ID: 924650208

View in Genome Browser
Species Human (GRCh38)
Location 1:245919057-245919079
Sequence CAGTTACAGTATGCCGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 53
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 49}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924650208_924650212 -5 Left 924650208 1:245919057-245919079 CCTCCCTCGGCATACTGTAACTG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 924650212 1:245919075-245919097 AACTGCCTGGAACCATTACCTGG No data
924650208_924650215 7 Left 924650208 1:245919057-245919079 CCTCCCTCGGCATACTGTAACTG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 924650215 1:245919087-245919109 CCATTACCTGGACTACGCAATGG 0: 1
1: 0
2: 0
3: 5
4: 40
924650208_924650217 19 Left 924650208 1:245919057-245919079 CCTCCCTCGGCATACTGTAACTG 0: 1
1: 0
2: 0
3: 3
4: 49
Right 924650217 1:245919099-245919121 CTACGCAATGGCTTTCTAACTGG 0: 1
1: 0
2: 0
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924650208 Original CRISPR CAGTTACAGTATGCCGAGGG AGG (reversed) Intronic
905327759 1:37169939-37169961 CAGGTAAAGTAGGCTGAGGGAGG + Intergenic
908163077 1:61430873-61430895 CAGTTACAATATGGAGAAGGAGG - Intronic
923751321 1:236748820-236748842 AAGTTACAGTATGCCGTATGTGG + Intronic
924650208 1:245919057-245919079 CAGTTACAGTATGCCGAGGGAGG - Intronic
924740148 1:246790152-246790174 CAGGGACAGGAGGCCGAGGGAGG + Intergenic
1063179553 10:3585490-3585512 CAGTGACATTCTGCAGAGGGGGG - Intergenic
1067789506 10:49277165-49277187 CGGTTACAGGATGCCAATGGTGG - Intergenic
1073066506 10:100762850-100762872 GAGTGTCAGTATGCAGAGGGTGG + Intronic
1075547495 10:123366199-123366221 CAGTTACAGAATGGCGTTGGGGG - Intergenic
1086043544 11:82506921-82506943 CATCTACAGTTTGCAGAGGGAGG - Intergenic
1087147546 11:94826988-94827010 CTTTGACAGTATGCAGAGGGAGG + Intronic
1090353105 11:126120415-126120437 CAGGTACAGAATGCAGAAGGGGG + Intergenic
1097953125 12:65455092-65455114 CAGGTAAAGAATGCTGAGGGAGG - Intronic
1100819566 12:98418816-98418838 CATTTATAGTATGCAGATGGTGG + Intergenic
1101540816 12:105663552-105663574 CAGATTCAGTATGCCTGGGGTGG + Intergenic
1103717015 12:122950682-122950704 CAGCAAGAGTTTGCCGAGGGAGG - Intronic
1108287524 13:48923388-48923410 CAGGTACAGTATTCCTAGGAGGG + Intergenic
1121409239 14:93737837-93737859 CAGTTAGCTCATGCCGAGGGAGG - Intronic
1122730220 14:103791231-103791253 CAGCTACAGTAGGCTGAGGCAGG - Intronic
1134358880 16:13511652-13511674 AAGTTACAGTATAGGGAGGGAGG + Intergenic
1135343355 16:21667118-21667140 CAGTTACAGGATGGTGATGGTGG + Intergenic
1140934611 16:79658741-79658763 CAGTTACAGTGTGCACAGGAAGG + Intergenic
1144754338 17:17670023-17670045 CAGTTACAGAATGCTGAGGACGG - Intergenic
1151856398 17:76725292-76725314 CAGTTACAGGAGGCTGAGGCAGG + Intronic
1157593986 18:48852649-48852671 TAGTTACAGTATGCCCATGTGGG - Intronic
1162935032 19:13978019-13978041 CAGGTGCAGTATGTGGAGGGCGG - Exonic
930661255 2:54055956-54055978 TATTTACAGTATGCCTATGGGGG - Intronic
931432812 2:62222380-62222402 CGGTTCCAGTATGCCTCGGGAGG - Exonic
940882494 2:158960536-158960558 CAGTTAGAATATGCCTGGGGTGG - Intergenic
1172513190 20:35514703-35514725 CAGTTACAGGCTGCACAGGGAGG + Exonic
1178942891 21:36922468-36922490 CAGGTACAGCATGCCGAGTTTGG - Intronic
951586772 3:24222712-24222734 AAGTGACAGCATGCAGAGGGAGG + Intronic
957272473 3:78049670-78049692 CAGTTACAGAGTGCAGAGCGAGG + Intergenic
963715937 3:148804029-148804051 CAGTTACTGAATTCAGAGGGTGG + Intronic
964821603 3:160776712-160776734 CAGTTACAGGAGGCTGAGGCAGG - Intronic
974625742 4:64427381-64427403 CAGTTACAGGAGGCCGAGGTGGG - Intergenic
995234966 5:109818250-109818272 CAGTTACAGGAGGCTGAGGCAGG - Intronic
995290169 5:110443054-110443076 CGGTTACAGTATGCCTTGGGTGG - Intronic
995491534 5:112697451-112697473 CAGTAAAATAATGCCGAGGGAGG + Intergenic
996581726 5:125038703-125038725 CAGTTACTGCATGCTGAGAGGGG - Intergenic
998980932 5:147701464-147701486 CAGTTACAGTATTAAGAGGAGGG + Intronic
1001069250 5:168569936-168569958 CAGTTACAGGAGGCTGAGGCAGG + Intronic
1002842983 6:922147-922169 CATTTACATTATGCCTGGGGTGG - Intergenic
1007083938 6:39129448-39129470 CAGTTACAGTAAACACAGGGTGG - Intergenic
1011813037 6:91155065-91155087 AAGATACAGTATGATGAGGGAGG + Intergenic
1017159163 6:151349324-151349346 CAGTTTCAGGAAGCCGAAGGAGG + Exonic
1023996440 7:45161745-45161767 CAGTCAGAGTAGGCTGAGGGGGG + Intronic
1036368263 8:8140143-8140165 AAGTTACAGAATGACGAGAGAGG - Intergenic
1036882624 8:12525499-12525521 AAGTTACAGAATGACGAGAGAGG + Intergenic
1040563111 8:48542151-48542173 CAGTTACAGGAGGCCAAGGCAGG + Intergenic
1045357378 8:101401909-101401931 CAGAGACAGAATGCAGAGGGGGG - Intergenic
1055706229 9:79007819-79007841 CAGTTTCAGTATGTCGAGTTTGG - Intergenic
1194607812 X:96003660-96003682 CTGTTTCAGTAGGCCTAGGGTGG + Intergenic