergenic
1067570245 10:47366329-47366351 AGGCAGGAATGGAGGGAGCGAGG + Exonic
1067794837 10:49313388-49313410 ATGAGGGGAAAGATGGAGCAAGG + Intronic
1067833685 10:49624846-49624868 ATGCAAGGATAGATGGATGGTGG + Intronic
1068331009 10:55568868-55568890 ATGCAGTGACAGATGCAGCGAGG - Intronic
1069487222 10:68831566-68831588 ATGCAGGGAGAGAGGGATGGCGG + Intronic
1070153385 10:73818834-73818856 CTGCAAGGATAGATGGTGGGAGG + Intronic
1070897891 10:80000762-80000784 ATGCAGGGAAGGAGGAAGCGAGG + Intergenic
1071575553 10:86723319-86723341 ATGCATGGATAAATGGAGGAGGG + Intronic
1074896304 10:117780496-117780518 ATGGATGGATAGATGGATGGAGG - Intergenic
1076499268 10:130923578-130923600 ATGCCGGGAAAAATGGAGCTTGG + Intergenic
1076825128 10:132963395-132963417 ATGGACGGATGGATGGAGGGAGG - Intergenic
1076825149 10:132963481-132963503 ATGGACGGATGGATGGAGGGAGG - Intergenic
1076825157 10:132963511-132963533 ATGGACGGATGGATGGAGGGAGG - Intergenic
1076825165 10:132963541-132963563 ATGGATGGATGGATGGAGAGAGG - Intergenic
1076845003 10:133065650-133065672 ATGGATGGATAGATGGAGGGTGG + Intergenic
1077236732 11:1485520-1485542 ATGAAGAGAAAGATGGAGCCGGG + Intronic
1077280511 11:1742933-1742955 ATGGATGGATAGATGGATGGAGG + Intronic
1077280548 11:1743097-1743119 ATGGATGGATAGATGGATGGAGG + Intronic
1077307032 11:1873067-1873089 AGGCAGGGAGAGATGGAGGCAGG + Intronic
1077479923 11:2808977-2808999 ATGCAGAGATGGAGGGAGGGAGG + Intronic
1077480930 11:2814232-2814254 ATGCAGAGATAGAGGGAAGGAGG + Intronic
1077563676 11:3282503-3282525 AAGCAGTGAGAGATGGAGCTGGG - Intergenic
1077569566 11:3328320-3328342 AAGCAGTGAGAGATGGAGCTGGG - Intergenic
1077572654 11:3353252-3353274 GTGTAGGAATAGATGGAGAGCGG + Intronic
1077894432 11:6443180-6443202 ATTCTGGGATAGATGGATCCGGG - Intergenic
1078050361 11:7960500-7960522 CTGCAGGGGCAGATGGAGAGAGG - Exonic
1078338678 11:10483714-10483736 ATGCAGGCAGAGCTGGAGAGGGG - Intronic
1078791576 11:14547765-14547787 CTCCAGGGATCGATGGAGGGAGG + Intronic
1080867796 11:36210880-36210902 ATGGAGGGATAGCGGGAGAGGGG + Intronic
1081499540 11:43652684-43652706 ATGAAGAGATACATGGGGCGAGG + Intronic
1083631903 11:64099905-64099927 ATGGAGGGATGGATGGATGGAGG + Intronic
1083678808 11:64342073-64342095 CTGCAGGGCCAGATGGTGCGAGG - Exonic
1084044457 11:66560693-66560715 ATGTAGGGATTGGTGGAGCAGGG - Exonic
1084740004 11:71133410-71133432 ATGGATGGACAGATGGAGGGAGG + Intronic
1085464244 11:76713397-76713419 ATGCATGGATAGATGGTGGTGGG + Intergenic
1085695954 11:78704960-78704982 CTGCAGGGACAGAGGGAGCTGGG - Intronic
1086059007 11:82681453-82681475 ATGCAGGGGCAGATGGACTGAGG - Intergenic
1086208388 11:84287702-84287724 ATGGAGGGAGAGAAGGAGAGAGG - Intronic
1087549686 11:99633293-99633315 ATGCAGGCATAGCAGGAGCAAGG - Intronic
1088057480 11:105602806-105602828 AGGAAGGGATGGATGGAGGGAGG - Intergenic
1088435791 11:109811875-109811897 AAGCAGGGATGGATGGAGAGAGG + Intergenic
1091057017 11:132429061-132429083 ATGGATGGATGGATGGAGAGTGG + Intronic
1092693713 12:11144771-11144793 ATGCAGGGGTAGAGGAAGCAGGG - Intronic
1092993341 12:13924525-13924547 CAGCAGGGATAGAGGGAGCTGGG + Intronic
1093484754 12:19640884-19640906 ATGGAGGCATGGAGGGAGCGCGG - Intronic
1094337741 12:29380078-29380100 GTGCAGGGATGGATAGAGAGAGG - Intronic
1095240747 12:39856218-39856240 ATGCATGGATAGATGGATGAAGG - Intronic
1095285215 12:40402939-40402961 AGCCAGAGATAGATGGAGCAGGG - Intronic
1095455207 12:42376394-42376416 TTGCAGAGATAGATAGAGTGGGG + Intronic
1095496818 12:42793866-42793888 ATGGACGGATGGATGGAGAGAGG - Intergenic
1095636819 12:44444371-44444393 AGGAAGGGATAGAGGGAGGGAGG + Intergenic
1103004358 12:117409375-117409397 ATGGAGGGAGGGATGGAGGGAGG + Intronic
1103729512 12:123017907-123017929 AGGAAGGGATGGATGGAGGGAGG - Intronic
1104599361 12:130142095-130142117 TTGCACGGATAGAGGGAGGGAGG - Intergenic
1104772544 12:131372690-131372712 ATGGAGGGATGGATGGATGGAGG - Intergenic
1104772553 12:131372726-131372748 ATGGAGGGATGGATGGAGGGAGG - Intergenic
1105211651 13:18260687-18260709 ATGAATGGATAGAGGGAGGGAGG + Intergenic
1105478858 13:20754945-20754967 ATGTAGGGGAAGATGGAGCCAGG + Intronic
1106335172 13:28777171-28777193 ATGGAGGGCTAGATGAAGCAGGG - Intergenic
1108018098 13:46096933-46096955 ATGCAGGAATTCATGGAGAGTGG + Intronic
1110382162 13:74865312-74865334 ATGGATGGATGGATGGAGGGAGG - Intergenic
1113049981 13:106200138-106200160 ATGGAGGGACAGAGGGAGGGAGG - Intergenic
1114358098 14:21937253-21937275 AAGGAGGGAGAGATGGAGGGGGG - Intergenic
1115084274 14:29494510-29494532 AGGAAGGGAGAGATGGAGGGAGG + Intergenic
1116264596 14:42671488-42671510 AGGCAGGGAGAGAAGGAGGGAGG - Intergenic
1116621034 14:47203392-47203414 ATGCAGGGATGAATGGTGCCAGG + Intronic
1116665161 14:47765398-47765420 CTGCAGTAATAGATGGAGTGGGG + Intergenic
1116919985 14:50561667-50561689 AGGCATGGAGAGTTGGAGCGGGG + Intronic
1117018885 14:51549199-51549221 ATGGATGGATAGATGGATGGAGG + Intronic
1119671021 14:76518450-76518472 AGGCAGGGAGGGAGGGAGCGAGG + Intergenic
1121096560 14:91221494-91221516 ATGCATGGATGGATGGATAGTGG + Intronic
1121423210 14:93830168-93830190 ATGGATGGATAGATGGAGGAAGG + Intergenic
1122275759 14:100589960-100589982 ATGCATGGATGGATGGAGGTGGG + Intergenic
1122365046 14:101190029-101190051 ATGAATGGTTAGATGGAGGGAGG + Intergenic
1122612256 14:102993540-102993562 ATGGAGGGAAAGAGGGAGGGAGG + Intronic
1122915305 14:104855559-104855581 GTGGAGGGATGAATGGAGCGGGG + Intergenic
1202829218 14_GL000009v2_random:8170-8192 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1202900930 14_GL000194v1_random:38022-38044 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1123427724 15:20185615-20185637 ATGGAGGGACAGATGGGGAGGGG - Intergenic
1123536961 15:21192165-21192187 ATGGAGGGACAGATGGGGAGGGG - Intergenic
1126173460 15:45713340-45713362 ATGGAGGGATGGAGGGAGGGAGG - Intergenic
1127816718 15:62617083-62617105 ATGCAGGGTTTCATGGAGCTCGG + Intronic
1127992837 15:64133437-64133459 ATGCAGGGAAGGTTGGGGCGTGG + Intronic
1128793413 15:70449151-70449173 ATGGATGGAGAGATGGAGGGAGG + Intergenic
1130133203 15:81160725-81160747 ATGCAGGGATGGAGGAAGGGAGG - Intronic
1130871736 15:87977483-87977505 ATGCTGGGATGGATGGAGCCTGG + Intronic
1131430812 15:92387585-92387607 AGGGAGGGAAAGATGGAGGGGGG - Intergenic
1132086194 15:98910201-98910223 TTGCAGGGATAGAGTGAGCAGGG - Intronic
1133026146 16:2989740-2989762 AGGCAGGAAGAAATGGAGCGGGG + Intergenic
1133563008 16:6967044-6967066 ATATATGGATAGATGGAGGGTGG - Intronic
1133594247 16:7275159-7275181 AAGAAGGGATAGAGGGAGAGAGG + Intronic
1135978305 16:27125924-27125946 ATGCAGAGAGAGAGAGAGCGTGG - Intergenic
1136083713 16:27869434-27869456 AAGCAGAGAAAGATGGAGGGAGG - Intronic
1136899225 16:34016926-34016948 ATGCAGGTAGAGATGTAGAGAGG + Intergenic
1137580050 16:49628091-49628113 ATGGATGGGTAGATGGAGGGTGG - Intronic
1139124839 16:64065605-64065627 ATGGAGGGAGGGATGGAGGGAGG + Intergenic
1140426533 16:74866040-74866062 ATGCAGGGAGGGAGGGAGGGAGG + Intergenic
1140716900 16:77734826-77734848 AAGCAGGGACAGAGGGAGAGGGG + Intronic
1141042894 16:80687418-80687440 ATGAATGGATAGATGGATGGTGG + Intronic
1141115133 16:81302031-81302053 ATGGATGGATGGATGGAGCTGGG - Intergenic
1141421614 16:83921375-83921397 ATGGATGGATAGATGGATGGAGG + Exonic
1141430287 16:83967756-83967778 ATGGATGGATGGATGGAGGGTGG + Intergenic
1141898264 16:86972514-86972536 ATGCAGGGATGGAGGGAGGGAGG + Intergenic
1141899351 16:86980543-86980565 ATGCATGGATAGATGGATGTGGG + Intergenic
1142007333 16:87695715-87695737 AGGCAGGGGGAGAGGGAGCGTGG - Intronic
1142152395 16:88518436-88518458 ATGCATGGATAGATGGATGGTGG + Intronic
1143707502 17:8709119-8709141 ATGCAGGGTTAGATTGAGGCTGG - Intergenic
1143769166 17:9157006-9157028 ACGGATGGATAGATGGAGAGAGG - Intronic
1144352900 17:14415813-14415835 AGGGAGGGAGAGATGGAGGGAGG - Intergenic
1144365606 17:14541689-14541711 ATGGAGGGAGGGATGGAGGGAGG - Intergenic
1144726071 17:17503436-17503458 ATGGACGGATAGATGGATAGGGG + Intergenic
1144854534 17:18260732-18260754 ACGCAGGTACAGCTGGAGCGCGG + Intronic
1145016832 17:19404425-19404447 ATGCATGGATAGATGGTTGGAGG + Intergenic
1147587992 17:41663909-41663931 ATGCAGAGGTTGATGGAGAGAGG + Intergenic
1151402707 17:73866366-73866388 ATCCAGGGAGAGATGGAAGGAGG + Intergenic
1151625307 17:75272165-75272187 AGGCAGGGAAGGATGGTGCGAGG + Intergenic
1152006553 17:77685830-77685852 ATGAAGGGATGGAGGGAGAGAGG - Intergenic
1152006601 17:77686084-77686106 ATGGATGGATAGATGGAGGAAGG - Intergenic
1152650733 17:81491531-81491553 AGGCAGGGAGAGAGGGAGAGAGG - Intergenic
1153786251 18:8537705-8537727 ATGAGGAGATAGAGGGAGCGAGG - Intergenic
1155724569 18:29063758-29063780 ATGCAGACATAGATGGAGAAGGG - Intergenic
1156742374 18:40347569-40347591 ATTCAGAGATAGCTGGAGCTGGG - Intergenic
1159037242 18:63289529-63289551 TTGCAGTGAAAGATGGAGAGAGG + Intronic
1160521131 18:79508782-79508804 ATGGACGGAGAGATGGAGAGAGG - Intronic
1161130304 19:2584685-2584707 AGGGAGGGATAGAGGGAGGGAGG + Intronic
1161130367 19:2584873-2584895 AGGGAGGGATAGAGGGAGGGAGG + Intronic
1161256119 19:3310759-3310781 AGGGAGGGAGAGATGGAGGGAGG - Intergenic
1161256186 19:3311086-3311108 ATGGAGAGAGAGATGGAGAGAGG - Intergenic
1161256200 19:3311208-3311230 ATGGAGAGAGAGATGGAGAGAGG - Intergenic
1161329039 19:3677815-3677837 ATGGAGGGATGGAGGGAGGGAGG + Intronic
1161329247 19:3678520-3678542 AGGGAGGGATGGATGGAGGGAGG + Intronic
1162155990 19:8678257-8678279 ATGCATGGATAAATGGAGGATGG - Intergenic
1162776992 19:12985894-12985916 ATGGAGGGGAAGATGGAGGGAGG - Intergenic
1162823704 19:13238137-13238159 ATGCAGGAAGAGATGGAGGGTGG - Intronic
1162904151 19:13813534-13813556 AGGCAGAGATGGATGGAGAGAGG + Intronic
1163383676 19:16985828-16985850 ATGGAGAGAGAGATGGAGGGTGG + Intronic
1163462150 19:17445471-17445493 ATTGATGGATAGATGGAGAGTGG - Intronic
1163571381 19:18084271-18084293 ATGGATGGATAGATGGATGGGGG - Intronic
1164678791 19:30120441-30120463 ATGCAGGGAGAGATCGGGCACGG - Intergenic
1164706511 19:30324037-30324059 ATACATGGATAGATGGATGGAGG - Intronic
1164730954 19:30504267-30504289 AGGGAGGGATAGAGGGAGGGAGG - Intronic
1164797438 19:31045301-31045323 ATGGATGGATAGATGGAGACTGG + Intergenic
1165098361 19:33422785-33422807 ATGGATGGATAGATAGAGGGAGG - Intronic
1165762432 19:38329560-38329582 ATGCAGGGAAAGAGGGAAGGAGG + Intergenic
1166411567 19:42558817-42558839 ATACAGGGACAGACGGAGGGGGG - Intronic
1166841798 19:45701922-45701944 CTGCAGGGAGGGATGGAGGGTGG + Intronic
1166934481 19:46322839-46322861 ATGAAGGGATACATTGAGTGAGG + Intronic
1168421077 19:56204155-56204177 CTGGAGGGATAGAGGGAGGGAGG - Intronic
1168424367 19:56226765-56226787 CTGGAGGGATAGAGGGAGGGAGG + Intronic
1168426305 19:56241978-56242000 CTGGAGGGATAGAGGGAGGGAGG - Intronic
1168534599 19:57158481-57158503 AGGCATGGAAAGATGGAGGGGGG + Intronic
1202643478 1_KI270706v1_random:119619-119641 ATGCAGAGATAGATGTGGCCTGG - Intergenic
925166713 2:1720068-1720090 ATGCAGAGAGAGAGGGAGGGAGG + Intronic
925166719 2:1720092-1720114 ATGCAGAGAGAGAGGGAGGGAGG + Intronic
926022916 2:9512956-9512978 ATGAAGGGATACATAGGGCGAGG - Intronic
927365909 2:22296106-22296128 ATGAAGGGAGAGAAGGAGCAGGG - Intergenic
927489966 2:23514796-23514818 CAGCAAGGATAGATGGAGCGTGG - Intronic
927927288 2:27022896-27022918 CTGCAGGGAAAGGAGGAGCGGGG + Intronic
928160786 2:28922438-28922460 ATGGAGGGAGAGAGGCAGCGAGG + Intronic
928165444 2:28968407-28968429 GGGCAGGGAGAGAGGGAGCGAGG - Intronic
928668834 2:33579661-33579683 GTTAAGGGATAGATGGAGCAGGG - Intergenic
930316815 2:49806739-49806761 AAGCAGGGAGAGGTGGAGAGGGG + Intergenic
930786308 2:55274517-55274539 AGGGAGGGAGAGATGGAGAGAGG + Intergenic
932453363 2:71830464-71830486 AGGAAGGGAGAGATGGAGGGAGG - Intergenic
932818543 2:74880470-74880492 ATGAAGGTAGAAATGGAGCGAGG + Exonic
933985124 2:87584424-87584446 CTGCAGGGATAGGCGGAGGGAGG - Intergenic
934301970 2:91781768-91781790 ATGAATGGATAGAGGGAGGGAGG - Intergenic
935782303 2:106518960-106518982 ATGGAGGGATAGATGGATGGAGG - Intergenic
935899971 2:107781235-107781257 ATGCAGGGAGAGAAGGGGGGAGG + Intergenic
936768886 2:115887635-115887657 AGGGAGGGAGAGATGGAGGGAGG - Intergenic
937509921 2:122583642-122583664 AGGAAGGGATGGATGGAGGGAGG + Intergenic
938108156 2:128547180-128547202 ATGGATGGATAGATGGAGAATGG - Intergenic
938902055 2:135806882-135806904 TTGCAGGGCCAGATGGAGCAGGG - Intronic
941569211 2:167148464-167148486 AGGCAGGGATGGAAGGAGGGAGG + Intronic
942182292 2:173391433-173391455 GTGCAGGGATGGCTGGAGCCTGG + Intergenic
942959761 2:181816144-181816166 AGGCAGGGAGAGTTGGAGAGAGG - Intergenic
945950423 2:216034332-216034354 AGGCAGTGATGGATGGAGAGGGG - Intronic
947812851 2:233015186-233015208 ATGGATGGATAGATGGTGGGTGG - Intronic
1168838247 20:892054-892076 ATGCAGGGAAAGAAGGAGGGGGG - Intronic
1169512829 20:6283674-6283696 ATGCAGGGAGAGATGAAGAGTGG + Intergenic
1170814753 20:19704195-19704217 ATGGATGGATAGATGGATGGAGG + Intronic
1170938289 20:20828037-20828059 AAGCAGGGAGAGAGGGAGTGAGG + Intergenic
1171399178 20:24860730-24860752 ATGGGTGGATAGATGGAGGGAGG + Intergenic
1172866664 20:38105082-38105104 ATGCTGGTATAGATGGAACGGGG + Intronic
1173087697 20:39940065-39940087 ATGGATGGATAGATGGATGGAGG + Intergenic
1173550230 20:43927784-43927806 AAGGAGGGATAGAGGGAGGGAGG - Intronic
1173979947 20:47216099-47216121 ACGCAGGGAGAGATGCAGGGAGG + Intronic
1174746952 20:53072954-53072976 ATGGAGGGATAGATGGATGAAGG - Intronic
1174746964 20:53072998-53073020 AGGGAGGGATGGATGGAGGGAGG - Intronic
1174746970 20:53073014-53073036 AGGAAGGGATGGATGGAGGGAGG - Intronic
1174746989 20:53073093-53073115 ATGGAGGGATGGATGGAAGGAGG - Intronic
1174747007 20:53073165-53073187 ATGGAGGGATAGATGGATGAAGG - Intronic
1174785118 20:53425159-53425181 ATGCAGGGATAGAAAGAGGGTGG - Intronic
1175382676 20:58574641-58574663 ATGGAGAGATAGATGGAGGAAGG - Intergenic
1175817281 20:61889855-61889877 ATGGATGGATAGATGGATGGTGG + Intronic
1175984076 20:62755484-62755506 ATGGAGGGAGGGATGGAGGGAGG - Intronic
1175984127 20:62755632-62755654 AGGCAGGGATGGAGGGAGGGAGG - Intronic
1175984191 20:62755818-62755840 AGGGAGGGATGGATGGAGGGAGG - Intronic
1176129965 20:63492590-63492612 ATGCATGGATGGATGGATGGAGG + Intronic
1176253448 20:64138138-64138160 ATGCTGGGATAGATGGGGCAGGG + Intergenic
1176292227 21:5052428-5052450 ATGGAGGGATGGATGGATGGAGG - Intergenic
1176292251 21:5052504-5052526 ATGGAGGGATGGATGGATGGAGG - Intergenic
1176292281 21:5052596-5052618 ATGGAGGGATAGAAGGATGGAGG - Intergenic
1176608402 21:8853010-8853032 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1176620304 21:9052800-9052822 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1177078501 21:16608657-16608679 ATTCAGGGATGGTTGGAGGGTGG + Intergenic
1178337998 21:31761125-31761147 AGGGAGGGAGAGATGGAGGGAGG - Intergenic
1178672586 21:34604886-34604908 ATGAATGGATTGATGGAGCCAGG + Intronic
1179007658 21:37529454-37529476 ATGGATGGATGGATGGAGGGAGG + Intergenic
1179567499 21:42258370-42258392 ATGGAGGGAGAGATGGAAAGAGG - Intronic
1179864979 21:44211062-44211084 ATGGAGGGATAGAAGGATGGAGG + Intergenic
1179865009 21:44211154-44211176 ATGGAGGGATGGATGGATGGAGG + Intergenic
1179865033 21:44211230-44211252 ATGGAGGGATGGATGGATGGAGG + Intergenic
1180172067 21:46064792-46064814 ATGGAGGGATGGAGGGAGGGAGG + Intergenic
1180358485 22:11862814-11862836 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1180379777 22:12129516-12129538 ATGCAGAGATAGATGTGGCCTGG - Intergenic
1180698527 22:17769437-17769459 AGGCAGGGAGAGATGGGGCCTGG - Intronic
1180814459 22:18780955-18780977 ATGAATGGATAGAGGGAGGGAGG + Intergenic
1181200647 22:21215291-21215313 ATGAATGGATAGAGGGAGGGAGG + Intronic
1181482150 22:23206966-23206988 ATGGATGGATGGATGGAGGGAGG - Intronic
1181630206 22:24147232-24147254 AGGCAGGGAGAGAGGGAGGGAGG - Intronic
1182023757 22:27101486-27101508 ATGGATGGATGGATGGAGAGAGG - Intergenic
1182039108 22:27222529-27222551 ATGGGTGGATAGATGGAGAGTGG + Intergenic
1183106509 22:35618870-35618892 ATGGATGGATAGATGGATGGAGG - Intronic
1183106541 22:35618998-35619020 ATGGATGGATAGATGGATGGAGG - Intronic
1183162908 22:36126782-36126804 ATGGAGGGAGAGAGGGAGGGAGG - Intergenic
1183262291 22:36803516-36803538 ATGGATGGACAGATGGAGGGAGG + Intronic
1183784932 22:40023768-40023790 ATGCTGGGATAGAGAGAGAGAGG + Intronic
1184293024 22:43508418-43508440 ATGAATGGATAGATGGGGCATGG - Intergenic
1184293047 22:43508506-43508528 ATGGATGGATAGATGGATGGGGG - Intergenic
1184293283 22:43509277-43509299 ATGGACGGATAGATGGAGGATGG - Intergenic
1184779951 22:46643016-46643038 ATCCAGGGATGGATGGATCCAGG - Intronic
1203226270 22_KI270731v1_random:80144-80166 ATGAATGGATAGAGGGAGGGAGG - Intergenic
1203264558 22_KI270734v1_random:6642-6664 ATGAATGGATAGAGGGAGGGAGG + Intergenic
950149725 3:10677411-10677433 AGGGATGGATAGGTGGAGCGGGG + Intronic
950307455 3:11927542-11927564 ATGCAGGGAGAGATTTAGGGGGG + Intergenic
952078800 3:29731891-29731913 ATGGAGGGATAGAGGAAGAGAGG - Intronic
953256066 3:41291548-41291570 AGGCAGGGAGAGATGGAGGGAGG + Intronic
953273890 3:41475957-41475979 ATGGAGGGAAAGAGGGAGGGAGG + Intronic
953766759 3:45748857-45748879 ATGCAGTGATAGATGCACTGAGG - Intergenic
953957417 3:47242368-47242390 ATGGAGGGATAGAAGGATAGAGG + Intronic
954085378 3:48240099-48240121 ATACAGAGACAGAGGGAGCGGGG + Intergenic
954126852 3:48536329-48536351 CGGCAGAGGTAGATGGAGCGGGG + Exonic
954144853 3:48629451-48629473 ATGAAGGGACAGAGGGAGAGTGG - Intronic
954639021 3:52087080-52087102 TTGAAGGGATAGAGGGAGAGTGG + Intronic
954759966 3:52866934-52866956 ATGCAGGGATAGGGGGAATGTGG + Intronic
955066635 3:55538850-55538872 ATAGAGGGATAGAGGAAGCGTGG - Intronic
955797493 3:62653023-62653045 ATGCAGGGAGATAGGGAGAGAGG - Intronic
956312101 3:67892653-67892675 ATGGAGGAATAGATTGAGTGAGG + Intergenic
956663720 3:71622918-71622940 ATGGAGGCAGAGATGGAGCCAGG + Intergenic
958542281 3:95494124-95494146 GTGTAAGGATAGCTGGAGCGTGG + Intergenic
962390861 3:134971460-134971482 ATGGATGGGTGGATGGAGCGAGG + Intronic
962991463 3:140581107-140581129 ATGCTGGGAGAGATGAAACGAGG + Intergenic
962992111 3:140587216-140587238 AGGGAGGGAGAGAGGGAGCGAGG + Intergenic
963715708 3:148801378-148801400 ATGAAGGGATAGAGGGAAAGAGG - Intronic
966735140 3:183181654-183181676 ATGGAGGGATAGAGGGACAGAGG + Intronic
966959137 3:184915978-184916000 AGGGAGGGATAGAAGGAGGGAGG - Intronic
968434306 4:576723-576745 ATGCAGGGAGAGGGGGAGAGGGG + Intergenic
969441633 4:7220496-7220518 AAGCAGGGCCAGATGGAGCCAGG + Intronic
970134892 4:12911860-12911882 ATGGAGGCATAGAGGGAGTGAGG - Intergenic
971372459 4:26029603-26029625 AGGCAGGGATATGGGGAGCGAGG + Intergenic
973826008 4:54708346-54708368 ATGCAGGGATAGACTGACCAGGG + Intronic
973929956 4:55782117-55782139 ATGCAGGGATAGCAGGAGAAAGG - Intergenic
979506273 4:121501417-121501439 ATGCAGGGATAGCAGGAGAAAGG + Intergenic
983288170 4:165765819-165765841 AAATAGGGATAGATGGAGAGAGG + Intergenic
983490724 4:168385971-168385993 ATAGAGGGATAGAGGGAGGGAGG + Intronic
984844891 4:184100713-184100735 ATGCAGGCAGAGAAGGAGTGGGG + Intronic
1202770848 4_GL000008v2_random:205533-205555 ATGCAGAGATAGATGTGGCCTGG - Intergenic
987182216 5:15379775-15379797 AGGCAGGGAGAGAGGGAGGGAGG + Intergenic
988879778 5:35488740-35488762 ATGCAAGAGTAGATGGAGCATGG - Intergenic
988974011 5:36497349-36497371 AGGCAGGGATGGAAGGAGAGAGG + Intergenic
989578915 5:43013807-43013829 ATGCAGGGATAAATGTAGGAAGG - Intergenic
992010519 5:72521572-72521594 AGGCAGTGATAGATAGAGCCAGG + Intergenic
993526657 5:88973654-88973676 ATGGAGGGAGAGAGGGAGGGAGG + Intergenic
994591223 5:101775237-101775259 ATGGAGGGACAAATGGAGAGAGG - Intergenic
995904438 5:117106518-117106540 ATGCATGGAGAGATTGAGCATGG + Intergenic
997823461 5:137086197-137086219 ATGCAGTGAGAGATGCAGGGAGG - Intronic
998260932 5:140631568-140631590 CTGCGGGGATAGAAGGAGCCAGG - Intergenic
999378773 5:151105382-151105404 ATGCAGGGATAGACGAGGTGGGG - Intronic
999904494 5:156124755-156124777 AGGGAGGGACAGATGGAGGGAGG + Intronic
1000300010 5:159947935-159947957 ATCCAGGGACAGCTGGAGCTTGG - Intronic
1000602203 5:163288282-163288304 ATGCAGGGATAAAAGGAAAGAGG + Intergenic
1000746065 5:165035525-165035547 ATCCAGGGTTAGCTGGAGTGTGG - Intergenic
1000982607 5:167832597-167832619 AGGCAGGGATGGATGGATAGAGG + Intronic
1001297179 5:170506234-170506256 AGGCAGGGAGTGATGGAGCTGGG - Intronic
1001445528 5:171779796-171779818 AGGCAGGGAGAGAGGGAGAGAGG + Intergenic
1001686351 5:173597580-173597602 ATGGAGGGAAAGAAGGAGGGAGG - Intergenic
1001686397 5:173597716-173597738 ATGGAGGGATGGAGGGAGGGAGG - Intergenic
1001686456 5:173597868-173597890 ATGGAGGGAGGGATGGAGGGAGG - Intergenic
1001686488 5:173597952-173597974 ATGGAGGGAGGGATGGAGGGAGG - Intergenic
1001686513 5:173598016-173598038 ATGGATGGATGGATGGAGGGAGG - Intergenic
1001968133 5:175928889-175928911 AGGGAGGGAGAGATGGAGGGAGG + Intronic
1002249309 5:177914921-177914943 AGGGAGGGAGAGATGGAGGGAGG - Intergenic
1002341632 5:178520069-178520091 ATGGATGGATAGATGGAGGATGG + Intronic
1002915298 6:1524011-1524033 ATGCAGGGAAAGCGGGAGCGCGG + Intergenic
1003644003 6:7899522-7899544 AGGCAGGGAGAGAGGGAGGGAGG + Intronic
1005277747 6:24238143-24238165 ATGCAGGGAGGAATGGAGGGAGG + Intronic
1006529009 6:34633870-34633892 ATGGAGGGAGAGAGGGAGGGAGG + Intronic
1008481413 6:51989846-51989868 ATGAAGGGATAGGGGGAGGGAGG + Intronic
1008612555 6:53197657-53197679 AGGGAGGGAGAGAGGGAGCGAGG + Intergenic
1014432595 6:121388511-121388533 CTGCAGGGATGGAAGGAGAGGGG - Intergenic
1015052941 6:128863720-128863742 CTGCAGGGAGAGATGGGGAGGGG + Intergenic
1015517422 6:134097352-134097374 ATGAAGTGATGGATGGAGAGCGG + Intergenic
1015903062 6:138087482-138087504 ATGTGGGGATATATGGAGTGGGG + Intergenic
1018005860 6:159620924-159620946 ATGGAGGGAGAGAGGGAGGGAGG + Intergenic
1019095404 6:169575385-169575407 ATGGATGGATGGATGGAGAGAGG - Intronic
1019480928 7:1266489-1266511 TTGGAGGGATAGATGGTGCAGGG + Intergenic
1019480938 7:1266536-1266558 TTGGAGGGATAGATGGTGCAGGG + Intergenic
1019730541 7:2627263-2627285 AAGGAGGGAAAGATGGAGGGAGG + Intergenic
1020521938 7:9201353-9201375 ATGGATGGATAGATAGAGAGAGG + Intergenic
1021719497 7:23491761-23491783 AGGCAGGGAGAGAAGGAGGGAGG - Intergenic
1021909490 7:25369949-25369971 ATGCAGGGAGGGCTGGAGCCAGG - Intergenic
1022043791 7:26606719-26606741 ACACAGGGACACATGGAGCGGGG + Intergenic
1022362471 7:29675348-29675370 ATACAGGGAGAGAGGGAGAGAGG - Intergenic
1023261377 7:38362230-38362252 ACGGAGGGAGCGATGGAGCGAGG + Intergenic
1024623346 7:51182672-51182694 AGGAAGGGATAGTTGGAGAGTGG + Intronic
1025735541 7:64143606-64143628 ATGCAGGGACGGATGGAGGGAGG + Intronic
1026352584 7:69530521-69530543 CTGCTGGGATGGATGGAGAGAGG - Intergenic
1026528347 7:71175201-71175223 ATGGAGGGATGGATGGATGGAGG - Intronic
1026850638 7:73721206-73721228 ATGCAGGGAAAGGAGGAGAGGGG - Intergenic
1028723678 7:94062349-94062371 ATGCAGAGTTAGATGAAGAGTGG - Intergenic
1029604804 7:101592117-101592139 ATGGATGGATGGATGGAGGGAGG - Intergenic
1029673098 7:102047481-102047503 ATGAAGGGAGAGATGGAGGGAGG + Intronic
1032725167 7:134584350-134584372 ATGAATGGATGGATGGAGGGAGG + Intergenic
1032725206 7:134584528-134584550 AAGGATGGATAGATGGAGGGAGG + Intergenic
1032898121 7:136275306-136275328 AGGGAGGGAGAGAGGGAGCGAGG - Intergenic
1033874292 7:145795242-145795264 ATGGAGGGAGAGAGGGAGGGAGG + Intergenic
1033921627 7:146400106-146400128 AGGCAGGGATGGAGGGAGGGAGG - Intronic
1034406115 7:150903471-150903493 ATGGAGAGAGAGATGGAGAGAGG - Intergenic
1036662984 8:10720297-10720319 ATGAATGGATGGATGGAGAGTGG + Intergenic
1037648040 8:20811578-20811600 AGGCAGAGACAGATGGAGGGTGG + Intergenic
1037776511 8:21839065-21839087 AGGCGGGGAGAGATGGAGCCAGG + Intergenic
1038727418 8:30094223-30094245 ATGGAGGGATGGAGGGAGAGAGG + Intergenic
1038989960 8:32857400-32857422 ATTAAGGGATAAATGGAGGGGGG - Intergenic
1040461521 8:47653492-47653514 ATGAAGGAAAAGAGGGAGCGAGG - Intronic
1040603647 8:48909195-48909217 ATGCAGGGATGGAAGGGGTGTGG - Intergenic
1040716057 8:50253904-50253926 AGGGAGGGAAAGATGGAGAGAGG + Intronic
1041714593 8:60922389-60922411 GTGCAGGAAGAGATGGCGCGAGG + Intergenic
1041814302 8:61950474-61950496 ATGAAGGGATGGGAGGAGCGGGG + Intergenic
1041866568 8:62581736-62581758 AAGAAGGGATGGATGGAGGGAGG - Intronic
1042865014 8:73349391-73349413 ATGCAGGGAGAGAAGCAGGGTGG - Intergenic
1043164351 8:76884767-76884789 TTTAAGGGCTAGATGGAGCGTGG - Intergenic
1043271900 8:78344561-78344583 ATACAGGGAGAGAGGGAGAGAGG + Intergenic
1043325295 8:79043012-79043034 AGGCAGGGATTGAGGGAGTGTGG + Intergenic
1046295706 8:112217176-112217198 AAGCAGGCATAGTTGAAGCGAGG - Intergenic
1046820827 8:118632527-118632549 ATGGAGGGCTTGATGGAGCCAGG + Intergenic
1047218996 8:122903513-122903535 GTGCAGGGATGGAGTGAGCGGGG + Intronic
1047306844 8:123659401-123659423 ATGGATGGATAGATGGATGGAGG - Intergenic
1048365667 8:133736285-133736307 AGGAAGGGAGAGATGGAGGGAGG - Intergenic
1048988731 8:139749133-139749155 AGGGAGGGACAGATGGAGCAGGG - Intronic
1049102306 8:140588589-140588611 AGGCAGGGAGAGAGGGAGGGAGG + Intronic
1049102584 8:140590181-140590203 GTGCAGGGATGGCTGGAGCTGGG + Intronic
1050313247 9:4374303-4374325 TTGCAGGGATAGATAAAGCAGGG - Intergenic
1050830244 9:10001043-10001065 CTACAGAGATAGAGGGAGCGGGG - Intronic
1051796136 9:20872569-20872591 ATGGAGGGAGAGAGGGAGGGAGG - Intronic
1052617531 9:30860831-30860853 ATGGATGGATAGATGGATGGAGG + Intergenic
1054355191 9:64054154-64054176 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1054935834 9:70686762-70686784 AAGGAGGGAAAGATGGAGGGAGG - Intronic
1056932912 9:90893489-90893511 ATGAAGGGAGAGAAGGAGGGAGG + Intronic
1056946853 9:91005026-91005048 CTGCAGGGATAGGTGGAGCTCGG - Intergenic
1057738002 9:97684324-97684346 ATGCAGCGATAGATGGACAAGGG + Intronic
1057820936 9:98330106-98330128 ATGCAGGGCTGGAGGGAGCTTGG - Intronic
1058390699 9:104492010-104492032 AGGGAGGGAGAGATGGAGCAAGG + Intergenic
1060430083 9:123543576-123543598 GAGCAGGGACAGAAGGAGCGTGG - Intronic
1060985698 9:127817874-127817896 ATGGATGGATAGATGGACAGTGG + Intronic
1061672234 9:132195218-132195240 AGGCAGGGAAAGATGGTGGGTGG - Intronic
1061962993 9:133997930-133997952 AGGGAGGGATGGATGGAGGGAGG - Intergenic
1061963010 9:133997974-133997996 ATGGAGGGAGAGATGGATGGAGG - Intergenic
1061963040 9:133998057-133998079 ATGGAGGGATGGATGGAAGGAGG - Intergenic
1061963340 9:133999038-133999060 GTGGAGGGATAGATGGAGGGAGG - Intergenic
1062201235 9:135303907-135303929 ATGGATGGATAAATGGAGGGTGG + Intergenic
1203703801 Un_KI270742v1:18220-18242 ATGCAGAGATAGATGTGGCCTGG + Intergenic
1203566594 Un_KI270744v1:96260-96282 ATGCAGAGATAGATGTGGCCTGG - Intergenic
1186071924 X:5830533-5830555 ATGCATAGATAGATAGAGAGTGG - Intergenic
1186490766 X:9970421-9970443 AAGGAGGGAGAGATGGAGAGAGG - Intergenic
1187259058 X:17668457-17668479 ATGCAGGAACAGAAGGAGTGAGG - Intronic
1187447695 X:19373206-19373228 ATGCAGGGACAGAGGGGGCAAGG + Intronic
1187929069 X:24277383-24277405 ATGCGGGGAGAGAGGGAGCATGG - Intergenic
1188036446 X:25322905-25322927 ATGGAGGGAGGGATGGAGGGAGG - Intergenic
1189176287 X:38960615-38960637 AGGCAGGGAGGGATGGAGAGAGG - Intergenic
1189710042 X:43801092-43801114 ATACAGGGAGAGAAGGAGAGAGG - Intronic
1193360353 X:80573115-80573137 ATGAAGGTAGAAATGGAGCGAGG - Intergenic
1194279527 X:91932017-91932039 ACACATGGATACATGGAGCGGGG - Intronic
1195416442 X:104625173-104625195 ATGCATGGATGGATGGAGGATGG - Intronic
1195693166 X:107645965-107645987 AAGCATGGAGAGATGGAGTGGGG - Intronic
1196588131 X:117454142-117454164 ATGGGGGGATAGAGGGAGGGAGG - Intergenic
1197014737 X:121609768-121609790 ATGAAGGGAGAGAGGGAGGGAGG + Intergenic
1198041782 X:132859848-132859870 AAGGAGGGAGAGATGGAGGGAGG + Intronic
1198642385 X:138770673-138770695 ATGCAGAGATGGATGGGGCATGG - Intronic
1198821690 X:140654930-140654952 TTCCAGGGATAGATGAAGTGTGG - Intergenic
1200597004 Y:5155508-5155530 ACACATGGATACATGGAGCGGGG - Intronic
1200882855 Y:8237533-8237555 ATGGAGGGACAGAGGGAGAGGGG + Intergenic
1201226374 Y:11822759-11822781 ATGCTGGAATAGAAGGAGAGAGG - Intergenic
1201625610 Y:16011757-16011779 AGGCAGGGAAGGATGGAGGGAGG + Intergenic
1201739340 Y:17306767-17306789 AGGGAGGGAGGGATGGAGCGAGG + Intergenic
1202194677 Y:22287078-22287100 AAGCAGGGACAGAGGGAGAGGGG + Intergenic