ID: 924646027

View in Genome Browser
Species Human (GRCh38)
Location 1:245878005-245878027
Sequence GAGTGTTCCCAGGAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 2, 2: 8, 3: 37, 4: 444}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924646027 Original CRISPR GAGTGTTCCCAGGAGGAGGA AGG Intronic
900006505 1:58106-58128 GAGTGTTCCAATGTGGAGGAAGG - Intergenic
900152221 1:1183669-1183691 GAGGGCTGCCTGGAGGAGGAGGG - Intronic
901054936 1:6444685-6444707 GAGTGTGCCCAGGAGGAAGACGG + Intronic
901792473 1:11661606-11661628 GAATGGTCCCAGGAGGGGAAGGG - Exonic
902359151 1:15932613-15932635 GAGAGTCCCCAAAAGGAGGATGG + Exonic
902361586 1:15945085-15945107 GAGGGTTCCCAGCTGGAGAACGG - Exonic
902479419 1:16703918-16703940 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
902681108 1:18044386-18044408 GAGTCTCCCCAGGAGTGGGATGG - Intergenic
902759727 1:18573295-18573317 GAGGGCTCCCTGGAAGAGGAGGG - Intergenic
903266877 1:22163047-22163069 CAGTGTCCCCAGGAAGGGGATGG + Intergenic
903671501 1:25038367-25038389 GAAGGCTCCCAGGAGGAGGTGGG + Intergenic
904305525 1:29586199-29586221 GTCTGTTCCCAGGAGGAGGCTGG - Intergenic
904380776 1:30109276-30109298 GGGTGGTCCCTGGAGGGGGATGG - Intergenic
904453091 1:30629096-30629118 CTGTGTTCTCAGGAGCAGGAAGG - Intergenic
904562351 1:31407170-31407192 GGCTGTTTCCTGGAGGAGGATGG - Intergenic
904887420 1:33751328-33751350 GAGGGTTTCCAGAAGGAGGAAGG + Intronic
904907323 1:33907448-33907470 GAGTGATTTCAGGAGGAGGCTGG + Intronic
905217737 1:36421321-36421343 GAGTGTTCCCGGGAGGAGGATGG - Intronic
905388579 1:37621586-37621608 GAGGGACCACAGGAGGAGGAGGG + Intronic
906704652 1:47886202-47886224 GAGGGCTCCCTGGAGGAGGTGGG - Intronic
907306084 1:53513865-53513887 GGCTGTAGCCAGGAGGAGGAAGG + Intronic
911934147 1:103945574-103945596 GAATGTACCCAGCAGGAGGCTGG + Intergenic
913581664 1:120233076-120233098 GACTGTTCTCAGTAGGAGGCTGG - Intergenic
913626513 1:120665312-120665334 GACTGTTCTCAGTAGGAGGCTGG + Intergenic
914563595 1:148844523-148844545 GACTGTTCTCAGTAGGAGGCTGG - Intronic
914609232 1:149285703-149285725 GACTGTTCTCAGTAGGAGGCTGG + Intergenic
914716301 1:150257584-150257606 GGGTGTTCCCTGGAGCAGGCAGG - Exonic
915940280 1:160114454-160114476 GACTGTTCCCAGTAGAAGGCGGG + Intergenic
917829755 1:178868313-178868335 GCATGTGCCCAGGAGGATGATGG - Intronic
919968447 1:202553607-202553629 GAGTGTACAGAGGAGGAGGATGG + Intronic
920054256 1:203181139-203181161 GTGAGTTCCCAGAAGGAGGGAGG - Intronic
920233927 1:204490193-204490215 GAGAGTTCTCAGGAAGAGGAAGG + Exonic
920249571 1:204614593-204614615 GTGTGTTTCGAGCAGGAGGAAGG - Intergenic
921119827 1:212126807-212126829 GCGTGAACCCAGGAGGTGGAGGG - Intergenic
923544239 1:234912774-234912796 GAGAGTTCCCAGCAGCAAGAAGG + Intergenic
923987912 1:239402224-239402246 CAGTGTTCCAAGGAGAAGCAAGG + Intronic
924646027 1:245878005-245878027 GAGTGTTCCCAGGAGGAGGAAGG + Intronic
1062768204 10:81049-81071 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1062839759 10:661319-661341 GAGCGTCTCCAGGTGGAGGAGGG - Intronic
1063969569 10:11372122-11372144 CAGTGGTCCCAAGAGGAGGCCGG - Intergenic
1065761478 10:28987149-28987171 AAGTCTTCTGAGGAGGAGGAGGG - Intergenic
1066426024 10:35308535-35308557 GAGTGAGCCCATGGGGAGGAGGG + Intronic
1067054159 10:43041608-43041630 GAGCATGCCCAGGAGGAGGGAGG - Intergenic
1068884381 10:62083500-62083522 GAGTGTGGGAAGGAGGAGGAGGG - Intronic
1069617246 10:69813938-69813960 TTGTGGTCCCAGGAGGAGGTGGG - Intronic
1069716188 10:70522933-70522955 GTGTGTGGCCAGCAGGAGGAAGG + Intronic
1069988299 10:72298731-72298753 TATTCTTCCCAGGAAGAGGAAGG + Intergenic
1070535232 10:77372226-77372248 GAGTGATTCCAGGAGGATGGGGG - Intronic
1070568945 10:77626393-77626415 AAGTGTTCCCAGATGCAGGAAGG + Intronic
1070596807 10:77838353-77838375 CATTGCTCCCAGGAGGAGGGAGG - Intronic
1070720983 10:78756955-78756977 TGCTGTGCCCAGGAGGAGGATGG - Intergenic
1070873793 10:79782266-79782288 GCATGAACCCAGGAGGAGGAAGG + Intergenic
1071640726 10:87304415-87304437 GCATGAACCCAGGAGGAGGAAGG + Intergenic
1071654510 10:87433530-87433552 GCATGAACCCAGGAGGAGGAAGG - Intergenic
1072642795 10:97225139-97225161 GAGTGTGCCTAGGAGGGGGCTGG - Exonic
1074077659 10:110143340-110143362 CAGTGTGCCCAGGTGGAGAAGGG - Intergenic
1074104211 10:110376516-110376538 GACTGATCCCAGGAGCAGGAAGG - Intergenic
1074435132 10:113427252-113427274 GCTTGAACCCAGGAGGAGGAGGG + Intergenic
1075345683 10:121680521-121680543 GGATGTTCCCACGAAGAGGAAGG - Intergenic
1075928625 10:126274053-126274075 GTGAGTTCCCAGGAGGTCGAAGG - Intronic
1076308631 10:129485353-129485375 GGCTGTGCCAAGGAGGAGGAGGG - Intronic
1076413386 10:130267491-130267513 GAGTGCTTCCAAGTGGAGGATGG - Intergenic
1076446177 10:130515866-130515888 CAGTTTTCCCAGGAGGAAGGTGG - Intergenic
1077054057 11:581630-581652 GGGCGTCCCCAGGAGGAGCAGGG + Intronic
1077131346 11:974256-974278 GAGTGGTCCCATGGGGATGAAGG + Intronic
1077168314 11:1153542-1153564 GAGGGTTCCCAGGAGGCAGGTGG + Intergenic
1077297297 11:1832185-1832207 GAGGGTTCCCTGGAAGAGGTGGG + Intronic
1077358152 11:2128085-2128107 GGGAGTTGCCTGGAGGAGGAGGG - Intergenic
1077595904 11:3531452-3531474 GCATCATCCCAGGAGGAGGAGGG - Intergenic
1078803251 11:14668941-14668963 GAGGGTCCCCAGGAGCAGGGAGG - Intronic
1081538723 11:44014744-44014766 GAGTGACCCTAGGAGTAGGAGGG + Intergenic
1082796331 11:57380664-57380686 AACTGTTCCCAGCAGGAGAAAGG + Exonic
1083277885 11:61607533-61607555 GAGAATTCCTAGGAGGATGACGG - Intergenic
1083427640 11:62596877-62596899 GAGTGTTTTAAGGAGCAGGAAGG - Intronic
1083664608 11:64267704-64267726 GAGGGGCCCCAGGAGGATGAAGG - Intronic
1084195430 11:67521832-67521854 CAGTGTTTCCAGGAGGAAGTGGG - Intronic
1084251802 11:67905447-67905469 GCATCATCCCAGGAGGAGGAGGG - Intergenic
1084262720 11:67989880-67989902 GAGTGTTCTCTGGAGGTGGCTGG - Intergenic
1084331523 11:68433214-68433236 GTGTGTTGCCGGGAGGAGGAAGG + Intronic
1084680788 11:70665063-70665085 GAGGGGTCCCTGTAGGAGGAAGG - Intronic
1084683567 11:70680842-70680864 GAGAGTCCCCACAAGGAGGACGG - Intronic
1084821036 11:71690581-71690603 GCATCATCCCAGGAGGAGGAGGG + Intergenic
1085471728 11:76762898-76762920 GAGTGTTAGCAGGGGGTGGATGG - Intergenic
1085842071 11:80023587-80023609 GTGTGTCATCAGGAGGAGGATGG - Intergenic
1086479853 11:87222719-87222741 GCGTGAACCCAGGAGGTGGAAGG + Intronic
1087237210 11:95733388-95733410 GTGTGTTTCGAGGAGGAGCAAGG - Intergenic
1088505634 11:110524371-110524393 TAGTGTTCCCATGAGCAAGAGGG - Intergenic
1088818076 11:113434878-113434900 GGGTGTCCCCAGGGGGAGGCTGG + Intronic
1089223331 11:116894107-116894129 GACTGTTCCCAGGAGGAGGGAGG - Intronic
1089637246 11:119822969-119822991 GAGTGTTTCCAGAAGGAAGGGGG + Intergenic
1089679404 11:120110952-120110974 TAGAGTTCCCAGGGGGAGAAGGG - Intergenic
1090507006 11:127326496-127326518 GAGTATGCTGAGGAGGAGGAGGG - Intergenic
1090669661 11:128937435-128937457 CAGGATTCCGAGGAGGAGGAGGG + Intronic
1090789348 11:130076944-130076966 GCATGTGGCCAGGAGGAGGAGGG + Intronic
1091311120 11:134575977-134575999 GAGAGTGCCCAGGGGAAGGAAGG + Intergenic
1091311135 11:134576038-134576060 GAGAGTGCCCAGGGGAAGGAAGG + Intergenic
1092422072 12:8340238-8340260 GCATCATCCCAGGAGGAGGAGGG - Intergenic
1092756462 12:11767994-11768016 GAGTGTTCCCTGGAGCAGCTGGG - Intronic
1094427192 12:30328006-30328028 GGGTGTGCCCAGGAGCAGGCAGG + Intergenic
1097448829 12:59711225-59711247 TACTGTTCCCAGAAGAAGGAAGG + Intronic
1100055248 12:90501230-90501252 CAGCTTTTCCAGGAGGAGGAAGG + Intergenic
1101655934 12:106720167-106720189 GAGAGGCCCCAGGAGGTGGAGGG + Intronic
1101782381 12:107847191-107847213 GAGTGTTGCCACGCTGAGGATGG - Intergenic
1102422051 12:112811417-112811439 GAGTGTTCCTAGGAGCAGGAAGG - Intronic
1102890342 12:116553782-116553804 GAGGGTTGCCAGGAGTTGGAGGG + Intergenic
1103008513 12:117439887-117439909 GCGTCTGCCCAGGAGGAGGGTGG + Intronic
1104071535 12:125350084-125350106 CAGTGTCCTCTGGAGGAGGAAGG + Exonic
1104779224 12:131409102-131409124 GAATGGACCCAGGAGCAGGAAGG - Intergenic
1104831243 12:131753277-131753299 GTGTGGTCCCAGGAGGTGGTGGG - Exonic
1104982213 12:132578447-132578469 GAGTGGGCTGAGGAGGAGGAGGG + Intronic
1105277190 13:18943259-18943281 GAGAGGCCCCAGGAGGAGGCTGG - Intergenic
1105847799 13:24308268-24308290 GGGTGTCCCCAGCAGGAGGTCGG + Intronic
1106405437 13:29469216-29469238 GAGTGGTCACAGGAGGGAGAAGG - Intronic
1109726591 13:66349186-66349208 CAGTGTTTCCTGGAGGAGGGAGG + Intronic
1109770429 13:66963705-66963727 GAGTGTTCACATGAAGAGGGTGG - Intronic
1113091280 13:106619398-106619420 AAGGGATCCCGGGAGGAGGAAGG - Intergenic
1113843229 13:113371761-113371783 GAGGGGTCTCAGGAGGAGGGAGG - Intergenic
1113966295 13:114155536-114155558 GGGTGTTACCTGGAGGGGGAAGG + Intergenic
1114631764 14:24163866-24163888 CTGTGTCCGCAGGAGGAGGAGGG + Exonic
1114696721 14:24632874-24632896 GAGTGTTTCCAGGAGGGTGTGGG + Intronic
1115264573 14:31487759-31487781 CAGTGTTCCCAAGTGGAGGTGGG - Intronic
1117784570 14:59269316-59269338 GCATGTTCCCAAGAGGAGTAAGG - Intronic
1117992764 14:61450995-61451017 TAGTGTTCCCATGAAGAGGTGGG - Intronic
1119770250 14:77216200-77216222 CAATGTTTCCAGGAGGAGGGAGG - Intronic
1121361957 14:93269861-93269883 TATTGGTCCCAGGAGGAGAATGG + Intronic
1121819077 14:96951409-96951431 GAGTGTTACCAGCAGAGGGAAGG + Intergenic
1122931020 14:104933153-104933175 GAGGGCTCCCTGGAGGAGGTGGG - Exonic
1123974858 15:25543608-25543630 GAATTTTCCCAGGGGGTGGAAGG - Intergenic
1124093736 15:26629494-26629516 ATGTGTTGGCAGGAGGAGGAGGG + Intronic
1126363535 15:47870763-47870785 GGTTGTGCCCAGCAGGAGGAGGG - Intergenic
1127843378 15:62848871-62848893 GAGAGTTACCAGGAGGTGGCAGG - Intergenic
1128311813 15:66635648-66635670 GAATGCTCCCTGGAGGAGGCAGG - Intronic
1129052354 15:72793089-72793111 GCGTGAACCCAGGAGGCGGAGGG - Intergenic
1129168829 15:73795643-73795665 GAGGGCTTCCTGGAGGAGGAAGG + Intergenic
1129168920 15:73796146-73796168 GAGCGCTTCCTGGAGGAGGAAGG - Intergenic
1129232737 15:74205783-74205805 GTGTCTTCCCATGAGGAGGGAGG - Intronic
1129828262 15:78650034-78650056 GAGTGTGCCCAGGAGGAGGATGG + Intronic
1130233521 15:82114190-82114212 GAGCCTACTCAGGAGGAGGAAGG + Intergenic
1130538427 15:84803232-84803254 GAGTGTAGCCAAGAGGAGTAGGG - Exonic
1131387911 15:92022822-92022844 GAGGCTTCCCAGGAAGAAGAAGG + Intronic
1132347321 15:101116181-101116203 GAGTGTTGGCAGGAAGAGGCTGG - Intergenic
1132447017 15:101932851-101932873 GAGTGTTCCAATGTGGAGGAAGG + Intergenic
1132457104 16:30025-30047 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1132656608 16:1044241-1044263 CAGGGGTCCCAGGAGGAGGGCGG - Intergenic
1132762924 16:1519717-1519739 GAGGGCTCCCAGGAGGAGGTGGG + Intronic
1132879122 16:2153563-2153585 GACTGTTGCTGGGAGGAGGAAGG - Exonic
1133267340 16:4593122-4593144 AAGCCTTCCCAGCAGGAGGAAGG - Intronic
1133725261 16:8531375-8531397 CAGTGTTCCAAGGAGGGGGTTGG - Intergenic
1134249635 16:12565445-12565467 GAGAGAACCCAGGATGAGGAGGG - Intronic
1134321370 16:13167415-13167437 GAGTGTTCTAAGGAGAAGAAAGG - Intronic
1134352120 16:13447363-13447385 TAGTGTTCCAAGGAGGTGGCAGG + Intergenic
1135927417 16:26707848-26707870 GAGTGGTCCCTGGGTGAGGATGG + Intergenic
1135971381 16:27074390-27074412 GAGGGTTCCCAGGAGAAGCAGGG + Intergenic
1135980384 16:27142508-27142530 GAGTCTTCCCAGGAAAAGGGTGG + Intergenic
1136568088 16:31081713-31081735 GAAGGGTCCCAGGAGGAGGTGGG + Intronic
1137506222 16:49056223-49056245 AAGTGTTGCCAGGTGGAAGAAGG - Intergenic
1137741401 16:50779732-50779754 GTGAGTTCACAGGAGGAGGCTGG - Exonic
1138010454 16:53373982-53374004 GAGTGTTCCCAACAGGATGCTGG - Intergenic
1138313936 16:56052252-56052274 CACTGTTCTCAGGATGAGGAAGG + Intergenic
1139321706 16:66119662-66119684 GAGTGTTCCCATCCAGAGGAGGG + Intergenic
1139531341 16:67544139-67544161 GAGGATTTCCAGAAGGAGGAAGG - Intronic
1139921182 16:70461516-70461538 GAGAGTGCCCTGGAGGAAGATGG + Intronic
1140404590 16:74700421-74700443 GGGTCTTCCCAGGAGGCGGCGGG - Intronic
1140595547 16:76405651-76405673 GAGTAGTCTGAGGAGGAGGAGGG + Intronic
1141096381 16:81165895-81165917 CAGTTTTCCCAGCAGGAGGGTGG + Intergenic
1141642516 16:85349522-85349544 GAGTGTCCCCAGCAGGGGCAGGG + Intergenic
1141974694 16:87507772-87507794 AAGTGTGACCAGGAGGAGGCTGG + Intergenic
1142768731 17:2081413-2081435 GCCTGTTCCCAGGGAGAGGATGG - Intronic
1143014840 17:3886213-3886235 GAGGGCTCCCTGGAGGAGGCGGG - Intronic
1143383097 17:6508530-6508552 TAGTGCTTCCTGGAGGAGGAAGG + Intronic
1143543317 17:7582260-7582282 CAGTGGCCCCAAGAGGAGGAAGG - Intergenic
1143658682 17:8311978-8312000 GAGTCATCCCCTGAGGAGGAGGG - Exonic
1144629089 17:16861308-16861330 GAGTCAGCCTAGGAGGAGGAAGG + Intergenic
1144652326 17:17014806-17014828 GAGTCAGCCTAGGAGGAGGAAGG - Intergenic
1145251767 17:21300684-21300706 GAGGGCTCCCTGGAGGAGGCGGG + Intronic
1145296532 17:21597544-21597566 GAGTGCTTCCCAGAGGAGGAAGG - Intergenic
1145367249 17:22274528-22274550 GAGTGCTTCCCAGAGGAGGAAGG + Intergenic
1145780929 17:27562600-27562622 AGGTGGTCCTAGGAGGAGGAGGG - Intronic
1146689729 17:34865135-34865157 GAGTGATCGCAGAGGGAGGATGG - Intergenic
1147015987 17:37491384-37491406 GAGGGTTGCCACGAGGAGGTAGG + Intronic
1147181869 17:38691468-38691490 GAGTTTTCAGAGGAGGGGGATGG + Intergenic
1147186282 17:38715038-38715060 GAGATTTCCCAGGAAGAGTAAGG + Intronic
1147736557 17:42642469-42642491 GGGTTCTCCCAGGAGGATGAGGG - Intergenic
1147914555 17:43878746-43878768 GCGCCTTCCCAGGAGGTGGAGGG - Intronic
1148155553 17:45423490-45423512 GAGTGCTTCCTGGAGGAGGAAGG - Intronic
1148194621 17:45704429-45704451 GGGTGATCCCAGGAGGAGGCTGG + Intergenic
1148208569 17:45794641-45794663 GAGTGTGACAAGGAGGGGGAAGG - Intronic
1148561737 17:48610400-48610422 GAGTGCTCCCAGCCGGAGGTCGG - Intronic
1149542475 17:57478045-57478067 GAGTCTTCTCAGGAGCAGGCCGG - Intronic
1149680385 17:58503015-58503037 ATGGGTTCCCAGCAGGAGGATGG - Intronic
1150387240 17:64772147-64772169 GAGTGCTTCCTGGAGGAGGAAGG - Intergenic
1151359929 17:73582721-73582743 GGGGGTACCCAGGAGGAGAAGGG - Intronic
1151362807 17:73598708-73598730 GGGTGGTCCCTGGAGGGGGATGG - Intronic
1151996437 17:77612216-77612238 CAGTGTTTCCAGAAGGAGGGCGG + Intergenic
1152694275 17:81735808-81735830 GAGAAGTCCCAGGAGAAGGAAGG - Intergenic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1152961093 18:80546-80568 GAGGGCTTCCTGGAGGAGGAGGG - Intergenic
1153299663 18:3581597-3581619 GAGTGTAGCCAAGAGGAGTAGGG - Intronic
1155323954 18:24647353-24647375 AAGAGTTCCCAGGAGCAGGAAGG - Intergenic
1155448251 18:25935496-25935518 GACAGTTCCCAGGAGCAGCAGGG - Intergenic
1155666426 18:28315147-28315169 AAGTATTCCCAGGTGCAGGAAGG - Intergenic
1156355813 18:36339193-36339215 GAATGCTCCCAGGAGGTTGATGG + Intronic
1156388377 18:36626916-36626938 CTGTTATCCCAGGAGGAGGAGGG + Intronic
1156932134 18:42658412-42658434 GAGTCTACACAGGAGGAGGTGGG + Intergenic
1157401864 18:47395453-47395475 CTGTGTTCCCAGCAGGAGGAAGG + Intergenic
1160575795 18:79853120-79853142 AAGTGTTCCCAGGAATACGAGGG + Intergenic
1160638259 19:99682-99704 GAGTGTTCCAATGTGGAGGAAGG - Intergenic
1160752676 19:741781-741803 CAGGGACCCCAGGAGGAGGAGGG + Intronic
1160817935 19:1044814-1044836 TGGTGTTCCCAGGGGGAGGCGGG + Intronic
1160905980 19:1451935-1451957 GTGTGTGGCCAGGTGGAGGAGGG + Exonic
1161341387 19:3744843-3744865 GCTTGATCCCAGGAGGCGGAGGG + Intronic
1162013797 19:7832787-7832809 GGGTCTTCCCAGGAGGACCACGG + Intronic
1162516096 19:11148750-11148772 GCGTGGTCCCAGCAGGAGAATGG - Intronic
1162795046 19:13082640-13082662 GAATGATCCCAGGAGGTGGTGGG + Intronic
1162897801 19:13775868-13775890 AAGTGATCACAGGGGGAGGAGGG - Intronic
1163023193 19:14494921-14494943 CAGTGTGGCCAGCAGGAGGAGGG + Intronic
1163783328 19:19261708-19261730 GTGAGGTCCCAAGAGGAGGAGGG - Intronic
1163886077 19:19966103-19966125 GACTGTTCCTTGGTGGAGGAGGG + Intergenic
1164203554 19:23039200-23039222 GAGTGTGCCCAGGCCGAGCATGG - Intergenic
1165158912 19:33804498-33804520 GAGAGTTCCCAGGAGGCTGAGGG + Intronic
1165418491 19:35710413-35710435 GAGTCAGCCCAGGAAGAGGAAGG + Intronic
1165864074 19:38925407-38925429 AAGTGGGCCCAGGTGGAGGATGG + Intronic
1165941758 19:39417975-39417997 GCGCGTTCCGAGGAGGCGGAGGG + Exonic
1166060590 19:40323148-40323170 GAATCTTACCATGAGGAGGATGG - Intronic
1166123304 19:40698930-40698952 GAGTGTTCCCAGCAGAGGGCAGG - Intronic
1166200033 19:41231361-41231383 GTGGGTTCCCAGGGAGAGGATGG - Intronic
1166310744 19:41961075-41961097 AGGTGTTCCCAGGAGGTGGGAGG + Intergenic
1166621259 19:44303410-44303432 GCCTTTTCCCAGAAGGAGGAGGG - Exonic
1167121769 19:47521452-47521474 GAGTGTTTCCAGGAGAAAGCTGG + Intronic
1167466628 19:49653708-49653730 GAGTGTCCCCTGGGGGAGGGTGG + Intronic
1167776500 19:51561103-51561125 GAGGTCTCCCTGGAGGAGGAGGG + Intergenic
1168125398 19:54279868-54279890 GTGTGTTCCCAGGTGATGGATGG + Exonic
1168169087 19:54574483-54574505 GCGTGTTCCCAGGTGATGGATGG - Exonic
1168171864 19:54594850-54594872 GTGTGTTCCCAGGTGATGGATGG - Exonic
1168176593 19:54631685-54631707 GTGTGTTCCCAGGTGATGGATGG - Exonic
1202713458 1_KI270714v1_random:29824-29846 GAGTGTGCCCAGGAGGAAGAGGG - Intergenic
924985139 2:264015-264037 GAGGCTGCCCAGGAAGAGGAAGG + Exonic
924985266 2:264485-264507 GAGGGGTACCTGGAGGAGGAAGG - Intronic
925018931 2:553581-553603 CTGTGTTCCCAGGAGGAGGTCGG + Intergenic
925169091 2:1740149-1740171 GAGGGTGCAGAGGAGGAGGAGGG + Intronic
925307188 2:2856889-2856911 GAGAGTTCTGAGGAGGTGGATGG - Intergenic
927146908 2:20172291-20172313 AAGTGTTTCTTGGAGGAGGAAGG + Intergenic
927758176 2:25725483-25725505 CAGTGGTCTCAGGAGGAGGAAGG - Intergenic
927940981 2:27102583-27102605 GAGTCTGGCCTGGAGGAGGAAGG + Exonic
928181672 2:29072553-29072575 GACTGGTCTGAGGAGGAGGAGGG - Exonic
928312511 2:30222566-30222588 GAGTCTTCCCAGGGGTAGGGGGG - Intergenic
929121128 2:38484857-38484879 GAGTGGTCCCTTCAGGAGGAAGG - Intergenic
929544301 2:42845765-42845787 GAGGGATCCAGGGAGGAGGAGGG + Intergenic
929639125 2:43558495-43558517 GTGTTTACCCAGGTGGAGGATGG - Intronic
930000740 2:46859983-46860005 CAGTGACCCCAGAAGGAGGAAGG + Intergenic
932277737 2:70463991-70464013 CGGTGTTCCGAGGAGGAGGGTGG + Intronic
932702454 2:74001138-74001160 CTGTGTTCCCAGGGGGAGGCAGG + Intronic
934522735 2:95030193-95030215 GAGTCCTCACAGGAAGAGGAAGG + Intronic
934896834 2:98126887-98126909 GACTGTGCCAAGGAGGTGGAAGG - Intronic
937009614 2:118550848-118550870 GGGTGTTCCCAGCAGGGTGATGG - Intergenic
937071829 2:119069655-119069677 GAGTATGTCCAGGAGAAGGAAGG + Intergenic
937109383 2:119351299-119351321 AAGTGTTCCTAGGCGCAGGAAGG - Intronic
937295666 2:120808389-120808411 GAGAGGTCACAGGAGGATGATGG - Intronic
938594774 2:132776846-132776868 GAGTTTTCCCGGGAGTAAGAGGG + Intronic
941956495 2:171210865-171210887 GACTGTTACCAGGAGGGAGAAGG + Intronic
944141703 2:196463959-196463981 GAGTTTTCATAGGTGGAGGAAGG - Intronic
945142156 2:206698472-206698494 GAGGGTTCCCGGAAGGAGAAGGG - Intronic
947731374 2:232433374-232433396 CAGTGTGCCCAGGAGGAGAGGGG + Intergenic
948167949 2:235877802-235877824 GGGTGTACCCAAGAGGGGGAGGG - Intronic
948602585 2:239115832-239115854 GAGTGTTCCCAGGATCCGGCAGG - Intronic
948853956 2:240721446-240721468 GGTCGGTCCCAGGAGGAGGAGGG + Intronic
1169110879 20:3032959-3032981 AAGTGTTCTGAGGAAGAGGAGGG - Intronic
1169224240 20:3846513-3846535 CAAAGTTCCCAGGGGGAGGAGGG + Intergenic
1171451227 20:25237477-25237499 CAGTCTTCCCAGGAGGAGGCCGG - Intergenic
1172012933 20:31856924-31856946 GAGTGTTTCAAGGAGGAGGGAGG + Intronic
1172042023 20:32052527-32052549 GAGGGGTCCCAGGAGGCGGAGGG + Intronic
1172253438 20:33496171-33496193 GGCTTTTCCCAGGAGAAGGAAGG + Intronic
1172308084 20:33895960-33895982 GGGTGTTCAAAGGAGGAGAAGGG + Intergenic
1172774175 20:37397683-37397705 GCGTGTTCTGAGGAGGAGGCAGG - Exonic
1173400574 20:42722407-42722429 GACTATTTCCAGGAGCAGGAGGG - Intronic
1173419338 20:42887081-42887103 GAGCGTTTAAAGGAGGAGGATGG - Intronic
1173585877 20:44182660-44182682 GAGTCGTCTCAGAAGGAGGATGG - Intronic
1173795746 20:45858037-45858059 GAGGGCTGCCTGGAGGAGGAGGG + Intronic
1175295316 20:57904287-57904309 GAGTAGGCTCAGGAGGAGGAGGG - Intergenic
1175399074 20:58689778-58689800 GTGTGTGGCCAGGAGGAGGAAGG - Intronic
1175715319 20:61251732-61251754 GAGTTTTCCTAGGAGCGGGAGGG + Intergenic
1175851792 20:62097696-62097718 GAGGGTTCCCAGGAAGAGGGTGG + Intergenic
1176296640 21:5076660-5076682 GTGAGTGACCAGGAGGAGGAGGG + Intergenic
1176912444 21:14582402-14582424 TAGTGTTAGCACGAGGAGGAAGG - Exonic
1176986588 21:15444660-15444682 GAGTCCTTCCAAGAGGAGGATGG - Intergenic
1179247360 21:39645445-39645467 GAATTTTCCCAGCAGGAGGTAGG + Intronic
1179681223 21:43022474-43022496 GAGTGGTCCTGGGAGGAGAAGGG + Intronic
1179860409 21:44185461-44185483 GTGAGTGACCAGGAGGAGGAGGG - Intergenic
1180148754 21:45936867-45936889 GAAGATCCCCAGGAGGAGGATGG - Intronic
1180228870 21:46414455-46414477 CTGTGTGTCCAGGAGGAGGAGGG - Intronic
1180611531 22:17101329-17101351 GGGTGGTCCCAGGATGAAGAAGG - Intronic
1181855100 22:25775617-25775639 GTGTGTTTCCAGGAAGAGGGAGG - Intronic
1181949939 22:26546537-26546559 CTGTGTTCCCTGGAGGGGGATGG - Intronic
1182737306 22:32540045-32540067 AAGTGTTCCCAGGAAAGGGATGG - Intronic
1182748869 22:32626112-32626134 GGGTGTTCCCAGTAGGCAGAGGG + Intronic
1183540504 22:38426898-38426920 GCGGGTTCCAAGGAGGAGGCGGG - Exonic
1184693599 22:46128245-46128267 GCATGTGCTCAGGAGGAGGATGG - Intergenic
950114379 3:10441155-10441177 CAGTGTAGCCAGGGGGAGGAAGG - Intronic
950457247 3:13100044-13100066 GAGAGTTCCGAGTAGGAGGATGG + Intergenic
950622063 3:14213762-14213784 GAGAGTTCCCAGGAAGGAGAGGG - Intergenic
953405837 3:42659382-42659404 GAGAGCTCTGAGGAGGAGGAGGG + Exonic
953417697 3:42732357-42732379 GAGTGTTGACAGCAGGAGCATGG + Intronic
954004075 3:47578438-47578460 GAATGGTCCCAGGAGGTGGTGGG - Intronic
954370733 3:50168501-50168523 GGGTGTGCCAAGCAGGAGGAAGG + Intronic
954390553 3:50266053-50266075 GAGTGAACACAGGTGGAGGAAGG + Intergenic
954406828 3:50349872-50349894 GGGTTGTCCCAGGAGGAGGAAGG - Intronic
954591184 3:51784049-51784071 GATTGCTTCCAGGAGGCGGAGGG - Intergenic
954868844 3:53751583-53751605 GAGTGGTGCCAGCAGCAGGAAGG + Intronic
955202371 3:56862541-56862563 GGGGGTTCCCAGGCGGAGGGGGG - Intronic
955789507 3:62573666-62573688 GAGTTTTCCCATGAGGAGCAGGG - Intronic
956368471 3:68532226-68532248 GGGTCTTCCCAGGAGGAGGAGGG + Intronic
957065876 3:75521853-75521875 GCATCATCCCAGGAGGAGGAGGG - Intergenic
957078158 3:75617822-75617844 GAGTGTTCTCTGGAGGTGGCTGG - Intergenic
958095280 3:88936177-88936199 GATTGTTCCCAGTGGGAGCAAGG - Intergenic
958916120 3:100052452-100052474 GAGTGCACCCAGTTGGAGGATGG + Intronic
961899817 3:130199761-130199783 GCATCATCCCAGGAGGAGGAGGG - Intergenic
962644262 3:137420386-137420408 CAGTGTGTCCAGGAGGAGAAGGG - Intergenic
962682554 3:137815290-137815312 TAGAGTTGTCAGGAGGAGGAGGG + Intergenic
962842543 3:139249003-139249025 ATGTGTTGCAAGGAGGAGGATGG - Intronic
964060652 3:152518311-152518333 CAGAGTTGCCAGGAGGAGCAGGG - Intergenic
964720586 3:159764650-159764672 GAGTGGGCGCCGGAGGAGGACGG + Exonic
966430502 3:179827272-179827294 GAGTGTCCTCAGGAAGAGGTAGG - Intronic
966746641 3:183283344-183283366 GAATGTTGACAGGAGGAGGAGGG - Intronic
966872082 3:184297513-184297535 GAGTGTTCCCACTAGGTGAAAGG + Intronic
966908858 3:184546805-184546827 GCGTGAACCCAGGAGGCGGACGG - Intronic
967276917 3:187784840-187784862 GAGTGATCAGAGGAGGAGGGTGG + Intergenic
967939899 3:194757459-194757481 GAGTCTTCCCATGGGGAGGCAGG + Intergenic
968609453 4:1550428-1550450 GCGTGTTCTCAGGAGCAGGTGGG + Intergenic
968745183 4:2356273-2356295 GACTGTTCACAGGAGGCTGACGG + Intronic
968845494 4:3039131-3039153 GCGTGAACCCAGGAGGTGGAGGG + Intronic
968899289 4:3423347-3423369 GACTTTTCCCACGTGGAGGAAGG + Intronic
969010474 4:4057917-4057939 GCATCATCCCAGGAGGAGGAGGG - Intergenic
969021233 4:4141795-4141817 GAGTGTTCTCTGGAGGTGGCTGG - Intergenic
969088376 4:4673317-4673339 GCGTGGTCCGAGGAGGAGGTGGG - Intergenic
969497611 4:7535027-7535049 GTGTGTCAGCAGGAGGAGGAGGG - Intronic
969607157 4:8208084-8208106 GAGGGTTGCCAGGTGGAGGATGG - Intronic
969732634 4:8965621-8965643 GAGTGTTCTCTGGAGGTGGCTGG + Intergenic
969792216 4:9499704-9499726 GAGTGTTCTCTGGAGGTGGCTGG + Intergenic
969802985 4:9584079-9584101 GCATCATCCCAGGAGGAGGAGGG + Intergenic
970058424 4:12001410-12001432 TAGTGATCACATGAGGAGGAAGG + Intergenic
972247275 4:37258662-37258684 GAGTGTCAGCAGGTGGAGGAAGG + Intronic
972772493 4:42210573-42210595 GTGTGTTGCAGGGAGGAGGAGGG + Intergenic
973218411 4:47697762-47697784 GAGAATTCCCATGAGGAGAAAGG + Intronic
974708611 4:65557957-65557979 GCTTGAACCCAGGAGGAGGAGGG - Intronic
975103478 4:70541337-70541359 GAGACTTCCCAGGGGGAGCAGGG - Intergenic
978104955 4:104890809-104890831 GGGCATTCCCAGCAGGAGGAAGG + Intergenic
978588236 4:110295581-110295603 GAGTGTTCTCAGTAGAAGGGTGG + Intergenic
979327275 4:119394802-119394824 AAGAGTTCCCAAGAGAAGGATGG - Intergenic
980613894 4:135193992-135194014 AATTGTTACCAGGAGGAGGGTGG + Intergenic
981797092 4:148607854-148607876 TAGTGTTCCCAACAGGAGGAAGG - Intergenic
982036148 4:151348035-151348057 GTGGGTTCACAGGAGTAGGAAGG + Intergenic
982360264 4:154511953-154511975 CATTGTTCCCAGGAGGAAGGTGG + Intergenic
983245159 4:165279490-165279512 AAGAGTTCCCAAGAGAAGGATGG - Intronic
984361661 4:178742579-178742601 GTCTGTTCCCAGGAGGATTATGG + Intergenic
984972370 4:185203045-185203067 GAGTTTTGCCAGGAGGGGCATGG + Intronic
985375587 4:189334047-189334069 GAGTGTTCCCACCAGCAAGAAGG - Intergenic
985903894 5:2818334-2818356 GAGTGTTGACAGGTGGAGGCTGG + Intergenic
986192032 5:5506278-5506300 GAGTATGCTGAGGAGGAGGAGGG - Intergenic
986445251 5:7815746-7815768 GTGTCATCCCACGAGGAGGAGGG - Intronic
986796926 5:11221831-11221853 AAGTGTCACCAGGAGGAGAAAGG + Intronic
990003417 5:50921400-50921422 GCGTGTTCTCAGGAGCAGGTGGG - Intergenic
990616219 5:57511204-57511226 GAGTGGTGAAAGGAGGAGGAAGG + Intergenic
990868465 5:60405273-60405295 CAGTTTTCCCAAGAGGAGCAAGG + Intronic
992396906 5:76376995-76377017 GCATCATCCCAGGAGGAGGAGGG - Intergenic
992931784 5:81654878-81654900 GAGTAATCCCAGGAAGTGGAAGG + Intronic
997727927 5:136137638-136137660 GTGTGTTCCCAGGAAGAGGGGGG + Intronic
997880958 5:137589251-137589273 GAGTGTTTCCAGGAAGAGGAAGG + Intronic
998161959 5:139818053-139818075 GCAGGTTCCCAGGAGCAGGAGGG + Intronic
998497647 5:142604663-142604685 AAGTGTTCCCTGGAGGAAGGTGG + Intronic
999371259 5:151056681-151056703 GTGGATTCCCAGGAGCAGGAAGG + Intronic
1001417419 5:171555708-171555730 GAGTGTCCCCTGGTGGAGGTCGG - Intergenic
1002087996 5:176787746-176787768 GAATGGTCCCAGAAGGAAGAGGG - Intergenic
1002715751 5:181225868-181225890 CAGTGGGACCAGGAGGAGGAGGG + Intronic
1002856605 6:1043547-1043569 GAGTGCTCCAGGGAGGACGAGGG - Intergenic
1002933049 6:1647417-1647439 GAGTGTCCCCAGCAGGCTGAAGG + Intronic
1003460920 6:6327405-6327427 GAGTGTTCCCAAGAGTAATATGG + Intergenic
1003568270 6:7239022-7239044 GTGTTTTCCCAGGGGAAGGAGGG - Intronic
1003894238 6:10591665-10591687 GAGTGGTACTAGCAGGAGGAGGG - Intronic
1004284537 6:14308571-14308593 GAGGGTGCCCAGGAGAAGGTGGG - Intergenic
1004760166 6:18657003-18657025 GAATGTCCCCTGGTGGAGGAGGG - Intergenic
1004866294 6:19856566-19856588 CAGTGGTGCCAGGAGGAGGGGGG + Intergenic
1005009568 6:21322973-21322995 GAGTTTTCTGAGGAGGAGGAGGG + Intergenic
1005192959 6:23247190-23247212 GAATTTTCCCAGGAGCAGAATGG + Intergenic
1006544729 6:34770361-34770383 GCATCATCCCAGGAGGAGGAGGG - Exonic
1007133721 6:39500590-39500612 GAGAGAACCCAGGAGGAGAAAGG - Intronic
1007198266 6:40082438-40082460 GAGTGGTCCCAGGTGGAGGAGGG - Intergenic
1010585819 6:77657885-77657907 TAGTGTGAACAGGAGGAGGAGGG - Intergenic
1012018851 6:93890197-93890219 GAGTGTTGCAAGAAGGTGGAAGG - Intergenic
1015556600 6:134468724-134468746 GAGTGTTCCCAGAAAGAGTGGGG - Intergenic
1015897511 6:138031585-138031607 GAAAGTTCTCAGGAGAAGGAAGG + Intergenic
1017940436 6:159048116-159048138 GGGTGGTCCCAGGAAGAGAAAGG - Intergenic
1019472270 7:1227363-1227385 GAATGTGGCCAGGAGGAGAAGGG - Intergenic
1019720540 7:2567905-2567927 TGATGTTCCCCGGAGGAGGAGGG + Intronic
1020308649 7:6853824-6853846 GAGTGTTCTCTGGAGGTGGCTGG - Intergenic
1020634890 7:10684966-10684988 TTATGTTCCCAGGAGGATGATGG - Intergenic
1021287085 7:18793643-18793665 GAGTGTTCTCAGGCAGAAGAAGG - Intronic
1023662226 7:42481536-42481558 GTGTGTGCACAGCAGGAGGAGGG + Intergenic
1023878683 7:44306727-44306749 GGGTGTGGGCAGGAGGAGGAGGG + Intronic
1023878754 7:44306982-44307004 GGGTGTGAGCAGGAGGAGGAGGG + Intronic
1024485244 7:49910213-49910235 GAGTTCGCCCAGGAGGTGGAGGG - Intronic
1024921657 7:54563509-54563531 CAGTGTCCCCAGCAGGAGGAAGG + Intronic
1025003723 7:55339454-55339476 GGGTGTGCCCAAGAGCAGGAGGG + Intergenic
1025230676 7:57201620-57201642 CAGTGTGGCCAGGAGGAGGCAGG - Intergenic
1025712158 7:63922076-63922098 GCTTGAACCCAGGAGGAGGAGGG + Intergenic
1026906915 7:74068132-74068154 GACTATTCCCAGGAGGGGGTAGG + Intronic
1027249469 7:76389989-76390011 GAGGGCTTCCTGGAGGAGGAAGG + Exonic
1027875553 7:83763434-83763456 GAGTTTTCCCAGGTGGATGAAGG + Intergenic
1029497390 7:100903385-100903407 AAGTGCGCCCAGGACGAGGATGG - Intergenic
1029514672 7:101017826-101017848 AAGGGGTCCCAGGGGGAGGAAGG - Intronic
1029514796 7:101018072-101018094 GAGGGGTCCCAGGGGGAGGGAGG - Intronic
1030143281 7:106327261-106327283 GACAGTTCCTAGAAGGAGGAGGG - Intergenic
1032463173 7:132126634-132126656 GACTGTTCCCAGGAAGAAGCAGG - Exonic
1032540692 7:132700470-132700492 GACTGTGCCCAGGTGCAGGAGGG + Intronic
1033004768 7:137549471-137549493 GTGTGTTCCCAGTAAGAAGAAGG - Intronic
1033615247 7:143008021-143008043 GCCTGTTCCCCGGAGGATGAAGG - Intergenic
1034224316 7:149471065-149471087 GAGTGATTCCTGTAGGAGGAAGG + Intergenic
1034226428 7:149487785-149487807 GAGTGTTCCAATGAGTAGAAAGG + Intronic
1034439358 7:151078785-151078807 GAGGGCTGACAGGAGGAGGAAGG - Intronic
1034900215 7:154903572-154903594 GAGGGCTCCGAGGTGGAGGATGG + Intergenic
1034907756 7:154965563-154965585 GAGTGGGCCTAGGAGGAGGAGGG - Intronic
1035451706 7:158980984-158981006 GAGTGTTCGCTGGAGATGGAGGG + Intergenic
1035469268 7:159099408-159099430 GGGTGTGCCCAGGAGGAGACAGG + Intronic
1035470158 7:159104508-159104530 GGGTGCTGCCAGGAGGAGGTAGG - Intronic
1035670441 8:1412912-1412934 GAATTTTCCCAGCAGGAGGGAGG - Intergenic
1036248792 8:7143769-7143791 GCATCATCCCAGGAGGAGGAGGG + Intergenic
1036687904 8:10924095-10924117 GAGAGGGCCCAGGAGGAGGAGGG - Intronic
1036822827 8:11953839-11953861 GAGTAACCCCAGGAGCAGGAAGG - Intergenic
1036885460 8:12549232-12549254 GCATCATCCCAGGAGGAGGAGGG - Intergenic
1036964344 8:13279296-13279318 GTGTGTTGCTAAGAGGAGGAGGG - Intronic
1037782838 8:21882491-21882513 AAGTGTTTGGAGGAGGAGGAGGG - Intergenic
1037784627 8:21895227-21895249 GAGTATTCCGAACAGGAGGAAGG + Intergenic
1039355991 8:36816245-36816267 ATGTGTTCCCAGGAGGAAAATGG + Intronic
1039963420 8:42267085-42267107 GTGTGAACCCAGGAGGTGGATGG - Intergenic
1041509078 8:58634379-58634401 GAGTGTCCCTAGGAGGCAGATGG - Intronic
1041903584 8:63008214-63008236 TAGAGTTTCCAGGAGGAGGGGGG - Intergenic
1042194311 8:66219493-66219515 GAGTGTTATAGGGAGGAGGAAGG + Intergenic
1043413725 8:80027978-80028000 CAGTTTTTCCAGGAGGAGGCTGG - Intronic
1045410260 8:101910171-101910193 AAGTGGTCCCAAGAAGAGGATGG + Intronic
1048679919 8:136829881-136829903 GGGTTTTAGCAGGAGGAGGAGGG + Intergenic
1048766499 8:137850117-137850139 GTGTGCTCCAATGAGGAGGATGG - Intergenic
1048997161 8:139801225-139801247 AAGTCTCCCCAGGAAGAGGAAGG - Intronic
1049352197 8:142170343-142170365 GAGGGCTTCCTGGAGGAGGAGGG + Intergenic
1049408160 8:142460803-142460825 GAGAGTGCTCAGGAGGTGGAAGG - Intronic
1050648939 9:7754397-7754419 CACTGTGCCCAGGAGGAAGAAGG + Intergenic
1051154566 9:14126483-14126505 CAGTCTCCCCAGGATGAGGAAGG + Intronic
1051355968 9:16239996-16240018 GAGGGTTGCGGGGAGGAGGAGGG - Intronic
1051878056 9:21811625-21811647 GAGTGAGCCAAGGAGGAGGTAGG - Intronic
1052203620 9:25811540-25811562 GAGTGTTTTCAGGAGGAAGCAGG + Intergenic
1054706277 9:68465540-68465562 GAGTGTTCCCCTGCGGATGAGGG - Intronic
1055709588 9:79045458-79045480 AAGTACTCCCAGGTGGAGGAGGG - Intergenic
1056297329 9:85206003-85206025 CACTGGTCCCAGGAGGAAGATGG + Intergenic
1056329848 9:85512117-85512139 GACCTTTCCCAGGAGGAGGCTGG - Intergenic
1056575527 9:87853443-87853465 AAGTGTCCCCAAGAGGAGCATGG + Intergenic
1058770451 9:108226275-108226297 AAGTGTTCCATGCAGGAGGAAGG - Intergenic
1058836183 9:108860266-108860288 GAGTCTTCCAAGATGGAGGAAGG + Intergenic
1059266020 9:113031382-113031404 GGTTGTTTCCAGGAGCAGGAGGG + Intergenic
1059554607 9:115266836-115266858 GAGGGTTCTCAAGAGGAGGTAGG - Intronic
1059999852 9:119948405-119948427 CACTGGTTCCAGGAGGAGGATGG - Intergenic
1060246521 9:121951006-121951028 GAGTGTGCCCAGAAAGAAGATGG - Intronic
1060434924 9:123585036-123585058 GATTCTTCCCAGCAGGAGGGTGG + Intronic
1060887298 9:127163623-127163645 GTGTGTACCCTGGAGGAGGCAGG + Intronic
1060934585 9:127507822-127507844 GACTGTTGCCAGGAGGATGCTGG - Intronic
1061224756 9:129274703-129274725 GAGTGTTGCCAGGGGCTGGAGGG + Intergenic
1061545629 9:131302558-131302580 GGGTCTTCCCAGGAGGTGGCTGG - Intronic
1061888008 9:133602496-133602518 GAGCGCTCCCAGGAAGAGAAGGG + Intergenic
1061913148 9:133735366-133735388 GAGGGTTTCCTGAAGGAGGAGGG - Intronic
1062737068 9:138143440-138143462 GAGGGCTTCCTGGAGGAGGAGGG + Intergenic
1186174473 X:6910624-6910646 GAAGGCTCCCTGGAGGAGGAAGG + Intergenic
1186469095 X:9807363-9807385 GAGTGTCCCCAGGAGCAAGCAGG + Intronic
1186920149 X:14269888-14269910 GCGTGAACCCAGGAGGCGGAGGG - Intergenic
1187213681 X:17254141-17254163 CACTGTTCCCAGGGGGATGAAGG - Intergenic
1187429025 X:19204496-19204518 TAGTGTTTGCAGGAGGACGAAGG + Intergenic
1188201575 X:27299053-27299075 GTGTGTTCCTAGGAGGAAGCAGG - Intergenic
1188422511 X:30007410-30007432 AAGTGTGCCCAGGAGAAGAAAGG - Intergenic
1188483811 X:30660893-30660915 GATTGAACCCAGGAGGCGGAGGG - Intronic
1188575522 X:31645273-31645295 GAGACTTCCCACAAGGAGGATGG - Intronic
1189101768 X:38197949-38197971 AAGTGTTCCCATGAGGCCGAAGG + Intronic
1189167894 X:38879653-38879675 GAGTATTCTCAGGAGGGGGAAGG + Intergenic
1190917037 X:54818491-54818513 GAGTGTTCGGAGCAGGGGGAAGG + Intergenic
1190964711 X:55288183-55288205 GTGTGAACCCAGGAGGCGGAGGG - Intronic
1191225543 X:58039031-58039053 GAACGTTCCCAGCAGGAAGAAGG + Intergenic
1191677592 X:63807943-63807965 AAGGGTTCCCAGGAGGACCATGG + Intergenic
1191778361 X:64842988-64843010 GAGTGAGCCCAGGAGGAGTGAGG - Intergenic
1196519380 X:116655036-116655058 AAGTGTTCCCAGGGGGATTATGG + Intergenic
1196824428 X:119730076-119730098 AAGTGTTCCCACTCGGAGGAAGG - Intergenic
1197715794 X:129705217-129705239 TAGTGATCCCAGGAGGCTGAAGG + Intergenic
1198162576 X:134022194-134022216 GAGTGTTTCAAGAATGAGGAAGG - Intergenic
1199767164 X:150949635-150949657 GAGAGGTCCCAGGAGCAGGCTGG - Intergenic
1200124399 X:153806444-153806466 GTGTATCCCCAGGAGGGGGATGG - Intronic
1200399255 X:156009701-156009723 GAGGGCTTCCTGGAGGAGGAGGG + Intronic
1202304258 Y:23451580-23451602 GAGTATACAGAGGAGGAGGATGG + Intergenic
1202566552 Y:26219011-26219033 GAGTATACAGAGGAGGAGGATGG - Intergenic